Locusta migratoria calmodulin gene segment and dsRNA and application thereof

Abstract

The invention relates to a migratory locust calmodulin (Cam) gene segment and dsRNA and application thereof, according to a migratory locust Cam gene sequence, a gene segment with a sequence of SEQ ID NO: 1 is obtained, and the dsRNA is synthesized by the segment. By injecting dsRNA into migratory locust bodies, expression of migratory locust calmodulin (Cam) genes can be specifically silenced, the expansion degree of insect craws is remarkably weakened, ecdysis difficulty is caused, death is caused, the biological control purpose is achieved, and the ecological environment is protected.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a locust calmodulin gene fragment, a dsRNA thereof and an application thereof. Background Art

[0002] The harm caused by pests is one of the key factors restricting the sustainable development of agricultural production. As an important strategy in agriculture, integrated pest management has played an important role in promoting the sustainable development of agriculture. However, in recent years, due to over-reliance on chemical agents, insect resistance has continued to increase and agricultural pollution has intensified. Therefore, it is particularly urgent to find efficient non-chemical control technologies to achieve sustainable control of agricultural pests. Biological control has become an important means of "green" prevention and control due to its advantages such as green, environmental protection and safety. Active research and application of biological control technology has important practical significance for maintaining ecological balance and promoting sustainable development.

[0003] RNA interference (RNAi) was first discovered in the study of Caenorhabditis elegans. It is a phenomenon of efficient and specific degradation of homologous RNA mediated by double-stranded RNA (dsRNA) molecules. This technology has been rapidly applied in various organisms, especially in non-model animal and plant research, due to its high precision and high efficiency in silencing target genes, and has greatly promoted the analysis of key gene functions. RNAi insecticide technology has many significant characteristics: first, the target is highly specific, which can avoid adverse effects on non-target beneficial organisms and will not cause permanent changes to the genome of pests; second, dsRNA can be rapidly degraded in the natural environment without producing harmful residues; in addition, this technology is relatively safe and will not pose a threat or pollution to the ecosystem. Therefore, as a green and environmentally friendly pest control method, RNAi insecticide technology has great application potential, provides new ideas for the sustainable prevention and control of crop diseases and pests, and lays the foundation for the development of eco-friendly agriculture.

[0004] Calmodulin (CaM) is a small molecule protein widely present in eukaryotic cells. 2 +) to regulate many cellular processes. Calmodulin itself has no catalytic activity, but in the presence of Ca 2 + can bind to a variety of target proteins, causing conformational changes in the target proteins, thereby affecting their activity and exerting biological effects. Calcium signals are important intracellular signaling molecules that regulate biological processes including gene expression, cell differentiation and secretion. The insect molting process involves a large number of cellular activities, especially in the nervous system. Studies have found that calmodulin binds to Ca 2+ binding, it can transmit the calcium signal required for molting. However, the mechanism by which calmodulin is involved in the regulation of neural information flow during insect molting is still unclear. Summary of the invention

[0005] The present invention aims to provide a locust calmodulin (Cam) gene fragment and a dsRNA synthesized therefrom, as well as application of the dsRNA in pest control.

[0006] The invention provides a locust calmodulin (Cam) gene fragment, the nucleotide sequence of the locust calmodulin (Cam) gene fragment is SEQ ID NO:1.

[0007] The present invention provides a method for synthesizing the locust calmodulin (Cam) gene fragment as described above, comprising the following steps: based on the locust calmodulin (Cam) gene, PCR amplification is performed using an upstream primer with a sequence of SEQ ID NO: 2 and a downstream primer with a sequence of SEQ ID NO: 3, the length of which is 267 bp, to obtain the locust calmodulin (Cam) gene fragment.

[0008] The present invention provides dsRNA synthesized from the locust calmodulin (Cam) gene fragment as described above.

[0009] The present invention provides the use of the dsRNA described above in controlling migratory locusts.

[0010] The present invention can specifically silence the mRNA expression of the locust calmodulin (Cam) gene by injecting dsRNA synthesized based on the locust calmodulin (Cam) gene fragment into the locust, significantly reducing the expansion degree of the insect crop, causing molting difficulties and leading to death, thereby achieving the purpose of biological control and protecting the ecological environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 : Electropherogram of amplified dsCam.

[0012] Figure 2 : Changes in the expression of the Cam gene in the fifth-instar migratory locust nymphs after injection of dsRNA in the experiment of the present invention. Figure A shows the frontal ganglion, and Figure B shows the crop; the left side shows the control group injected with dsGFP, and the right side shows the treatment group injected with dsCam, **P<0.01.

[0013] Figure 3: Figure A is a comparison chart of the effects of dsRNA injection on crop expansion during locust molting in the experiment of the embodiment of the present invention on the crop expansion behavior of locusts during molting; Figure B is a statistical result chart of the differences in crop expansion height and expansion area during locust molting in the experiment of the embodiment of the present invention on dsRNA injection in the 5th instar locust nymphs. In each group, the left side is the control group injected with dsGFP, and the right side is the treatment group injected with dsCam, *P<0.05, **P<0.01.

[0014] Figure 4 : A comparison chart of the effects of dsRNA injection on locust molting development in fifth-instar locust nymphs in the experiment of the present invention (the left side is the control group injected with dsGFP, and the right side is the treatment group injected with dsCam).

[0015] Figure 5 : The effect of dsRNA injection into 5th instar migratory locust nymphs on the survival curve of migratory locusts in the experiment of the present invention (the "circle" is the control group injected with dsGFP, and the "square" is the treatment group injected with dsCam). DETAILED DESCRIPTION

[0016] Example 1: PCR amplification to obtain the sequence of the locust calmodulin (Cam) gene fragment

[0017] 1) Based on the transcriptome database of locust, bioinformatics methods were used to search for the calmodulin (Cam) gene of locust. After sequence analysis and alignment, the calmodulin (Cam) gene sequence LOCMI04328 was obtained.

[0018] 2) Specific primers were designed using primer premier 6.0 software. The upstream and downstream primer sequences were SEQ ID NO: 2 and SEQ ID NO: 3, respectively. The underline is the T7 promoter. All primers were synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.

[0019] Primer name Primer sequence 5'-3' SEQ ID NO:2 TAATACGACTCACTATAGGCGAGGAGCAGATCGCAGAG SEQ ID NO:3 TAATACGACTCACTATAGGTTGTCGAACACGCGGAATG

[0020] 3) Extraction of total RNA from migratory locusts: Select 5th-instar migratory locust nymphs of uniform size and half male and half female, and quickly dissect their frontal ganglia and crops under a stereo microscope. Five nymphs are divided into groups with 6 biological replicates and frozen in liquid nitrogen. The total RNA of migratory locusts is extracted according to the specific operation steps of the Thermo Fisher Trizol kit.

[0021] 4) Synthesis of locust first-strand cDNA: Use PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa) to remove genomic DNA and perform reverse transcription to synthesize first-strand cDNA.

[0022] 5) PCR amplification: Using the first-strand cDNA as a template, PCR amplification was performed to obtain the calmodulin (Cam) gene fragment. The size of the PCR product was determined by agarose gel electrophoresis, then cloned and transformed into Escherichia coli and sent to the company for sequencing.

[0023] 6) Sequence analysis: The sequencing results were compared with the transcriptome search results to verify and obtain the nucleotide sequence of the gene fragment, whose nucleotide sequence is SEQ ID NO: 1.

[0024] SEQ ID NO: 1:

[0025] CGAGGAGCAGATCGCAGAGTTCAAAGAAGCCTTCTCTCTCTTCGATAAGGATGGTGACGGCACCATCACAACCAAAGAATTGGGAACCGTGATGCGTTCCCTCGGGCAGAATCCAACAGAAGCAGAACTTCAG GATATGATAAACGAAGTGGACGCTGATGGCAACGGAACAATCGACTTCCCAGAATTTCTCACCATGATGGCGCGCAAAATGAAGGATACGGACAGCGAGGAAGAAATCAGAGAAGCATTCCGCGTGTTCGACAA

[0026] Example 2: Acquisition of dsRNA of the Calmodulin (Cam) gene fragment of Locust

[0027] The E. coli cloned with the correct calmodulin (Cam) gene cloning vector obtained in Example 1 was added to LB liquid culture medium containing ampicillin antibiotics and cultured overnight at 37°C. The plasmid was extracted using a plasmid extraction kit, and the calmodulin (Cam) gene fragment was obtained by PCR amplification using the plasmid as a template. The Wizard @ The SV Gel and PCR Clean-Up System (Promega) kit was used for purification, and the dsRNA was synthesized by in vitro transcription according to the T7 RiboMAX™ Express RNAi System (Promega) kit. The uniqueness of the dsRNA was detected by 1.2% agarose gel electrophoresis. Figure 1 As shown. The green fluorescent protein gene GFP was used as a control, dsGFP was synthesized, and quantified using NanoDrop 2000 (Thermoscientific) until the final concentration reached 2.5 μg / μL, and stored in a -80°C refrigerator for later use.

[0028] Example 3: Experiment on killing locusts with dsRNA of calmodulin (Cam) gene

[0029] 1) Locust calmodulin (Cam) gene dsRNA injection

[0030] In this experiment, 5th-instar migratory locust nymphs of uniform size, healthy growth, and half male and half female were selected as experimental subjects. The synthesized dsRNA was injected into the 2nd and 3rd abdominal segments of the nymphs with a 25mL microsyringe. The injection dose was 5μg / head, and a dsGFP control group was set up, with 36 heads in the treatment group and 36 heads in the control group. After the injection, the migratory locust nymphs were placed in a 30℃ constant temperature biochemical incubator for breeding.

[0031] 2) Detection of the silencing effect of calmodulin (Cam) gene in locusts

[0032] The 5th-instar migratory locust nymphs injected with dsGFP and dsCam were collected, and 6 insects were selected from each group, half of which were male and half were female. Six biological replicates were selected from both the treatment group and the control group. The total RNA was extracted by Trizol method, and the first-strand cDNA was obtained by reverse transcription using PrimeScript RT reagent Kit with gDNA Eraser. The relative expression levels of the target gene Cam and the housekeeping gene RP49 were detected by Real-time PCR method, and their silencing efficiency was calculated. Figure 2 As shown, the results showed that compared with the control group, after injection of dsCam, the expression of calmodulin (Cam) gene in the treated group was significantly reduced, the silencing efficiency in the frontal ganglion reached 87.2%, and the silencing efficiency in the crop reached 71.92%.

[0033] 3) Observation of locust phenotypes after dsRNA injection

[0034] like Figure 3 As shown in the figure, the crop of the dsGFP-injected control group can expand and contract normally during the molting stage. Compared with the control group, the expansion degree of the crop of the treated group after dsCam injection was significantly weakened, and the height and area of ​​the expanded crop were significantly reduced. Figure 4 As shown in the figure, after the 5th instar nymphs were injected with dsRNA, all the nymphs in the dsGFP control group successfully molted to adults, and they grew and developed well after molting. However, after the treatment group was injected with dsCam, 11 nymphs failed to molt successfully and died. The dead nymphs showed a phenotype of molting difficulty and could not molt from the old cuticle that cracked on the back.

[0035] 4) Observation of locust mortality after dsRNA injection

[0036] like Figure 5 As shown, the mortality rate of locusts in the group injected with dsCam was 73.9%, which was significantly lethal compared with the control group injected with dsGFP (mortality rate was 6.7%).

Claims

1. A locust calmodulin gene fragment, characterized in that: The nucleotide sequence of the locust calmodulin gene fragment is SEQ ID NO:

1.

2. The method for synthesizing the locust calmodulin gene fragment as claimed in claim 1, characterized in that: The method comprises the following steps: based on the locust calmodulin gene, PCR amplification is performed with an upstream primer with a sequence of SEQ ID NO: 2 and a downstream primer with a sequence of SEQ ID NO: 3 to obtain a locust calmodulin gene fragment.

3. dsRNA synthesized from the locust calmodulin gene fragment as claimed in claim 1 or 2.

4. Use of the dsRNA as claimed in claim 3 in locust control.

Images