Kit for detecting monkey pox virus based on RAA-CRISPR / Cas12a and application

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a kit for detecting nucleic acid of a monkey pox virus based on RAA-CRISPR / Cas12a and a detection method. The invention provides the combination of the specific RAA primer and the specific crRNA of the monkey pox virus, the RAA technology is combined with a CRISPR-Cas12a system, the visual rapid detection of nucleic acid of the monkey pox virus is realized, and compared with the traditional method, the method has the advantages of high specificity, high sensitivity, short detection time, accurate result and the like.

Description

Technical Field

[0001] The present application belongs to the field of biological detection technology, and specifically relates to a kit for detecting monkeypox virus nucleic acid based on RAA-CRISPR / Cas12a and its application. Technical Background

[0002] Monkeypox is an important zoonosis caused by monkeypox virus (MPXV) of the genus Orthopoxvirus in the family Poxviridae. Its clinical symptoms are similar to those of smallpox and can be transmitted from person to person and from animal to person. MPXV is a double-stranded DNA virus with a genome length of approximately 197kb. There are two known branches of MPXV, branch I is called the Congo branch, and branch II is called the West African branch. MPXV has a wide host range, mainly involving a variety of African rodents. In addition, primates (a variety of monkeys and apes) may also be sporadically infected due to contact with infected rodents. Infected animals and people infected with monkeypox virus are the main sources of infection. The virus invades the human body through mucous membranes and broken skin. Infection is mainly caused by contact with respiratory secretions, lesion exudates, blood, other body fluids of infected animals, or bites and scratches from infected animals. The virus can also be transmitted from pregnant women to fetuses through the placenta.

[0003] In recent years, real-time fluorescence PCR has been widely used in the field of viral nucleic acid detection, but fluorescence PCR detection requires the use of special instruments and equipment, has high requirements for operators, and takes a long time to detect, which cannot meet the needs of rapid detection at the grassroots level. Therefore, there is an urgent need for a rapid detection method with strong specificity, high sensitivity, and suitable for the field for the detection of monkeypox virus nucleic acid. In view of this, this application is proposed. Summary of the invention

[0004] In order to solve the above technical problems, the present application proposes a kit for detecting monkeypox virus nucleic acid based on RAA-CRISPR / Cas12a and its application. This method combines RAA technology with the CRISPR / Cas12a system. The advantage of this method is that it does not require large-scale instruments and equipment, has strong specificity, high sensitivity, short detection time, and accurate results, and can quickly detect monkeypox virus nucleic acid on site.

[0005] The present application first provides a nucleic acid composition, characterized in that the composition includes a monkeypox virus-specific RAA primer pair and a specific crRNA.

[0006] Further, the specific RAA primer pair sequence is as follows:

[0007] Upstream primer: 5′-TCAATGTCTACACAGGCATAAAATGTAGGAGAGTT-3′ (Seq ID No. 1);

[0008] Downstream primer: 5′-CAATGGATGCTGATACACGGCCTACAGATTCTGAT-3′ (Seq ID No. 9);

[0009] Further, the specific crRNA sequence is as follows:

[0010] 5'-UAAUUUCUACUAAGUGUAGAUAUGAUGUUAUUCCGGUUAAAAAA-3' (Seq ID No. 13),

[0011] Alternatively, the specific RAA primer pair and the specific crRNA sequence are sequences having a homology of greater than 95% with the above sequence.

[0012] Furthermore, the nucleic acid composition also includes a ssDNA-FB sequence;

[0013] Preferably, the ssDNA-FB is as follows:

[0014] 5'-TTATTATT-3' (Seq ID No. 17).

[0015] Furthermore, the 5' end of the ssDNA-FB sequence is modified with a FAM fluorescent group, and the 3' end is modified with Biotin.

[0016] The present application also provides a detection kit for detecting monkeypox virus nucleic acid based on RAA-CRISPR / Cas12a, wherein the kit includes the above-mentioned primer combination for detecting monkeypox virus nucleic acid based on RAA-CRISPR / Cas12a.

[0017] Preferably, the kit also includes a recombinase, a polymerase, dNTPs, magnesium acetate, a Cas12a protein, a lysis buffer and a Cas12 / 13-specific nucleic acid detection test strip.

[0018] The present application further provides a detection method for detecting monkeypox virus nucleic acid based on AA-CRISPR / Cas12a, the steps of which are as follows:

[0019] (1) Extracting DNA from the sample to be tested;

[0020] (2) using the DNA extracted in step (1) as a template, amplifying the DNA in the above RAA amplification system at 39° C. for 20 min;

[0021] Furthermore, the total volume of the RAA amplification reaction system is 50 μL: 25 μL of recombinase polymerase and dNTPs mixture, 2.5 μL of 280 mM magnesium acetate, 2 μL of 10 μM RAA upstream primer, 2 μL of 10 μM RAA downstream primer, 5 μL of template, and supplemented with nuclease-free water to 50 μL.

[0022] (3) digesting the RAA amplification product obtained in step (2) in the above CRISPR / Cas12a reaction system at 39° C. for 10 min;

[0023] Furthermore, the total volume of the CRISPR / Cas12a enzyme digestion reaction system is 60 μL: 6 μL of 10× lysis buffer, 2 μL of 1 μM Cas12a protein, 2 μL of 1 μM crRNA, 1.2 μL of 10 μM ssDNA-FB, 2 μL of RAA amplification product, and the volume is supplemented with nuclease-free water to 60 μL.

[0024] (4) The reaction product obtained in step (3) is detected using a Cas12 / 13 dedicated nucleic acid detection test strip, and the color development result of the test strip is read within 10 minutes.

[0025] (5) Interpretation of test results: red strips appear on both the test strip quality control line (C line) and the test line (T line), or the test strip quality control line (C line) does not show color and the test line (T line) shows a red strip. Both of the above situations indicate that Cas12 / 13 can effectively cut and activate the reporter group to develop color, and the result can be judged as positive; a red strip appears on the test strip quality control line (C line) and the test line (T line) does not show color, indicating that Cas12 / 13 failed to cut the reporter molecule and failed to activate the reporter group to develop color, and the result can be judged as negative; no red strips appear on either the test strip quality control line (C line) or the test line (T line), indicating that the test result is invalid.

[0026] This application uses RAA isothermal nucleic acid amplification technology to amplify monkeypox virus-specific gene fragments, and then crRNA specifically recognizes the amplified product, thereby triggering the activity of Cas12a. The activated Cas12a not only cis-cuts the target double-stranded DNA chain guided by crRNA, but also has an additional trans-cutting function to cut any nearby ssDNA. Utilizing this characteristic of the CRISPR / Cas12a system, ssDNA-FB is added to the detection system, and the detection signal is released after cutting, which can realize the visual rapid detection of monkeypox virus nucleic acid.

[0027] The present application establishes a visual rapid detection method for detecting monkeypox virus nucleic acid based on RAA-CRISPR / Cas12a, which has high sensitivity and strong specificity, and can specifically detect 1.438 copies / μL of the recombinant control plasmid, and has no cross-reaction with other orthopoxviruses (VARV, VACV, CMLV, CPXV and ECTV). This method can be combined with lateral flow test strips to observe and interpret the results with the naked eye in about 35 minutes.

[0028] The present application relates to a method for detecting monkeypox virus nucleic acid, which uses crRNA to recognize RAA amplification products, and then activates Cas12a enzyme to specifically cut ssDNA nucleic acid small molecules to release detection signals. In this process, RAA amplification product fragments are partially cleaved and degraded, reducing the concentration of intact nucleic acid fragments in the system. In addition, amplification and enzyme cleavage reactions are completed in the same test tube, which not only simplifies the operating process, but also effectively reduces the risk of cross contamination.

[0029] The advantages and beneficial effects of this application are:

[0030] (1) The RAA upstream primer, RAA downstream primer, crRNA PAM sequence, etc. obtained by optimization screening in this application can specifically amplify the target gene of monkeypox virus (West African branch and Congo branch), and have no cross reaction with other orthopoxviruses (VARV, VACV, CMLV, CPXV and ECTV); and have high sensitivity, and can specifically detect 1.438 copies / μL of recombinant control plasmid, that is, each reaction can detect a minimum of 7.19 copies of recombinant control plasmid, and the sensitivity is equivalent to that of fluorescent PCR. .

[0031] (2) Compared with the traditional RAA constant temperature amplification technology, the CRISPR / Cas12a enzyme cleavage detection system used in this application significantly enhances the signal amplification effect, and when combined with the lateral flow test paper technology, the results can be directly judged by the naked eye. The total duration of the detection process is reduced to less than 35 minutes, including a 20-minute constant temperature amplification stage and a 10-minute enzyme cleavage stage, which significantly reduces the time required for detection compared to the most widely used PCR technology.

[0032] (3) The detection kit and detection method described in the present application do not require large-scale detection equipment and are easy to operate. The RAA amplification reaction temperature and the CRISPR / Cas12a enzyme cleavage reaction temperature are both 39°C, and only a simple constant temperature device is required.

[0033] (4) The reagent of the present application can be used to conveniently perform on-site detection of monkeypox virus nucleic acid, and the test results can be quickly obtained; this is of great significance for the rapid prevention and control of monkeypox and the prevention of the spread of the epidemic. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is the specific detection result of monkeypox virus RAA-CRISPR / Cas12a of the present application;

[0035] Figure 2 It is the sensitivity test result of monkeypox virus RAA-CRISPR / Cas12a of this application;

[0036] Figure 3 This is the repeatability test result of monkeypox virus RAA-CRISPR / Cas12a in this application. DETAILED DESCRIPTION

[0037] The embodiments of the present application will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present application and should not be considered as limiting the scope of the present application. In the examples, if no specific conditions are specified, the conditions are carried out according to normal conditions or manufacturer recommendations. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased from the market.

[0038] Partial term definition, unless otherwise defined below, the meaning of all technical terms and scientific terms used in the specific embodiments of the present application is intended to be the same as that commonly understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present application.

[0039] The term "approximately" in this application indicates an accuracy range that can be understood by those skilled in the art and still ensures the technical effect of the characteristic in question. The term generally indicates ±10%, preferably ±5%, of the indicated value.

[0040] As used in this application, the terms "comprises", "comprising", "having", "containing" or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0041] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0042] The present application is described below in conjunction with specific embodiments.

[0043] Example

[0044] 1. Materials and Methods

[0045] 1. Experimental plasmid

[0046] In this study, a total of 7 sequences were synthesized based on the MPXV Congo branch F3L gene sequence, MPXV West African branch F3L gene sequence, VARV E3L gene sequence, VACV E3L gene sequence, CMLV E3L gene sequence, CPXV F3L gene sequence and ECTV F3L gene sequence published in the NCBI GenBank database. These sequences were cloned into the pUC57 vector and named as MPXV-F3L-1, MPXV-F3L-2, VARV-E3L, VACV-E3L, CMLV-E3L, CPXV-F3L and ECTV-F3L, respectively, and used as control plasmids in subsequent experiments.

[0047] 2. Design and screening of RAA primers and crRNA

[0048] In this case, multiple primer combinations and multiple crRNAs were designed based on the monkeypox virus F3L gene sequence, and their specificity was determined by BLAST comparison, and then used for subsequent test screening. The RAA primer sequence is shown in Table 1, the size of the RAA primer combination amplification product is shown in Table 2, and the crRNA sequence and ssDNA-FB sequence are shown in Table 3. All primers in this case were synthesized by Qingke Biotechnology.

[0049] Table 1. RAA primer sequences

[0050] Primer name Sequence (5'→3') SEQ ID No. MPXV-F1 TCAATGTCTACACAGGCATAAAATGTAGGAGAGTT 1 MPXV-F2 ATAAAATGTAGGAGAGTTACTAGGCCCCACTGATT 2 MPXV-F3 TAGGAGAGTTACTAGGCCCCACTGATTCAATACGA 3 MPXV-F4 ACTAGGCCCCACTGATTCAATACGAAAAGACCAAT 4 MPXV-F5 TGATTCAATACGAAAAGACCAATCCTCCTAGTTA 5 MPXV-R1 ACACGGCCTACAGATTCTGATGCTGATGCTATAAT 6 MPXV-R2 TGATACACGGCCTACAGATTCTGATGCTGATGCTA 7 MPXV-R3 TGGATGCTGATACACGGCCTACAGATTCTGATGCT 8 MPXV-R4 CAATGGATGCTGATACACGGCCTACAGATTCTGAT 9 MPXV-R5 TACGACAATGGATGCTGATACACGGCCTACAGATT 10

[0051] Table 2. Size of gene fragments amplified by RAA primer combination

[0052]

[0053]

[0054] Table 3. crRNA sequences and ssDNA-FB sequences

[0055] sequence name Sequence (5'→3') SEQ ID No. crRNA1 UAAUUUCUACUAAGUGUAGAUGCGGGAUACAUCAUCUAUUAUAG 11 crRNA2 UAAUUUCUACUAAGUGUAGAUACCGGAAUAACAUCAUCAAAAGA 12 crRNA3 UAAUUUCUACUAAGUGUAGAUAUUGAUGUUAUUCCGGUUAAAAAA 13 crRNA4 UAAUUUCUACUAAGUGUAGAUCAAUAAAUAAUUUUUUAACCGG 14 crRNA5 UAAUUUCUACUAAGUGUAGAUUUGGAAAGGUGUUAACCCUGUCA 15 crRNA6 UAAUUUCUACUAAGUGUAGAUACAGUACUCAUUAAUAACGGUGA 16 ssDNA-FB FAM-TTATTATT-Biotin 17

[0056] 4. Reaction system and reaction conditions

[0057] RAA reaction system and reaction conditions: 25 μL of recombinase polymerase and dNTPs mixture, 2.5 μL of 280 mM magnesium acetate, 2 μL of 10 μM RAA upstream primer, 2 μL of 10 μM RAA downstream primer, 5 μL of template, and nuclease-free water to 50 μL. Amplify at 39°C for 20 min.

[0058] CRISPR / Cas12a enzyme digestion reaction system: 10× lysis buffer 6μL, 1μM Cas12a protein 2μL, 1μM crRNA 2μL, 10μM ssDNA-FB 1.2μL, RAA amplification product 2μL, add nuclease-free water to 60μL. Digest at 39℃ for 10min, detect with Cas12 / 13 special nucleic acid detection test strip, and read the color development result of the test strip within 10min.

[0059] Interpretation of RAA-CRISPR / Cas12a visual detection results: If red strips appear on both the quality control line (C line) and the detection line (T line) of the Cas12 / 13 dedicated nucleic acid detection test strip, or if the quality control line (C line) of the test strip does not show color and the detection line (T line) shows a red strip, both results can be judged as positive; if a red strip appears on the quality control line (C line) of the test strip and the detection line (T line) does not show color, the result is judged as negative; if no red strips appear on either the quality control line (C line) or the detection line (T line) of the test strip, the test result is invalid.

[0060] 5. RAA Primer Screening

[0061] During the screening process, an upstream primer was first selected as the basis for screening the appropriate downstream primer. Subsequently, the upstream primer that best matched the screened downstream primer was further selected in order to obtain the ideal primer combination for monkeypox virus nucleic acid detection. The primer screening process followed the RAA reaction system and conditions described in the "4. Reaction system and reaction conditions" section. The effect of RAA amplification was evaluated by capillary electrophoresis analysis and referring to "Table 2 RAA primer combination amplified gene fragment size".

[0062] 6. crRNA screening

[0063] The specific primer combination obtained in step "5. RAA primer screening" is used for the CRISPR / Cas12a reaction to screen the designed crRNA. The crRNA screening process follows the CRISPR / Cas12a reaction system and conditions described in section "4. Reaction system and reaction conditions". After the reaction is completed, the results are tested using the Cas12 / 13 dedicated nucleic acid detection test strips.

[0064] 7. Specificity test

[0065] Using the screened RAA primers and crRNA, the recombinant plasmids of monkeypox virus (MPXV), smallpox virus (VARV), vaccinia virus (VACV), camelpox virus (CMLV), cowpox virus (CPXV) and mousepox virus (ECTV) were detected according to "4 / Reaction system and reaction conditions", and negative controls and water controls were set up.

[0066] 8. Sensitivity test

[0067] In this example, the recombinant plasmid MPXV-F3L-1 was diluted 10-fold to 10 -10 , using dilutions of various gradient concentrations as templates, and using the established RAA-CRISPR / Cas12a monkeypox virus visualization detection method for detection. At the same time, it was compared with the real-time fluorescence PCR method described in the "Technical Guidelines for Monkeypox Prevention and Control (2022 Edition)" issued by the General Office of the National Health Commission, that is, real-time fluorescence PCR detection was performed on the same diluted plasmid template.

[0068] 9. Repeatability test

[0069] In this example, 10 -5 , 10 -6 , 10 -7 The diluted concentration of MPXV-F3L-1 was used as a template and detected using the established RAA-CRISPR / Cas12a monkeypox virus nucleic acid visualization detection method, and the detection was repeated three times.

[0070] 2. Experimental Results and Analysis

[0071] 1. Screening of RAA primers and crRNA

[0072] After screening, this example screened out the upstream primer MPXV-F1 of the sequence shown in Seq ID No.1 and the downstream primer MPXV-R4 of the sequence shown in Seq ID No.9 from the RAA primers in Table 1. This primer combination can be used for specific detection of the monkeypox virus F3L gene. Capillary electrophoresis analysis showed that the RAA amplification product fragment matched the "F1+R4" fragment size in "Table 2 RAA primer combination amplified gene fragment size", with a size of about 260bp. In this example, the crRNA3 of the sequence shown in Seq ID No.13 was screened out from the crRNA sequence in Table 3.

[0073] 2. Specificity test results

[0074] The specificity test was carried out using the recombinant plasmids MPXV-F3L-1, MPXV-F3L-2, VARV-E3L, VACV-E3L, CMLV-E3L, CPXV-F3L and ECTV-F3L as templates. The results showed that ( Figure 1), only MPXV-F3L-1 and MPXV-F3L-2 were detected, while other orthopoxviruses, negative controls and water controls were not detected, indicating that the established method has strong specificity and can accurately detect monkeypox virus nucleic acid without cross-reaction with other orthopoxvirus nucleic acids.

[0075] 3. Sensitivity test results

[0076] Take 10 -4 -10 -10 The MPXV-F3L-1 plasmid with a dilution ratio was used as a template, and the established RAA-CRISPR / Cas12a monkeypox virus visualization detection method and the real-time fluorescence PCR method in the "Technical Guidelines for Monkeypox Prevention and Control (2022 Edition)" of the National Health Commission were used for detection. The results showed that the established method can detect 10 -10 , that is, the lowest concentration of MPXV-F3L-1 for the established method is 1.438 copies / μL ( Figure 2 ), which is comparable to the real-time fluorescence PCR method. It can be seen that the RAA-CRISPR / Cas12a detection method in this example can achieve similar sensitivity compared to the most commonly used real-time fluorescence PCR detection method; however, the detection method in this example does not need to rely on large-scale instruments and equipment, and has a significant detection time advantage, thereby greatly shortening the detection cycle and improving the detection efficiency.

[0077] 4. Repeatability test results

[0078] The method established in this application was used to treat 10 -6 (Concentration: 1.438×10 4 copies / μL)、10 -7 (Concentration: 1.438×10 3 copies / μL)、10 -8 (Concentration: 1.438×10 2 Three repetitive tests were performed using three concentrations of MPXV-F3L-1 as templates. The results showed that ( Figure 3 ): Three concentrations of MPXV-F3L-1 were all detected by this method, and the results were consistent, indicating that the method of this application has good repeatability.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A nucleic acid composition, characterized in that The composition includes a monkeypox virus-specific RAA primer pair and a specific crRNA.

2. The nucleic acid composition according to claim 1, characterized in that The specific RAA primer pair sequences are as follows: Upstream primer: 5′-TCAATGTCTACACAGGCATAAAATGTAGGAGAGTT-3′ (Seq ID No. 1); Downstream primer: 5′-CAATGGATGCTGATACACGGCCTACAGATTCTGAT-3′ (Seq ID No. 9); The specific crRNA sequence is as follows: 5'-UAAUUUCUACUAAGUGUAGAUAUGAUGUUAUUCCGGUUAAAAAA-3' (Seq ID No. 13); Alternatively, the specific RAA primer pair and the specific crRNA sequence are sequences having a homology of greater than 95% with the above sequence.

3. The nucleic acid composition according to claim 2, characterized in that The nucleic acid composition further includes a ssDNA-FB sequence; Preferably, the ssDNA-FB sequence is as follows: 5'-TTATTATT-3' (Seq ID No. 17).

4. The nucleic acid composition according to claim 3, characterized in that The 5' end of the ssDNA-FB sequence is modified with a FAM fluorescent group, and the 3' end is modified with Biotin.

5. A detection kit for detecting monkeypox virus nucleic acid based on RAA-CRISPR / Cas12a, the kit comprising the nucleic acid composition described in any one of claims 1-4.

6. The kit according to claim 5, characterized in that The reagents also include recombinase, polymerase, dNTPs, magnesium acetate, Cas12a protein and lysis buffer.

7. Use of the nucleic acid composition according to any one of claims 1 to 4 in detecting monkeypox virus.

8. Use of the nucleic acid composition according to any one of claims 1 to 4 in the preparation of a monkeypox virus detection reagent.

9. A method for detecting monkeypox virus nucleic acid based on AA-CRISPR / Cas12a, the method comprising the following steps: (1) Extracting DNA from the sample to be tested; (2) Using DNA as a template, isothermal amplification is performed in the RAA amplification system; (3) digesting the RAA amplification product in the CRISPR / Cas12a reaction system; (4) Detect the reaction product using a Cas12 / 13-specific nucleic acid detection test strip and read the color development result of the test strip; (5) Interpretation of test results.

10. The method according to claim 9, characterized in that In the method, the RAA amplification system comprises the primer pair described in SeqIDNo.1-2, and the CRISPR / Cas12a reaction system comprises the crRNA described in Seq ID No.3 and the ssDNA-FB shown in SeqIDNo.4.

Images