Grape tartaric acid biosynthesis key enzyme VvTSAD4 as well as coding gene and application thereof

Abstract

The invention relates to a grape tartaric acid biosynthesis key enzyme VvTSAD4 as well as a coding gene and application thereof, and belongs to the technical field of biological gene engineering. The amino acid sequence of the grape tartaric acid biosynthesis key enzyme VvTSAD4 is as shown in SEQ ID NO. 1. The invention also discloses a recombinant expression vector containing the key enzyme VvTSAD4 for biosynthesis of grape tartaric acid, a recombinant genetic engineering bacterium or a transgenic plant tissue, and an application of the key enzyme VvTSAD4 for biosynthesis of grape tartaric acid. Expression of the grape tartaric acid biosynthesis key enzyme VvTSAD4 can promote biosynthesis of tartaric acid in grape fruits, the content of tartaric acid in grapes is increased, and the grape tartaric acid biosynthesis key enzyme VvTSAD4 is easy to popularize and apply.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, relates to a key enzyme VvTSAD4 for tartaric acid biosynthesis and a coding gene thereof, and also discloses the application of the key enzyme VvTSAD4 for tartaric acid biosynthesis. Background Art

[0002] Grape is one of the four major fruits in the world. It has high nutritional and economic value and is an important fruit crop in my country. It has a long history of planting, a large cultivated area, and continuously growing yields.

[0003] In recent years, global warming has attracted great attention from the wine grape planting and wine industries around the world. It has caused the spatial shift of high-quality wine grape planting areas, turning some wine grape cultivation areas into sub-suitable areas, greatly affecting the distribution of wine grape varieties and wine types. It has also caused grapes to mature early, acidity to degrade too quickly, and aroma to accumulate insufficiently, resulting in excessively high alcohol content, bland taste, and poor quality of wine.

[0004] In order to cope with the impact of global warming on the wine industry, cultural measures such as covering with shade nets and using anti-transpiration agents have been studied to inhibit the rapid accumulation of sugar in grape fruits and the rapid degradation of organic acids (mainly malic acid), and certain results have been achieved.

[0005] Mile County and Qiubei County, where the wine grape cultivation area accounts for more than 75% of Yunnan Province, are facing a more serious situation. During the ripening period of wine grapes (such as crystal), they are faced with rain and heat in the same season. Not only is the acidity degradation faster, but the accumulation of sugar is also insufficient. Insufficient acidity will lead to a high pH of the wine fermentation liquid and poor microbial stability. In order to increase the acidity of the fermentation liquid and the microbial stability during fermentation, a large amount of tartaric acid has to be added to adjust the pH during winemaking. Sometimes sugar is added to compensate for the insufficient sugar content of the fermentation liquid to increase the alcohol content, which greatly increases the production costs of enterprises.

[0006] Tartaric acid is a characteristic acid of grapes. It has good stability during the ripening period of wine grapes and is the most important contributor to the acidity of mature grapes and wines. It accounts for about 70% to 90% of the total organic acids in wine. It affects the acid characteristics of wines and their antioxidant and anti-corruption capabilities. Malic acid is another major organic acid in grape berries, but most of it is decomposed by gluconeogenesis or metabolism during the ripening process of grapes. Increased temperature will accelerate this metabolic process. Therefore, the tartaric acid content of grapes is particularly important for the acid retention of wine grapes and wine production. The increase in tartaric acid content can extend the fruit-hanging time of wine grapes and promote the accumulation of sugars or flavor substances. Therefore, new strategies for biologically regulating the accumulation of endogenous tartaric acid in grapes or targeted breeding of high tartaric acid accumulation-type excellent wine grape varieties are urgently needed to be developed.

[0007] However, there is still a lack of sufficient theoretical basis for the biological regulation of tartaric acid, and the enzymes in its synthesis pathway have not been fully confirmed. The synthesis of tartaric acid with ascorbic acid as the main precursor is the main pathway of tartaric acid biosynthesis. Although the L-galactose pathway from D-mannose to ascorbic acid is very clear, most of the enzymes in the biosynthesis process from ascorbic acid to tartaric acid have not been confirmed, and there is still a lack of sufficient understanding of the biosynthesis process of tartaric acid.

[0008] Therefore, how to overcome the shortcomings of existing technologies is an urgent problem to be solved in the field of biological genetic engineering technology. Summary of the invention

[0009] The purpose of the present invention is to solve the deficiencies of the prior art and provide a key enzyme VvTSAD4 for tartaric acid biosynthesis and its encoding gene and application.

[0010] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0011] In a first aspect, the present invention provides a key enzyme for tartaric acid biosynthesis, VvTSAD4, the amino acid sequence of which is shown in SEQ ID NO.1.

[0012] The second aspect of the present invention provides a gene encoding the key enzyme VvTSAD4 in tartaric acid biosynthesis.

[0013] Furthermore, preferably, the coding sequence of the gene is the nucleotide sequence shown in SEQ ID NO.2.

[0014] The third aspect of the present invention provides a recombinant vector containing the above gene.

[0015] The fourth aspect of the present invention provides a recombinant genetically engineered bacterium or a transgenic plant tissue transformed with the above-mentioned recombinant vector.

[0016] The fifth aspect of the present invention provides the use of the above-mentioned key enzyme VvTSAD4 in tartaric acid biosynthesis in increasing the tartaric acid content in grape berries.

[0017] Based on the research and development of the present invention, the inventors speculate that the key enzyme VvTSAD4 in tartaric acid biosynthesis of the present invention can catalyze tartaric acid semialdehyde to produce tartaric acid.

[0018] The amino acid sequence of VvTSAD4, a key enzyme in tartaric acid biosynthesis, is shown in SEQ ID NO.1, which has 531 amino acids in total. It is a stable protein, a hydrophilic protein, a non-secretory protein and a non-transmembrane protein, and contains 62 phosphorylation sites.

[0019] The present invention confirms that the VvTSAD4 gene plays a role in tartaric acid biosynthesis through transient gene overexpression and heterologous tomato genetic transformation.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a key enzyme VvTSAD4 for tartaric acid biosynthesis, the expression of which can promote the accumulation of tartaric acid and play an important role in improving the quality of grape fruit. Overexpression of VvTSAD4 in grape fruit can increase the TA content by 18.8%. Overexpression of VvTSAD4 in tomatoes can increase the TA content by about 4.7 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a research technology roadmap of the key enzyme VvTSAD4 in the biosynthesis of tartaric acid of the present invention;

[0023] Figure 2 This is a bar graph of tartaric acid content at different stages of grape fruit development; among them, all averages are arranged in order from large to small, and the letter a is marked on the largest average; and the average is compared with the following averages, and all those with insignificant differences are marked with the letter a, until a certain average with significant difference is marked with the letter b; then the average marked with b is used as the standard, and compared with the averages above that are larger than it, all those with insignificant differences are also marked with the letter b; then the largest average marked with b is used as the standard, and compared with the following unmarked averages, all those with insignificant differences continue to be marked with the letter b, until a certain average with significant difference is marked with c, and so on; any average with the same letter is not significantly different, and any average with different letters is significantly different; the significance level α = 0.05;

[0024] Figure 3 is the expression level of VvTSAD4, a key enzyme in the biosynthesis of tartaric acid in grape berries at different stages of development; the significance level is α = 0.05;

[0025] Figure 4 This is a structural domain analysis diagram of the key enzyme VvTSAD4 in the biosynthesis of tartaric acid of the present invention;

[0026] Figure 5 This is an identification diagram of VvTSAD4 cloned in the embodiment of the present invention; wherein, M represents DL250bp DNA Marker, and 1-2 are VvTSAD4 CDS full-length electrophoresis products;

[0027] Figure 6This is an identification diagram of VvTSAD4 cloned in the embodiment of the present invention connected to the overexpression vector; wherein, M represents DL250bp DNA Marker, and 1-5 are all PCR electrophoresis products of bacterial solution carrying pC1300-VvTSAD4 recombinant plasmid;

[0028] Figure 7 This is the tartaric acid content of grape fruit after transformation of VvTSAD4 gene; the significance level is α=0.05;

[0029] Figure 8 This is the expression level diagram of the grape fruit after transformation of VvTSAD4 gene; the significance level α=0.05;

[0030] Fig. 9 Clustering and genetic distance prediction of grape VvTSAD4 protein;

[0031] Fig.10 This is a positive identification diagram for tomatoes transformed with the VvTSAD4 gene; where M represents DL250bp DNA Marker.

[0032] Fig.11 This is a graph showing the TA content in transgenic tomatoes with the VvTSAD4 gene; the significance level is α=0.05. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with embodiments.

[0034] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0035] Example 1 Genetic evolution analysis of the key enzyme VvTSAD4 in grape tartaric acid biosynthesis

[0036] The key enzyme of tartaric acid biosynthesis VvTSAD4 screened in the transcriptome data of the present invention was tested for homology with the amino acids encoded by the VvTSAD4 gene through BLASTp in the NCBI database, and clustering and genetic distance analysis were performed using MEGA software to obtain two developmental trees ( Fig. 9 ). The results of the phylogenetic tree showed that the VvTSAD4 protein was closely related to succinic semialdehyde dehydrogenase (>XP002265514.1) and an unnamed protein (>CBI24145.3) in grape (Vitis vinifera).

[0037] Example 2 Expression pattern of key enzyme VvTSAD4 in grape tartaric acid biosynthesis and its relationship with fruit tartaric acid accumulation

[0038] The tartaric acid content of the fruit samples of the 'Beichun' grapes at the fruit setting stage (EL-27), the pea-sized stage (EL-31), the color change stage (EL-35), and the ripening stage (EL-38) was determined. Three biological replicates were set for each sample. The method for determining the tartaric acid content of the grape fruit is as follows:

[0039] The fruit samples were ground into powder under the protection of liquid nitrogen, 1.000 g of the sample was accurately weighed into a 25 mL centrifuge tube, 10 mL of 20 g / L metaphosphoric acid solution was added, and the mixture was vortexed and extracted with ultrasonic vibration for 5 min under ice bath conditions, followed by centrifugation at 8000 r / min and 4°C for 10 min. The supernatant was taken and filtered with a 0.45 μm filter membrane for determination.

[0040] High performance liquid chromatography (HPLC) chromatographic conditions and standard sample configuration:

[0041] The analysis was performed using an Agilent 1260xilie high performance liquid chromatograph G1314F VWD series detector from the United States, and the chromatographic column was a ZORBAX SB-C18 (4.6×250 mm, 5 μm) from the United States.

[0042] Mobile phase: 0.1% phosphoric acid solution: methanol = 97.5:2.5 (volume ratio) mobile phase isocratic elution for 12 minutes, column temperature 25°C, detection wavelength 210nm, injection volume 10μL. Used for the determination of tartaric acid (TA) content.

[0043] Preparation of standard curve: Accurately weigh 0.2 g of tartaric acid (TA), dilute with 0.1% by volume phosphoric acid aqueous solution to obtain a standard solution, dilute to prepare mixed standard solutions with concentrations of 0.5 mg / ml, 1 mg / ml, and 2 mg / ml, filter with a 0.45 μm water filter membrane and store in a brown sample bottle, elute the TA standard using the mobile phase program for tartaric acid (TA) content determination mentioned above; then prepare a standard curve with the standard concentration as the horizontal axis and the peak area as the vertical axis.

[0044] Test results such as Figure 2 As shown, the tartaric acid content of 'Beichun' accumulated greatly during the fruit setting period (EL-27) and the pea-sized period (EL-31), and the concentration began to decrease after the color change. The tartaric acid content in the EL-31 period increased by 4.094 mg / g compared with the EL-27 period.

[0045] Fruit samples of grape 'Beichun' were collected at four developmental stages: fruit setting (EL-27), pea-sized stage (EL-31), color change (EL-35), and maturity (EL-38). Three replicates were made for each stage. 100 mg of pulp was quickly ground into powder in liquid nitrogen. The total RNA of the plant was extracted using the RNAprep Pure polysaccharide and polyphenol plant total RNA extraction kit from Qingke Biotechnology, and cDNA was synthesized using the FastKing RT Kit (with gDNase). For specific operation steps, please refer to the kit operation steps. Gene expression was measured using an Applied Biosystems ABI 7500 quantitative PCR instrument, and the fluorescent quantitative primers were:

[0046] Forward primer qVvTSAD4-F: aggtctacttcggagccagt; (SEQ ID NO.3)

[0047] Reverse primer qVvTSAD4-R: atcattcgtctcctgccctc. (SEQ ID NO.4)

[0048] The qPCR reaction system is shown in Table 1 , and the reaction procedure is shown in Table 2 .

[0049] Table 1 qPCR reaction system (20 μL)

[0050]

[0051] Table 2 qPCR reaction procedure

[0052]

[0053] Analysis of the expression of VvTSAD4, a key enzyme in tartaric acid biosynthesis, in these tissues Figure 3 As shown, the expression level of VvTSAD4 gene in the fruit development process of 'Beichun' increased first and then decreased. The expression level of VvTSAD4 gene increased by 86% in the EL-31 period compared with the EL-27 period.

[0054] Example 3 Basic information of the key enzyme VvTSAD4 in tartaric acid biosynthesis

[0055] The key enzyme of tartaric acid biosynthesis, VvTSAD4, is annotated in the grape database as a transporter of the MFS superfamily. The ORF of this gene is 1593 bp in length, encoding 531 amino acids, and is located on chromosome 19 of the grape genome. The estimated protein size of VvTSAD4 is 56.59 KD, and the isoelectric point (pI) is 7.46.

[0056] Analyze the structure of VvTSAD4, such as Figure 4 As shown, the VvTSAD4 protein contains the same TSAD (PLN02278) family domain and is a member of the superfamily CL11961.

[0057] Example 4 Analysis of transient overexpression of VvTSAD4, a key enzyme in tartaric acid biosynthesis

[0058] (1) Vector construction

[0059] The full-length CDS of VvTSAD4 was cloned using homology arm primers with restriction sites and ligated to the pCAMBIA1300 expression vector, which contains BamHI and SacI sites and has a 35S promoter as a strong promoter. The primer sequences are:

[0060] pC1300-VvTSAD4-F: ctctcgagctttcgcgagctcatggggatatcgcagatgg; (SEQ IDNO.5)

[0061] pC1300-VvTSAD4-R: gcccttgctcaccatggatcctcagttattgctttatatttccgaag. (SEQ ID NO.6)

[0062] Follow the steps below:

[0063] a. Using grape fruit cDNA template, add specific primers with SacI and BamHI restriction sites (SEQ ID NO.5 and SEQ ID NO.6) to amplify the VvTSAD4 gene ( Figure 5 ), the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4; after successful sequencing and alignment, gel recovery of the target fragment was performed (agarose gel DNA recovery kit, Tiangen) according to the manufacturer's instructions.

[0064] Table 3 PCR reaction system

[0065] Reaction solution components volume 2×HieffCanace Gold PCR Master Mix 10μL Forward primer (10 μM) 0.8μL Reverse primer (10 μM) 0.8μL cDNA 1μL <![CDATA[ddH2O]]> 7.4μL

[0066] Table 4 PCR reaction program

[0067]

[0068]

[0069] b. Double digest the pCAMBIA1300 vector with SacI and BamHI. See Table 5 for the enzyme digestion system.

[0070] Table 5 pCAMBIA1300 vector restriction enzyme digestion system

[0071] Reaction solution components volume 10xFuniCutTM Buffer 2μL pCAMBIA1300 vector 2μL FuniCutTM BamHI 1μL FuniCutTM SacI 1μL <![CDATA[ddH2O]]> 14μL

[0072] Mix the above reaction solution (do not vortex), centrifuge it instantaneously, incubate it at 37°C for 15 min, detect it using 1% agarose gel, and recover the cut vector.

[0073] c. Use 2×Hieff Clone MultiS Enzyme Premix to connect the recovered VvTSAD4 target fragment and the linear pCAMBIA1300 vector, and react in a 50℃ water bath for 20 minutes. The resulting connection product is the pC1300-VvTSAD4 recombinant plasmid. The connection product is transformed into E. coli competent cells DH5α by heat shock method, spread on LB solid medium containing kanamycin, pick single colonies, and detect positive clones by PCR ( Figure 6 ) and sent the positive colonies for sequencing.

[0074] d. The successfully sequenced plasmid was transformed into GV3101 Agrobacterium competent cells, and then placed in an ice bath for 5 minutes, liquid nitrogen quick-freeze for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes. 700 μL of LB liquid medium was added, and 80 μL of bacterial liquid was evenly spread on LB solid medium containing kanamycin and rifampicin resistance. After drying, it was placed in a 28°C incubator for 24-36 hours. Single colonies were picked, and positive clones detected by PCR were used for transient transformation of grape fruit.

[0075] (2) Transient overexpression of VvTSAD4 in grape berries and identification

[0076] In order to verify the function of VvTSAD4 in tartaric acid biosynthesis, Agrobacterium carrying pC1300-VvTSAD4 was transiently transformed into young grape fruits by the fruit stem infection method as the experimental group; the pCAMB IA1300 vector was used as the control.

[0077] The infection method is as follows:

[0078] Shake the culture: Add the Agrobacterium culture liquid carrying pC1300-VvTSAD4 to the LB liquid culture medium containing kanamycin and rifampicin resistance, and culture overnight at 180 rpm and 28°C; the culture medium involved is specifically shown in Table 6.

[0079] Table 6

[0080]

[0081]

[0082] Bacterial liquid collection: centrifuge at 7000r / min for 7min and discard the supernatant;

[0083] Resuspend the bacterial suspension and adjust the OD 600 Value: Resuspend the bacterial precipitate with resuspension solution and adjust the solution OD with a UV spectrophotometer 600 to 0.7;

[0084] Infection of young grape fruits: Use young grape fruits of the same growth and size to retain the stalks, soak them in heavy suspension, randomly sample on the 0th, 2nd, 4th, 6th, 8th and 10th day, remove the seeds from the samples and store them at -80℃, extract RNA and reverse transcribe it into cDNA, and perform qRT-PCR determination. The reaction system of qRT-PCR determination is shown in Table 7, and the amplification program is shown in Table 8.

[0085] Table 7 Fluorescence quantitative reaction system

[0086]

[0087] Table 8 qRT-PCR amplification procedure

[0088]

[0089] The relative expression level of VvTSAD4 gene showed a significant upward trend from the 0th day to the 2nd day of fruit infection and reached a peak (e.g. Figure 8 ), the relative expression of VvTSAD4 gene on the 2nd day after infection increased by 0.54 compared with the 0th day, and then began to decline significantly on the 4th day, and the change trend was different from that of the control group. The relative expression of VvTSAD4 gene on the 2nd and 4th days after infection was 4.512 times and 2.1 times that of the control group, respectively. Compared with the 0th day, the growth rate of the relative expression of the gene on the 2nd day was 46.12%, while that of the control group decreased. Figure 8 It can be seen that the transgenic grape fruits are significantly over-expressed at the DNA level.

[0090] (3) Changes in tartaric acid content in VvTSAD4 overexpressing grape berries

[0091] VvTSAD4 is closely related to tartaric acid biosynthesis, and the tartaric acid content was significantly increased by high performance liquid chromatography. Figure 7 As shown, the tartaric acid content increased significantly 2 days after infection, and increased by 0.3414 mg / g, 0.6159 mg / g, and 0.6416 mg / g on the 4th, 6th, and 8th days compared with the 2nd, 4th, and 6th days, respectively. After 6 and 8 days of infection, the tartaric acid content of the test group increased by 18.8% and 15.8% respectively compared with the control group at the same time.

[0092] Example 5 Genetic transformation of VvTSAD4, a key enzyme in tartaric acid biosynthesis, in tomato

[0093] 1. Genetic transformation of tomato

[0094] (1) Seeding

[0095] Soak 'Micro-Tom' tomato seeds in 75% alcohol by volume for 1 minute, then wash once with sterile water, sterilize with 50% 84 disinfectant by volume for 10 minutes, and wash 5 times with sterile water; then sow the treated tomato seeds on M0 culture medium with sterile tweezers and culture in the dark at 24°C for 5-6 days.

[0096] (2) Explant infection and co-culture

[0097] The pC1300-VvTSAD4 Agrobacterium culture liquid was expanded to OD600 = 0.8, and the expanded culture liquid was centrifuged at 3000rpm for 20min, the supernatant was discarded, 1ml DM medium was added to gently wash the bacteria, and then discarded, and 1ml DM medium was added to suspend it with a pipette, shaken, and placed on ice for activation; at the same time, the cotyledons of the grown tomato seedlings were cut vertically in the DM medium with sterile tweezers and a scalpel, and the size was 0.8-1.0cm 2 , as explants; put the cut explants into the pC1300-VvTSAD4 resuspension and infect them for 15 minutes; after infection, use sterile tweezers to clamp the explants onto sterile filter paper to absorb excess bacterial liquid, and then place them on M1 culture medium and culture them in the dark at 24℃ for 48 hours.

[0098] (2) Selective training

[0099] After culturing in M1 medium, the explants were transferred to M2 medium and cultured for 15 to 20 days at 24°C with 16h / 8h light-dark alternation.

[0100] The explants after selection culture were transferred to M3 medium for differentiation culture, and subcultured every 20 days until budding.

[0101] (3) Rooting culture

[0102] After the buds have differentiated and obvious growth points can be seen, use sterile tweezers and a scalpel to carefully cut the buds from the callus tissue, avoiding the attachment of excess callus tissue and avoiding damaging the growth points. Then transfer them to M4 medium and culture them at 24°C with 16h / 8h alternating light and dark until roots form.

[0103] Table 9 Culture medium used in tomato genetic transformation system

[0104]

[0105] 2. Identification of genetically transformed positive plants and determination of TA content

[0106] After rooting, some leaves of the T0 generation tomato plants were taken and DNA was extracted using a DNA extraction kit ( Plant DNA Kit, Yisheng) was used to extract DNA from tomato leaves, and PCR was performed using 557 bp hygromycin tag Hpt-F / Hpt-R as primers; forward primer Hpt-F: acactacatggcgtgatttcat (SEQ ID NO.7); reverse primer Hpt-R: tccactatcggcgagtacttct (SEQ ID NO.8), and then molecular positive detection was performed ( Fig.10 ), the PCR system and method are the same as those in Table 3 and Table 4. Then the positive tomato seedlings were transplanted to a greenhouse for growth, and the fruits were harvested after maturity and kept as seeds. After that, the seeds were sown and conventional cultivation management was carried out. The TA content of the fruits of the T1 generation plants of the transgenic VvTSAD4 gene strains (OE1, OE2, OE3, OE4) was detected, and the wild-type 'Micro-Tom' tomato was used as the control (WT). The results showed that the TA content of the OE1, OE2, OE3, and OE4 strains was significantly higher than that of the WT ( Fig.11 ), compared with WT, they are improved by 138.52%, 304.6%, 370.71% and 123.98% respectively.

[0107] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. The key enzyme of grape tartaric acid biosynthesis VvTSAD4, characterized in that: The amino acid sequence of the key enzyme VvTSAD4 in tartaric acid biosynthesis is shown in SEQ ID NO.

1.

2. A gene encoding the key enzyme VvTSAD4 in tartaric acid biosynthesis according to claim 1.

3. The gene according to claim 2, characterized in that The coding sequence of the gene is the nucleotide sequence shown in SEQ ID NO.

2.

4. A recombinant vector containing the gene shown in claim 2 or 3.

5. A recombinant genetically engineered bacterium or transgenic plant tissue transformed with the recombinant vector according to claim 4.

6. Use of the key enzyme VvTSAD4 in tartaric acid biosynthesis according to claim 1 in increasing the tartaric acid content in grape berries.

Images