Method for detecting monkey pox virus based on LAMP (loop-mediated isothermal amplification) and fluorescent DNA (deoxyribonucleic acid) aptamer

Abstract

The invention relates to a monkey pox virus detection method based on LAMP (loop-mediated isothermal amplification) and a fluorescent DNA (deoxyribonucleic acid) aptamer. The invention provides a group of specific primers, a probe and a kit. The sequences of the primers and the probe are as shown in SEQ ID No.1 to SEQ ID No.7; wherein the probe is a thermostable DNA fluorescent aptamer and is connected to the 5'end of the loop primer. According to the invention, the fluorescent DNA aptamer is used as a probe to replace a common nucleic acid dye, so that the problems that loop LAMP is easy to interfere and false positive is easy to appear are solved. The detection process does not need complex instruments and equipment and can be completed only through constant temperature equipment, the detection time is short, the sensitivity is high, and the method is suitable for large-scale screening and early diagnosis. The invention has important application value in preventing and controlling the propagation of monkey pox epidemic situation.

Description

Technical Field

[0001] The invention relates to the technical field of biomedical detection, and in particular to a monkeypox virus detection method based on LAMP and fluorescent DNA aptamers. Background Art

[0002] Monkeypox virus is a zoonotic pathogen that is mainly transmitted through contact with infected animals or body fluids of infected people. In recent years, with the acceleration of globalization, the spread of monkeypox virus has gradually expanded and has become a major concern in the field of public health. Traditional monkeypox virus detection methods, such as virus culture isolation, polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA), although with high sensitivity and specificity, usually require complex equipment and long detection time, which is not suitable for resource-limited areas and rapid on-site detection.

[0003] Loop-mediated isothermal amplification (LAMP) technology is a new type of nucleic acid amplification method, which is widely used in the rapid detection of pathogens due to its high sensitivity, specificity and simplicity. The LAMP reaction can be amplified under constant temperature conditions, eliminating the temperature cycler required for traditional PCR, thereby greatly shortening the detection time and simplifying the equipment requirements. As a new type of molecular probe, fluorescent DNA aptamers have good thermal stability and high sensitivity, and can be used to specifically monitor the generation of nucleic acid products during the amplification process in real time.

[0004] At present, there are no public reports on monkeypox virus detection methods based on LAMP and fluorescent DNA aptamers. Combining the advantages of LAMP technology and fluorescent DNA aptamers, it is expected that a rapid, sensitive and non-complex instrumentation-free monkeypox virus detection method will be developed to meet the detection needs of on-site and resource-limited areas, thus providing an effective means for the prevention and control of monkeypox virus.

[0005] The present invention is proposed in this context, and aims to provide a monkeypox virus detection method based on LAMP and fluorescent DNA aptamers to achieve rapid, simple, sensitive and specific monkeypox virus detection. Summary of the invention

[0006] The purpose of the present invention is to provide a method for detecting monkeypox virus based on LAMP and fluorescent DNA aptamers to solve the problems of detection interference and false positive in the prior art. The present invention effectively improves the specificity and sensitivity of detection by designing a set of specific primers and probe sequences (SEQ ID No.1 to SEQ ID No.7) and using a thermally stable fluorescent DNA aptamer as a probe. The probe is connected to the 5' end of the loop primer, replacing the traditional nucleic acid dye, and significantly reducing the interference caused by nonspecific amplification during the LAMP reaction.

[0007] In order to achieve the above-mentioned object of the present invention, the present invention adopts the following technical solutions or combinations:

[0008] First, the present invention provides a loop-mediated isothermal amplification primer combination for detecting monkeypox virus, wherein the primer combination is a primer combination for specifically amplifying the F3L gene of the monkeypox virus; the primer combination comprises an outer primer, an inner primer and a loop primer; the outer primer comprises F3 and B3; the inner primer comprises FIP and BIP; and the loop primer comprises LF and LB.

[0009] Preferably, the nucleotide sequence of the primer combination is shown as SEQ ID No.1 to SEQ ID No.6.

[0010] SEQ ID No.1: ACGGCCTACAGATTCTGAT

[0011] SEQ ID No.2: ACTGATTCAATACGAAAAGACC

[0012] SEQ ID No.3: ACCGGAATAACATCATCAAAAGACTTGATGCTATAATAGATGATGTATCC

[0013] SEQ ID No.4: TATTGGAAAGGTGTTAACCCTGTCAATCTCCTAGTTATTTGACAGTA

[0014] SEQ ID No.5: TGATCTCTCTCATTGATTTTTCG

[0015] SEQ ID No.6: CCCTGTCACCGTTATTAATGAG

[0016] Secondly, the present invention provides a probe for monitoring LAMP amplification, the probe is composed of a DNA aptamer and any of the loop primers in a connected state at the 5' end, and the probe binds to fluorescent molecules in the environment and excites their fluorescence. The nucleotide sequence of the DNA aptamer is shown in SEQ ID NO:7.

[0017] SEQ ID

[0018] NO:7:CCTCAGTCGAGGGATGGCGCGGCAGTGGGCGCCGCAGTTCCTGCGAGGGGCGACTGAGG

[0019] The present invention provides the use of the above reagent in detecting monkeypox virus.

[0020] On this basis, the present invention provides a LAMP kit for detecting monkeypox virus, wherein the kit comprises primers and probes having nucleotide sequences as shown in SEQ ID No.1 to SEQ ID No.6.

[0021] Preferably, the detection kit further comprises any one of a reaction buffer, a fluorescent molecule, a positive control and a negative control, or a combination of at least two of them.

[0022] Preferably, the reaction premix comprises any one of enzyme, dNTPs or enzyme buffer or a combination of at least two of them.

[0023] Common enzyme buffers are composed of buffer systems such as Tris-HCl, (NH4)2SO4, KCl, Tween-20, SDS, betaine, and DMSO.

[0024] Preferably, the enzyme comprises Bst2.0 DNA polymerase.

[0025] Preferably, the fluorescent molecule includes green fluorescent nucleic acid dye DFHBI-1T or DFHO.

[0026] Furthermore, a method for detecting monkeypox virus is provided, the detection method comprising the following steps:

[0027] (1) Obtaining genomic DNA from the sample to be tested: extracting DNA from the sample to be tested, and using RNase-free water as a negative control;

[0028] (2) preparing a LAMP reaction system: using the DNA extracted in step (1) as a template, using the above-mentioned detection kit to prepare a LAMP reaction system; (3) amplification reaction: performing an amplification reaction on the prepared LAMP reaction system, and observing the amplification curve;

[0029] (4) Result interpretation: The test result is determined based on the amplification curve. If a typical inverted “S”-shaped amplification curve appears within the reaction time, it is positive; if no typical inverted “S”-shaped amplification curve appears, it is negative.

[0030] Furthermore, the temperature of the LAMP amplification reaction is 55-65°C, and the amplification time is 10-90 min. Preferably, the amplification temperature is 57°C, and the amplification time is 50-70 min.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] (1) The present invention provides a set of LAMP primers that can specifically detect monkeypox virus. The primers have good specificity and can achieve specific amplification for monkeypox virus, but cannot specifically amplify other viral genomes other than monkeypox virus. In addition, the primers have good reproducibility and the results are stable and reliable.

[0033] (2) The present invention uses a thermally stable fluorescent DNA aptamer as a probe, which effectively improves the specificity and sensitivity of the detection. The probe replaces the traditional nucleic acid dye and significantly reduces the interference caused by nonspecific amplification during the LAMP reaction.

[0034] (3) The detection process involved in the present invention does not require complicated instruments and equipment, and can be completed with only a constant temperature device. The detection time is short, the sensitivity is high, and it is suitable for large-scale screening and early diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The comparison results of the amplification efficiency of three sets of MPXV primers

[0036] Figure 2 This is the sensitivity test result of the F3L-1 primer set

[0037] Figure 3 is the linear range of the F3L-1 primer set

[0038] Figure 4 This is the specific detection result of the F3L-1 primer set DETAILED DESCRIPTION

[0039] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention.

[0040] In the present invention, the BstDNA polymerase, dNTPs and DFHBI-1T are commercially available products, and the reagents and instruments used can be purchased through commercial channels.

[0041] The monkeypox virus plasmid was obtained from Sangon Biotech by cloning the F3L gene sequence in the virus sequence (GeneBank: ON568298 / ON563414) into the pUC57 vector.

[0042] Example 1: LAMP primer and probe design

[0043] According to the monkeypox virus genome sequence published by NCBI, the F3L gene sequence of the monkeypox virus was searched and compared, and three sets of specific primers were designed using the LAMP primer design software Primer Explorer V5 (http: / / primerexplorer.jp / lampv5e / index.html), namely F3L-1, F3L-2, and F3L-3. The following are the primers and their aptamer-labeled probe sequences (5'-3') listed in Table 1:

[0044] Table 1. Primer set for monkeypox virus detection

[0045]

[0046]

[0047] The probe corresponding to each set of primers (Apt-LF / LB) is composed of a DNA adaptor connected to the 5' end of any of the loop primers.

[0048] Example 2: Screening of LAMP primers

[0049] By comparing the amplification efficiency, the three sets of LAMP primers designed in Example 1 were optimized. The specific method was as follows: Based on the three sets of primers designed in Example 1, isothermal amplification systems of the three sets of primers were constructed respectively. 6 1 μl of the monkeypox virus plasmid with a copy / μl was added to the isothermal amplification system preset by three sets of primers for reaction. The reaction conditions were 56°C for 30 seconds per cycle, and a total of 140 cycles were performed. The amplification efficiency of each primer set was compared under the same conditions. The LAMP isothermal amplification reaction system is shown in Table 2 below.

[0050]

[0051]

[0052] The amplification results of the three sets of primers are shown in Figure 1 As shown, it can be seen that under the same template concentration, the time for the F3L-1 primer set to show an amplification curve is the shortest compared to other primer sets, so F3L-1 is the preferred primer set, and this primer set is also used in the following experiments.

[0053] Example 3: Sensitivity of LAMP in detecting monkeypox virus

[0054] A plasmid containing the F3L gene sequence of monkeypox virus was used as a positive control for sensitivity testing, and then diluted 10-fold to 10 6 copies / μl, 10 5 copies / μl, 104 copies / μl, 10 3 copies / μl, 10 2 The samples of all dilution multiples were used as templates and amplified using the LAMP detection kit of the present invention.

[0055] The reaction system and specific operation of the isothermal amplification detection method are shown in Example 2.

[0056] Test results such as Figure 2 , Figure 3 As shown. The positive and negative control test results are normal, all concentrations are detected, 1 copy / μl can be detected, but it is beyond the linear range. 10 copies / μl and above can be stably detected, and the plasmid concentration and the inflection point (POI) time of the amplification curve have a good linear relationship.

[0057] Example 4 Specific detection of monkeypox virus by LAMP

[0058] This example tests the specificity of the LAMP primer combination used to detect monkeypox virus in Example 1.

[0059] DNA of other pathogens and related species that present skin lesions similar to MPXV at different stages of development were selected as templates, including: herpes simplex virus (HSV), varicella-zoster virus (VZV), vaccinia virus (VACV), vaccinia virus (CPXV), human papillomavirus-16 (HPV-16), human papillomavirus-18 (HPV-18). The templates were detected respectively with reference to the reaction systems established in Examples 2 and 3.

[0060] The results of LAMP detection of specific reaction are as follows Figure 4 As shown in the figure, the NTC negative control. The MPXV primer set has good specificity and the test results for all non-MPXV viruses are negative.

[0061] In summary, the primer set for detecting monkeypox virus provided by the present invention has good specificity and reproducibility. The provided DNA fluorescent adaptor probe can be used for monitoring the LAMP amplification process, and the result is stable and reliable. The provided monkeypox virus detection kit has fast detection speed and simple operation, and can be widely used in the rapid differential diagnosis of monkeypox virus strains.

[0062] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A loop-mediated isothermal amplification primer combination for detecting monkeypox virus, characterized in that: The primer combination is a primer combination for specifically amplifying the monkeypox virus F3L gene; the primer combination comprises an outer primer, an inner primer and a loop primer.

2. The loop-mediated isothermal amplification primer combination for detecting monkeypox virus according to claim 1, characterized in that: The outer primers include F3 and B3; the inner primers include FIP and BIP; and the loop primers include LF and LB.

3. According to claim 2, the nucleotide sequence of the outer primer F3 is shown in SEQ ID NO: 1; the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO: 2; the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO: 3; the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO: 4; the nucleotide sequence of the loop primer LF is shown in SEQ ID NO: 5; the nucleotide sequence of the loop primer LB is shown in SEQ ID NO:

6.

4. A probe for monitoring LAMP amplification, characterized in that The probe is a thermally stable fluorescent DNA aptamer, and the nucleotide sequence of the DNA aptamer is shown in SEQ ID NO:

7.

5. The probe according to claim 4, characterized in that: The probe is composed of a DNA adapter and the 5' end of any one of the loop primers in a connected state, and the probe is combined with a fluorescent molecule in the environment and excites its fluorescence.

6. A LAMP kit for detecting monkeypox virus, characterized in that: The kit comprises the primer set and probe according to claims 2 and 4.

7. The kit according to claim 6, characterized in that The LAMP kit further comprises other reaction reagents, which include a reaction buffer, a DNA polymerase, a fluorescent molecule, a part or all of a positive control and a negative control.

8. A method for detecting monkeypox virus using the LAMP primer set of claim 2 or the LAMP kit of claim 6, characterized in that: The detection method comprises the following steps: (1) Obtaining genomic DNA of the sample to be tested; (2) preparing a LAMP reaction system; wherein the system comprises the LAMP primer set according to claim 2 or the LAMP kit according to any one of claims 6; (3) Amplification reaction: Perform an amplification reaction on the prepared LAMP reaction system and observe the amplification curve; (4) Result interpretation: The test result is determined based on the amplification curve. If a typical inverted "S"-shaped amplification curve appears within the reaction time, it is positive; if no typical inverted "S"-shaped amplification curve appears, it is negative.

9. The method for detecting monkeypox virus according to claim 7, characterized in that: The amplification reaction was carried out under the conditions of 55-65°C constant temperature reaction for 45-90 minutes.

Images