Bacillus orientalis TB-1 and application thereof in degradation of polylactic acid mulching film

Abstract

The invention relates to bacillus orientalis TB-1 and application of the bacillus orientalis TB-1 in degradation of polylactic acid mulching films, and belongs to the technical field of microorganisms, the bacillus orientalis TB-1 is preserved in China General Microbiological Culture Collection Center (CGMCC) on October 24, 2024, and the preservation number is CGMCC NO.32326. The bacillus orientalis TB-1 is applied to degradation of polylactic acid mulching films. Bacterial liquid prepared from the strain is mixed into soil, the degradation rate of the polylactic acid mulching film can be obviously increased, the mulching film degradation strain library is further expanded, the PLA biological treatment means are enriched, and a new thought is provided for the mulching film degradation mode.

Description

Technical Field

[0001] The present invention belongs to the technical field of microorganisms, and in particular, relates to a Bacillus TB-1 and its application in degrading polylactic acid mulch film. Background Art

[0002] With the widespread use of plastics, "white pollution" has become a global problem. Degradable plastics are gradually replacing traditional plastics. Polylactic acid (PLA) is obtained by polymerization with lactic acid as raw material. The raw material is renewable, the production process is pollution-free, and it has good material properties and degradability. It is one of the most promising biodegradable plastics. PLA is widely used in the automotive industry, biomedicine, packaging, and agricultural mulch. However, PLA degrades slowly under natural conditions. As the amount of use increases, accumulation in the environment can still lead to white pollution. Therefore, screening effective PLA-degrading bacteria has become an important means to accelerate the degradation of PLA.

[0003] The PLA-degrading bacteria reported so far mainly include: Brevibacterium ( Bacillus brevis )、Pseudomonas( Pseudomonas sp ), Stenotonia maltose ( Stenotrophomonas maltophilia ) and fungi actinomycetes, all of which can degrade polylactic acid, but providing a new strain that can degrade PLA still has positive significance for reducing white pollution. Summary of the invention

[0004] In view of the problems raised in the background technology, the present invention provides a Bacillus sp. Bacillus toyonensis TB-1, bacterial solution containing the bacterium and method for degrading PLA using the bacterium, Bacillus toyota of the present invention Bacillus toyonensis The TB-1 strain can improve the degradation efficiency of PLA by reshaping the soil microbial community and enriching functional microorganisms. This not only further expands the library of mulch film degradation bacteria and enriches the biological treatment methods for PLA, but also provides a new idea for mulch film degradation.

[0005] To achieve the above object, the present invention is implemented through the following technical solutions: The Bacillus orientalis Bacillus toyonensis TB-1 was deposited in the China General Microbiological Culture Collection Center on October 24, 2024, with the deposit number CGMCC NO. 32326.

[0006] Furthermore, the 16S rDNA gene sequence of the strain TB-1 is shown in SEQ ID No.1.

[0007] The application of the Bacillus toyota TB-1 in the degradation of polylactic acid (PLA) mulch film.

[0008] The method of using the above-mentioned Bacillus TB-1 to degrade polylactic acid mulch is specifically as follows: a degradation agent containing Bacillus TB-1 is sprayed into the film-covered soil. The strain can reshape the soil microbial community, enrich functional microorganisms, and improve the degradation of polylactic acid (PLA) mulch.

[0009] Containing the above-mentioned Bacillus orientalis Bacillus toyonensis TB-1 bacterial suspension.

[0010] Beneficial effects of the present invention: Bacillus toyota provided by the present invention Bacillus toyonensis TB-1 can significantly accelerate the decomposition rate of polylactic acid mulch and improve the degradation efficiency of PLA. This not only further expands the mulch degradation bacterial strain library and enriches the biological treatment methods of PLA, but also provides a new idea for the mulch degradation method. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 For the present invention Bacillus toyonensis TB-1 colonies on NB medium; Figure 2 For the present invention Bacillus toyonensis Scanning electron microscope photo of TB-1; Figure 3 This is a phylogenetic tree constructed based on the 16S rDNA sequence of strain TB-1 and its similar strains; Figure 4 The polylactic acid (PLA) agricultural mulch film at 0 days after different treatment methods in Example 4 of the present invention; Figure 5 The comparison of the degradation effects of different treatment methods on polylactic acid (PLA) agricultural mulch film in Example 4 of the present invention; Figure 6 The figure shows a comparison of the degradation effects of different treatment methods on polylactic acid (PLA) agricultural mulch film in Example 5 of the present invention. DETAILED DESCRIPTION

[0012] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0013] In order to more clearly illustrate the present invention, it is described in detail through the following examples. Example 1

[0014] Bacillus toyota of the present inventionBacillus toyonensis TB-1 was deposited in the China General Microbiological Culture Collection Center on October 24, 2024, with the deposit number CGMCC NO. 32326. The 16S rDNA gene sequence of strain TB-1 is shown in SEQ ID No.1. Example 2

[0015] Bacillus toyota described in Example 1 Bacillus toyonensis Acquisition and identification of TB-1 (1) Strain screening method 1) Take the polylactic acid mulch from the tobacco-growing farmland of Xingfa Village, Dajima Town, Luquan County, Kunming City, Yunnan Province, shake off the soil, take 5g of the polylactic acid mulch, cut it into pieces less than 1 cm, put it into 100ml of liquid carbon-free culture medium, and shake and culture it at 30℃ and 100rpm for 48h. Boil the shake flask in boiling water for 30 minutes, cool it down, dilute it step by step, and spread it on NB solid culture medium and culture it at 30℃ for 48h. The formula of liquid carbon-free culture medium (1L) is: peptone 1g / L, magnesium sulfate 0.02g / L, potassium dihydrogen phosphate 0.5g / L, sodium chloride 0.5g / L, calcium chloride 0.1g / L. The formula of NB solid culture medium (1L) is: peptone 10g, beef powder 3g, sodium chloride 5g, agar 20g.

[0016] 2) Culture for 48 hours, pick a single colony, streak and purify it for 3 generations, and store it at 4℃ for later use.

[0017] 3) Inoculate the purified bacteria into 100 ml of sterile carbon-free culture medium respectively. Soak the unused polylactic acid mulch film in 75% alcohol for 2 minutes, rinse it with sterile water, dry it under sterile conditions and cut it into pieces. Weigh 1 g and place it in carbon-free culture medium. Shake and culture it at 30°C and 100 rpm for 15 days.

[0018] 4) After 15 days of shaking culture, the polylactic acid membrane was removed, rinsed with clean water, dried, and weighed. The strain with the largest mass reduction was selected, which was the Bacillus japonii of Example 1. Bacillus toyonensis TB-1.

[0019] (2) Identification of strains Strain morphology:

[0020] The strain was inoculated in NB and cultured on agar plates at a constant temperature (30°C) for (24) hours, and the colony morphology, color, edge, and culture medium color were observed. Figure 1 The colonies are beige, root-shaped, flat and opaque.

[0021] Gram stain:

[0022] Drop a drop of water in the center of the slide, mix a small amount of strains with water to make a smear, dry and fix; add crystal violet staining solution to the position where the bacteria are smeared, stain for 1-2 minutes, rinse with tap water; add 95% ethanol solution to decolorize for 20-30 seconds, and rinse with water; use absorbent paper to absorb the water on the slide, then add safranin staining solution to re-ignite for 2 minutes, rinse with water, and dry. Observe the bacteria under the oil microscope. Red bacteria are Gram-negative bacteria, and blue are Gram-positive bacteria.

[0023] TB-1 electron microscope scanning photos are attached Figure 2 .

[0024] Gram staining results: Gram staining was positive. Combined with the above morphological characteristics, strain TB-1 was identified as a Gram-positive bacterium.

[0025] Molecular biological identification of strain TB-1: The genomic DNA sample of strain TB-1 was extracted using a bacterial kit (DNAzol® BD Reagent, Thermo Fisher Scientific), and the sample DNA was PCR amplified using primers (27F:AGAGTTTGATCMTGGCTCAG) and (1492R:GTATTACCGCGGCTGCTGAG). The amplified product was sent to Beijing Novogene Technology Co., Ltd. for sequencing. The measured 16S rDNA (such as SEQ ID No.1) sequence was entered into the Blast alignment system in the NCBI data, and similar sequences in the database were searched to obtain sequence comparison results. The results showed that the measured 16S rDNA sequence was aligned with the model strain by BLAST. Bacillus toyonensis BCT-7112 T The similarity is 99.93% ( Figure 3 ), indicating that the strain is Bacillus toyota ( Bacillus toyonensis ). Example 3

[0026] A kind of bacteria containing Bacillus orientalis Bacillus toyonensis The preparation method of TB-1 bacterial solution comprises the following steps: Activation of strains: Inoculate the TB-1 stored on the slant onto the autoclaved solid culture medium under sterile conditions and activate and culture at 30°C for 24 hours. The formula of the solid culture medium used is (1L): 10g peptone, 3g beef powder, 5g sodium chloride, and 20g agar.

[0027] Seed liquid preparation: Inoculate the activated strain into the autoclaved liquid culture medium (50ml) under sterile conditions. Cultivate in a shaking incubator at 30°C for 1-2 days to obtain the seed liquid, with the shaking speed at 200rpm. The liquid culture medium formula (1L) is: 10g peptone, 3g beef powder, 5g sodium chloride.

[0028] Preparation of bacterial solution: Take 2 mL of seed solution and inoculate it into 300 mL of the above liquid culture medium sterilized by high pressure under sterile conditions, and culture it in a shaking incubator at 30°C for 24 h to obtain bacterial solution (OD660: 1.68) at a rotation speed of 200 rpm. Example 4

[0029] Contains Bacillus orientalis Bacillus toyonensis Application of TB-1 bacterial solution in degradation of polylactic acid mulch film Weigh 250g of soil and place it in a culture dish with an inner diameter of 15cm and a height of 2.5cm. Dilute the TB-1 original bacterial solution of Example 3 by 10 times to obtain a bacterial suspension (OD660: 0.96). Take 100ml of TB-1 bacterial suspension (B) and pour it into the culture dish. Cover the culture dish with a polylactic acid (PLA) mulch cut to 20cm×20cm, and press the edges tightly. In addition, a culture dish with an equal volume of clean water (CK) was used as a control group. The experiment set up 2 treatments, 3 dishes for each treatment, and placed them in an artificial climate box. 50ml of clean water was added to the culture dish every 7 days. Climate box conditions: lighting time 12 h, intensity 8000 lux, temperature: 25±2℃ during the day, 20±2℃ at night.

[0030] The test results are as follows Figure 4 and 5 As shown, Figure 4 Spraying the soil Bacillus toyonensis Photos of mulch film of TB-1 (B) and watered control group (CK) at day 0; Figure 5 Spraying the soil Bacillus toyonensis Photo of TB-1 and mulch film 15 days after watering.

[0031] Remark: Figure 4 and 5 The letter "B" stands for soil spray Bacillus toyonensis TB-1 bacterial solution, the letters "CK" represent water for soil spraying, and the spraying amounts of bacterial solution and water are the same.

[0032] The comparison shows that spraying Bacillus toyonensis After TB-1 bacterial solution, the decomposition rate of polylactic acid mulch film was significantly accelerated, which was specifically manifested in Bacillus toyonensis After 15 days of TB-1 treatment, cracks of different sizes appeared on the surface of the PLA film, and the PLA film pressed tightly at the edge of the culture dish could no longer be lifted off in one piece. The control group remained intact without any cracks and could be lifted off in one piece from the edge. This result shows thatBacillus toyonensis TB-1 bacterial solution can accelerate the degradation of polylactic acid mulch. Example 5

[0033] Cut the unused new polylactic acid mulch into 12 pieces, each weighing 1g, soak them in alcohol for 2min, rinse them with sterile water, dry them, cut each piece of 1g mulch into pieces, and put them into 100ml carbon-free liquid culture medium that has been sterilized at high temperature and high pressure and cooled. The experiment set up 4 treatments, 3 bottles for each treatment. CK is a carbon-free culture medium containing 1g polylactic acid mulch, B is a carbon-free culture medium containing polylactic acid inoculated with 2ml of TB-1 strain seed solution of Example 3, BS is a carbon-free culture medium containing polylactic acid with 5g of tobacco-growing area soil and 2ml of TB-1 strain seed solution, and S is a carbon-free culture medium containing polylactic acid with 5g of tobacco-growing area soil.

[0034] Carbon-free culture medium formula: Liquid carbon-free culture medium formula (1L) is: peptone 1g / L, magnesium sulfate 0.02g / L, potassium dihydrogen phosphate 0.5g / L, sodium chloride 0.5g / L, calcium chloride 0.1g / L.

[0035] Soil treatment in tobacco-planting areas: Collect planting soil from tobacco-planting areas, remove stones, weeds and other debris, place it in a culture dish to dry in the shade, grind it, pass it through a 200-mesh sieve, and weigh it for later use.

[0036] Effects of different treatments on the degradation of polylactic acid Figure 6 shown.

[0037] The results showed that after 15 days of different treatments, TB-1 strain treatment B reduced the weight of the mulch by 10.17%, and TB-1 strain mixed with soil treatment BS could reduce the weight of the polylactic acid mulch by 31.33%. The degradation rate was significantly higher than that of CK and soil S treatment. Stenotrophomonas maltophilia LB2-3 (10% weight loss at 30°C for 40 days) and Pseudomonas Pseudomonas WS3 (25% weight loss in 20 days at 30°C), the BS treatment was significantly more efficient.

[0038] The inventors speculated that the principle of bacterial liquid accelerating the decomposition of polylactic acid mulch is that Bacillus TB-1 participates in the reconstruction of soil microbial communities and accelerates the degradation of polylactic acid (PLA) mulch.

[0039] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A Bacillus TB-1, characterized in that The Bacillus orientalis Bacillus toyonensis TB-1 was deposited in the China General Microbiological Culture Collection Center on October 24, 2024, with the deposit number CGMCC NO. 32326.

2. The Japanese Bacillus TB-1 according to claim 1, characterized in that The 16S rDNA gene sequence of the strain TB-1 is shown in SEQ ID No.

1.

3. Use of the Toyo Bacillus TB-1 as claimed in claim 1 or 2 in degrading polylactic acid mulch film.

4. The method for degrading polylactic acid mulch film using the Toyo Bacillus TB-1 as claimed in claim 1 or 2, characterized in that: A degradation agent containing Bacillus TB-1 is mixed into the film-covered soil to degrade the polylactic acid film.

5. Containing the Bacillus sp. as claimed in claim 1 Bacillus toyonensis TB-1 bacterial suspension.

Images