Application of Prevotella copri as children metabolism-related fatty liver disease biomarker and therapeutic target

Abstract

The invention discloses application of Prevotella copri as a children's metabolism-related fatty liver disease (MASLD) biomarker and a therapeutic target, relates to the fields of medical microbiology and metabonomics, and explores biological characteristics of the Prevotella copri and an action mechanism of the Prevotella copri in children's metabolism-related fatty liver disease (MASLD). The invention also analyzes the effect of Prevotella copri and its metabolite 5-aminovaleric acid in the development of children's metabolism-related fatty liver disease (MASLD), and provides a basis for developing a method for treating metabolism-related fatty liver disease (MASLD) based on intestinal microorganisms. According to the present invention, the Prevotella copri is subjected to intragastric administration to the mouse fed with the high fat diet, such that the liver fat change and the intestinal flora disorder aggravating are found; the metabolite 5-amino valeric acid of the Prevotella copri can be used for aggravating the adiposis of the liver cells. Therefore, the Prevotella copri and the metabolite 5-aminovaleric acid of the Prevotella copri can be used as a biomarker and a therapeutic target for diagnosis, treatment, prognosis evaluation or drug screening of the MASLD (Metabolism-related Fatty Liver Disease) of children.

Description

Technical Field

[0001] The present invention relates to the fields of medical microbiology and metabolomics, explores the biological characteristics of Prevotella copri and its mechanism of action in childhood metabolic-associated fatty liver disease, and analyzes the role of Prevotella copri and its metabolite 5-aminovaleric acid (5-AVA) in the development of childhood metabolic-associated fatty liver disease (MASLD), providing a basis for developing a treatment method for metabolic-associated fatty liver disease (MASLD) based on intestinal microorganisms. The present invention particularly relates to the application of Prevotella copri as a biomarker and therapeutic target for childhood metabolic-associated fatty liver disease (MASLD). Background Art

[0002] Metabolic dysfunction-associated steatotic liver disease (MASLD) is an alternative name for non-alcoholic fatty liver disease (NAFLD). It has become the most common cause of chronic liver disease worldwide, with a global prevalence of approximately 25%. MASLD may progress from simple steatosis to metabolic dysfunction-associated steatotic liver disease (MASLD). assoc MASLD is a chronic hepatic fibrosis (HCC) disease that is associated with various degrees of liver fibrosis and may even progress to cirrhosis and MASH-related hepatocellular carcinoma (HCC). It is estimated that the prevalence of MASLD in children worldwide is 3-10%, while the prevalence in obese children can rise to more than 30%.

[0003] There are pathological differences between MASH in children and adults. MASH type 2 is the main manifestation in children, which is characterized by fatty liver, portal inflammation, and portal fibrosis. In the diagnosis of MASLD, liver biopsy remains the gold standard for distinguishing simple hepatic steatosis from MASH and staging fibrosis, but its large-scale application is limited due to its invasiveness. Currently, the most commonly used diagnostic method in clinical practice is still ultrasound contrast imaging. Although it is easy to perform, ultrasound may not be able to detect fatty degeneration acutely when the degree of fatty degeneration is very low, and it is highly dependent on the operation. In addition, due to the lack of mechanistic understanding of MASLD in children and the many factors affecting the onset of the disease, there is still a lack of specific therapeutic drugs for MASLD in children. Therefore, new biologically based, easily accessible, and specific biomarkers and therapeutic targets are urgently needed. Studies in recent years have shown that intestinal flora and metabolites may be important contributors to the progression of MASLD in children, but their pathogenic effects and mechanisms are still poorly understood.

[0004] Prevotella copri, a signature species of the enterotype of Prevotella, has been shown to induce insulin resistance, aggravate glucose intolerance, and increase levels of circulating branched-chain amino acids. A previous study by Michail et al. reported that the abundance of Prevotella was higher in children with NAFLD compared with controls, highlighting its potential role in the pathogenesis of NAFLD in children. In addition, Schwimmer et al. conducted a large case-control study comparing the gut microbiota of obese children with or without NAFLD. They found that children with NAFLD had a lower diversity of the gut microbiota compared with healthy controls. Importantly, in children with NAFLD, a higher abundance of Prevotella copri, lower α-diversity, and more severe fibrosis were found. Although these evidences demonstrate that Prevotella copri may affect the development and progression of MASLD in children, the molecular mechanisms of its action remain to be elucidated.

[0005] Currently, the gold standard for diagnosing MASLD in children is still liver biopsy, and there is a lack of new biologically based non-invasive diagnostic and prognostic biomarkers; the main method for treating MASLD in children is still lifestyle changes, and there are no FDA-approved drugs; although evidence shows that Prevotella copri may modulate key features of MASLD in children, the molecular mechanisms behind its function remain largely unexplored. Summary of the invention

[0006] In view of the above-mentioned defects of the prior art, the present invention aims to solve the deficiencies in the prior art by deeply exploring the biological characteristics of Prevotella copri and its mechanism of action in childhood metabolic associated fatty liver disease (MASLD), hoping to provide an intestinal microbial therapy based on Prevotella copri and its metabolites to effectively alleviate the progression of childhood metabolic associated fatty liver disease (MASLD).

[0007] To achieve the above objectives, the present invention provides, on one hand, a use of Prevotella copri as a biomarker for childhood metabolism-related fatty liver disease.

[0008] Preferably, the Prevotella copri promotes metabolic associated fatty liver disease (MASLD) in children via its metabolite 5-aminovaleric acid (5-AVA).

[0009] Another aspect of the present invention provides a use of Prevotella copri as a therapeutic target for childhood metabolic associated fatty liver disease (MASLD).

[0010] Preferably, the Prevotella copri promotes metabolic associated fatty liver disease (MASLD) in children via its metabolite 5-aminovaleric acid (5-AVA).

[0011] A third aspect of the present invention provides a drug for treating childhood metabolic associated fatty liver disease (MASLD), wherein the drug targets Prevotella copri or its metabolite 5-aminovaleric acid.

[0012] Preferably, the medicament can reduce or eliminate Prevotella copri or its metabolite 5-aminovaleric acid in children.

[0013] A fourth aspect of the present invention provides a use of a reagent for detecting Prevotella copri or its metabolite 5-aminovaleric acid in the preparation of a kit for diagnosing childhood metabolic associated fatty liver disease (MASLD).

[0014] Preferably, the diagnosis of metabolic associated fatty liver disease (MASLD) in children comprises:

[0015] Collect samples from the experimental group;

[0016] Determine the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the samples of the experimental group by using a reagent for detecting Prevotella copri or its metabolite 5-aminovaleric acid;

[0017] The expression levels of the experimental group were compared with those of the control group to determine whether the experimental group had childhood metabolic associated fatty liver disease (MASLD).

[0018] Preferably, if the expression level of Prevotella copri or its metabolite 5-aminovaleric acid is elevated, the experimental group is determined to suffer from childhood metabolic associated fatty liver disease (MASLD).

[0019] The fifth aspect of the present invention provides a system for evaluating and diagnosing metabolic associated fatty liver disease (MASLD) in children, characterized in that it includes a detection device and a comparison device, wherein the detection device is used to detect the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the experimental group; the comparison device is used to compare the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the experimental group with the expression level of Revotella copri or its metabolite 5-aminovaleric acid in the control group to determine whether the experimental group suffers from metabolic associated fatty liver disease (MASLD) in children.

[0020] Beneficial technical effects of the present invention:

[0021] This invention deeply explores the molecular mechanism of Prevotella copri in regulating the development of metabolic-associated fatty liver disease (MASLD) in children; compared with the existing diagnostic methods and non-specific drug treatments for metabolic-associated fatty liver disease (MASLD) in children, this invention explores specific intestinal microorganisms and their metabolites, discovers new non-invasive diagnostic and prognostic biomarkers, and also provides new targets for treatment. This diagnostic and treatment program based on specific microorganisms may improve patient compliance and treatment effects.

[0022] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1, (A) Representative images of H&E staining (bar 50 μm), Oil Red O staining (bar 100 μm) and BODIPY staining (bar 100 μm) of liver sections of mice in the control group (fed with standard mouse chow), high-fat diet group (HFD) and HFD+Prevotella copri group (HFD+PC), showing that Prevotella copri aggravated hepatic steatosis in HFD-fed young mice. (BC) Levels of triglyceride (B) and cholesterol (C) in the liver of mice in different groups (n=8-10). The level of triglyceride in the liver of mice in the HFD+Prevotella copri group (HFD+PC) was significantly increased, while there was no significant difference in cholesterol level. (DF) Levels of serum triglyceride (D), cholesterol (E) and free fatty acids (F) in mice in different groups (n=6-10). The levels of serum cholesterol and free fatty acids in mice in the HFD+Prevotella copri group (HFD+PC) were significantly increased, while there was no significant difference in triglyceride level. (G) Expression levels of Acc1, Scd1, Cd36, Fatp2, Fatp5, and Apob genes in the liver of mice in different groups, showing that Prevotella copri increased the expression of genes related to lipogenesis (Acc1 and Scd1) and fatty acid uptake (Cd36, Fatp2, and Fatp5). (HI) Western blot analysis (H) and quantification (I) of APOB protein levels in mouse liver, with TUBULIN as an internal reference (n=4), showing that APOB protein levels were significantly decreased in the HFD+Prevotella copri group (HFD+PC) mice. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0024] Figure 2, (A) Representative images of liver sections of mice (n=8-10) stained with F4 / 80 (scale bar 50μ m) and Sirius red (scale bar 100μ m) in the control group (standard mouse diet), high-fat diet group (HFD) and HFD+Prevotella copri group (HFD+PC), showing no significant differences in the levels of inflammation and fibrosis in the livers of mice in different groups. (BC) Expression levels of Ccl2 (B) and Tnf (C) in mRNA in the livers of mice in different groups (n=5-10), showing that the expression of inflammatory genes in mice in the HFD+Prevotella copri group (HFD+PC) was significantly increased compared with the HFD group. (D) There was no significant difference in the levels of collagen in the livers of mice in different groups (n=5-10). (EF) Expression levels of Tgfb (E) and Ctgf (F) in the mRNA of the liver of mice in different groups (n=6-8), showing that the expression of genes related to liver fibrosis in the HFD+Prevotella copri group (HFD+PC) mice was significantly increased. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0025] Figure 3 , (AB) Shannon index (A) and Simpson index (B) of mice in the control group (fed with standard mouse chow), high-fat diet group (HFD), and HFD+Prevotella copri group (HFD+PC) based on 16s rDNA sequencing, showing that the diversity of intestinal flora in the HFD+Prevotella copri group (HFD+PC) mice was significantly decreased compared with the HFD group. (C) Principal coordinate analysis (PCoA) plots of each sample showed that the clustering patterns among mice in different groups were different. (D) Average relative abundance of bacteria at the phylum level in mice in different groups. (EF) Average relative abundance of Firmicutes and Bacteroidota in mice in different groups showed that the abundance of Firmicutes in mice in the HFD+Prevotella copri group (HFD+PC) was significantly increased, while the abundance of Bacteroidetes was significantly decreased. *P<0.05, **P<0.01, ***P<0.001.

[0026] Figure 4, (AB) After HepG2 cells were treated with 0.3mM palmitic acid (PA) or 0.3mM PA+10% Prevotella copri culture supernatant (PA+PC) for 24 hours, representative images of Oil Red O staining (bar 75μm) in different groups (A), and triglyceride levels of HepG2 cells (n=8) in different groups (B). (CD) Primary hepatocytes were isolated from 6-week-old mice and treated with 0.3mM PA or 0.3mM PA+10% Prevotella copri culture supernatant (PA+PC) for 24 hours. Representative images of Oil Red O staining (bar 75μm) in different groups (C), and triglyceride levels of primary hepatocytes (n=7-8) in different groups (D). It shows that the supernatant of Prevotella copri culture significantly promotes lipid accumulation in HepG2 cells and primary hepatocytes. *P<0.05, **P<0.01, ****P<0.0001.

[0027] Figure 5 , (A) Heat map showing 47 differential metabolites in the supernatant of Prevotella copri culture compared with the culture medium (n=3). (B) Heat map showing 37 significantly increased metabolites and the top 40 significantly decreased metabolites in the feces of HFD group mice and HFD+Prevotella copri group (HFD+PC) mice (n=4). The metabolite 5-aminopentanoic acid or 5-aminovaleric acid (5-AVA) was found to be significantly increased in the supernatant of Prevotella copri culture and the feces of HFD+Prevotella copri group (HFD+PC) mice. (CE) HepG2 cells were treated with control, 0.3 mM PA or 0.3 mM PA + 0.1 mM 5-AVA (PA + 5-AVA) for 24 hours; primary hepatocytes isolated from 6-week-old mice were treated with control, 0.3 mM PA or 0.3 mM PA + 1 mM 5-AVA (PA + 5-AVA) for 24 hours. Representative images of Oil Red O staining (bar 75 μm) of different groups (C), triglyceride levels of HepG2 cells (n = 4) in different groups (D), and triglyceride levels of primary hepatocytes (n = 4-8) in different groups (E), showing that 5-AVA exacerbated PA-induced lipid accumulation in HepG2 cells and primary hepatocytes. *P < 0.05, ***P < 0.001, ****P < 0.0001.

[0028] Figure 6(A) After primary hepatocytes isolated from 6-week-old mice were treated with control, 0.3 mM PA, or 0.3 mM PA + 1 mM 5-AVA (PA + 5-AVA) for 24 h, the expression levels of genes related to lipogenesis (Acc1 and Scd1), fatty acid uptake (Cd36, Fatp2, and Fatp5), and very low-density lipoprotein (VLDL) export (Apob) in different groups (n = 4-8) were detected by qPCR. Compared with the PA group, the expression of Acc1, Scd1, Fatp2, and Fatp5 was significantly upregulated in the PA + 5-AVA group. (BC) Western blot analysis (B) and quantification (C) of APOB protein levels in mouse primary hepatocytes, with TUBULIN as an internal reference (n = 4), showing that APOB protein levels were significantly reduced in mouse primary hepatocytes treated with PA + 5-AVA. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. DETAILED DESCRIPTION

[0029] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0030] In the drawings, components with the same structure are indicated by the same numerical reference numerals, and components with similar structures or functions are indicated by similar numerical reference numerals. The size and thickness of each component shown in the drawings are arbitrarily shown, and the present invention does not limit the size and thickness of each component. In order to make the illustration clearer, the thickness of the components is appropriately exaggerated in some places in the drawings.

[0031] Prevotella copri (P.copri) is a Gram-negative bacterium that is a penicillinase-positive anaerobic bacterium. This strain grows and reproduces in the human gastrointestinal tract and has strong metabolic activity. Studies have found that Prevotella copri strains are widely present in the intestines of normal people, and the number is relatively stable.

[0032] The main technical solutions of the present invention are as follows:

[0033] Three-week-old male C57BL / 6J mice were used to construct an animal model of metabolic-associated fatty liver disease (MASLD) in children using a high-fat diet (HFD). Prevotella copri was introduced into the mice.

[0034] (1) Mouse liver tissues were collected and sliced, and the effects of Prevotella copri on liver steatosis, inflammation, and fibrosis in mice were investigated using hematoxylin and eosin (H&E), Sirius red, F4 / 80, Oil Red O (ORO), and BODIPY staining.

[0035] (2) Using biochemical analysis, we measured triglyceride and total cholesterol levels in mouse serum and hepatocytes, liver hydroxyproline levels, and serum free fatty acid levels to evaluate the effect of Prevotella copri on hepatic steatosis;

[0036] (3) Determine the mRNA expression levels of genes related to lipogenesis (Acc1 and Scd1), fatty acid uptake (Cd36, Fatp2, and Fatp5), inflammation (Ccl2 and Tnf), and fibrosis (Tgfb and Ctgf) in the mouse liver, and evaluate the effects of Prevotella copri on metabolic-associated fatty liver disease (MASLD)-related phenotypes;

[0037] (4) Western blot analysis was used to investigate the changes in APOB protein levels in mouse liver and to evaluate the effect of Prevotella copri on very low-density lipoprotein (VLDL) transport;

[0038] (5) Based on 16S rDNA sequencing, the effect of Prevotella copri on the composition of intestinal flora was evaluated.

[0039] A common differential metabolite, 5-aminopentanoic acid (5-AVA), was found in the supernatant of cultured Prevotella copri and the feces of mice in the HFD+Prevotella copri group (HFD+PC). The mechanism of action of Prevotella copri and its metabolite 5-AVA was further verified in in vitro experiments using HepG2 cells (a human hepatocellular carcinoma cell line) and primary hepatocytes isolated from 6-week-old mice. It was found that 5-AVA promoted lipid synthesis and fatty acid uptake while reducing the output of very low-density lipoprotein (VLDL), leading to liver fat accumulation, thereby promoting the development of metabolic-associated fatty liver disease (MASLD) in children.

[0040] In order to make the present invention more concise and easy to understand, the research method is described in detail with the accompanying drawings as follows:

[0041] 1. Materials and Methods

[0042] 1.1 Construction of animal model

[0043] Three-week-old male C57BL / 6J mice were purchased from Shanghai Jihui Experimental Animal Co., Ltd. and randomly divided into three groups: (1) control group (n = 10): mice were fed with standard feed and gavaged with sterile PBS buffer twice a week; (2) high-fat diet (HFD) group (n = 10): mice were fed with a high-fat diet (60 kcal% fat, 20 kcal% protein, 20 kcal% carbohydrate) and gavaged with sterile PBS buffer twice a week; (3) HFD+Prevotella copri group (n = 10): mice were fed with a high-fat diet and gavaged with Prevotella copri (10^9 CFU / mouse) twice a week. The body weight and food intake of mice were recorded weekly. At the end of the fifth week, after fasting for 6 hours, all mice were euthanized, and blood, liver tissue, and intestinal tissue were collected for analysis.

[0044] Mice were kept in a specific pathogen free (SPF) environment (temperature 22-26°C, humidity 65%, and light-dark cycle of 12 h). Animal experiments were approved by the Animal Care and Use Committee of Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine and were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of the National Research Council.

[0045] 1.2 Biochemical analysis

[0046] Blood samples obtained from mice were centrifuged at 3000 rpm for 15 minutes at 4°C to obtain serum. Triglyceride and total cholesterol levels in mouse serum and hepatocytes were determined using commercially available kits (Pulile Gene Technology Co., Ltd., Beijing). Liver hydroxyproline levels were detected according to the instructions (Solebo Technology Co., Ltd., Beijing). Serum free fatty acid levels were determined using a free fatty acid content assay kit (Solebo Technology Co., Ltd., Beijing).

[0047] 1.3 Histological analysis

[0048] Mouse livers were fixed overnight with 4% paraformaldehyde, embedded in paraffin, and sliced ​​for hematoxylin and eosin (H&E) staining to assess liver lipid accumulation. Sirius red staining was performed to assess the degree of liver fibrosis. At the same time, paraffin sections of liver tissue were immunohistochemically stained with rabbit anti-F4 / 80 polyclonal antibody (Sevier Biotechnology Co., Ltd., Wuhan) as the primary antibody to assess the degree of liver inflammation. In addition, frozen liver tissues of mice embedded in OCT were stained with Oil Red O (ORO) and BODIPY to assess liver lipid accumulation.

[0049] 1.4 Real-time quantitative PCR

[0050] Total RNA was extracted from mouse liver tissue using TRIzol reagent, and its concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, United States). Subsequently, 1 g of total RNA was converted into cDNA using Hifaire111st Strand cDNA Synthesis SuperMix (Yisheng Biotechnology Co., Ltd., Shanghai), a ready-to-use premix for first-strand cDNA synthesis. Quantitative PCR analysis (qPCR) was performed on the QuantStudio Dx Real-Time platform (ThermoFisher Scientific) using SYBR Green MasterMix (Yisheng Biotechnology Co., Ltd., Shanghai). The primer sequences are summarized in Table 1. 18S was used as an internal reference gene.

[0051] Table 1 Quantitative PCR primer sequences

[0052] Gene name Species Forward sequence Reverse sequence CD36 mouse CATTTGCAGGTCTATCTACG CAATGTCTAGCACACCATAAG Scdl mouse AACATTCAATCCCGGGAGAATA GAAACTTTCTTCCGGTCGTAAG Accl mouse TTCACTCCACCTTGTCAGCGGA GTCAGAGAAGCAGCCCATCACT Fatp2 mouse CTGCGGTACTTGTGTAACGTCC TCCGAATGGGACCAAAGCGTTG Fatp5 m0use TTCAACAGCGGAGACCTCCTGA CCACGATGTCAGCGACTTCTGT Ccl2 mouse ATTGGGATCATCTTGCTGGT CCTGCTGTTCACAGTTGCC Tnf mouse GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG Acox1 mouse CGCACATCTTGGATGGTAGT GGCTTCGAGTGAGGAAGTTATAG Apob mouse GCATGAGTATGCCAATGGTCTCC CTGGTTGCCATCTGAAGCCATG Ct mouse GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA Tgb mouse AGCTGGTGAAACGGAAGCG GCGAGCCTTAGTTTGGACAGG 18S mouse ACGGAAGGGCACCACCAGGA CACCACCACCCACGGAATCG

[0053] 1.5 Western blot analysis

[0054] Western blot was used to determine the APOB protein level in mouse liver. Briefly, the proteins were processed by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred to nitrocellulose membranes. Rabbit anti-APOB and TUBULIN polyclonal antibodies (Wuhan Sanying Biotechnology Co., Ltd., Wuhan) were used as primary antibodies. Goat anti-rabbit IgG antibody (Biyuntian Biotechnology Co., Ltd., Shanghai) was used as secondary antibody. Densitometric analysis of immunoblots was performed using Image Lab4.1 software (Bio-Rad, Hercules, CA).

[0055] 1.6 Bacterial DNA extraction and 16S rDNA sequencing

[0056] Bacterial DNA was extracted from mouse feces using the TIANamp fecal DNA kit (Tiangen Biochemical Technology Co., Ltd., Beijing). The integrity of the extracted DNA was detected by 1% agarose gel electrophoresis. Samples were selected for sequencing based on the quantity and quality of the extracted DNA. The V3-V4 region of the 16SrDNA gene was amplified and purified on the I11umina Miseq platform (Meiji Biopharmaceutical Technology Co., Ltd., Shanghai) for sequencing. Fastp (v0.19.6) and Flash (v1.2.11) were used to perform quality control, splicing and filtering on the raw data. The DADA2 plug-in on the QIIME2 platform was used to denoise the sequence to resolve the amplicon sequencing variants (Amplicon Sequence Variants, ASVs). Subsequent classification analysis was performed based on the representative sequences and abundance information of ASVs. The raw data of 16S rDNA sequencing can be obtained from the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI), with the BioProject number being PRJNA1101524.

[0057] 1.7 Untargeted metabolomics

[0058] Fecal samples were collected from mice in the HFD group and the HFD+P.revotekla copri group at week 5. The supernatant was collected when the OD600 of the P.revotella copri culture was 1. Liquid chromatography analysis was performed using a Vanquish UHPLC system (Thermo Fisher Scientific). HSS T3 (2.1 × 100 mm, 1.8 μm) (Waters, Milford, MA) column. Raw data were converted to mzXML format by the MSConvert tool in the ProteoWizard software package (v3.0.8789), and then feature detection, retention time correction, and peak alignment were performed using the xcms software package (v3.12.0). Metabolites were identified by accurate mass and matched with multiple databases, including HMDB, MassBank, KEGG, LipidMaps, mzCloud, and the database constructed by Suzhou Panomik Biopharmaceutical Technology Co., Ltd. Orthogonal partial least squares discriminant analysis (OPLS-DA) was performed using the R software package “ropls (v1.6.2)”. Differential metabolites were screened using VIP ≥ 1 and P < 0.05 as the criteria.

[0059] 1.8 Cell culture and treatment

[0060] Primary hepatocytes were isolated from 6-week-old C57BL / 6J mice (refer to the study of Llorente C et al., the mouse liver was perfused in vivo, using a calcium-free salt solution containing 0.5 mM ethylenediaminetetraacetic acid (EGTA) to remove calcium ions in the liver; then the perfusion was continued using a solution containing 0.02% type I collagenase; after perfusion, the mouse liver tissue was gently minced on a culture dish and filtered through a nylon cell sieve with a pore size of 70 μm to separate the hepatocytes; the separated hepatocytes were washed three times and then centrifuged at 50×g for 1 minute to remove impurities and unseparated tissues) and cultured in DMEM / F-12 medium supplemented with 10% fetal bovine serum (FBS). HepG2 cells are a human hepatocellular carcinoma cell line obtained from the American Type Culture Collection (ATCC, HB-8065) ​​and cultured in high-glucose DMEM medium supplemented with 10% FBS.

[0061] To evaluate the effect of Prevotella copri-derived metabolite (5-AVA) on cellular lipid accumulation, HepG2 cells or mouse primary hepatocytes were treated for 24 h with different treatments, including control, 0.3 mM palmitic acid (PA), and PA co-cultured with 10% Prevotella copri culture supernatant or 5-AVA, with 5-AVA concentrations of 0.1 mM for HepG2 cells and 1 mM for primary hepatocytes. Lipid accumulation was determined by Oil Red O staining and cellular triglyceride content.

[0062] 1.10 Statistical analysis

[0063] Statistical analysis was performed using GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA). All data are presented as Mean ± SEM (unless otherwise indicated). For statistical comparisons, Student's t test or one-way ANOVA followed by Tukey's multiple comparisons were used to compare normally distributed variables. P < 0.05 was considered statistically significant.

[0064] 2. Results

[0065] 2.1 Prevotella copri aggravates liver steatosis in HFD-fed mice: Compared with the control group and HFD group, the liver triglyceride level and serum cholesterol and free fatty acid levels of mice in the HFD+Prevotella copri group were significantly increased; at the same time, the expression of genes related to lipogenesis and fatty acid uptake in the HFD+Prevotella copri group increased. Although the expression of the Apob gene at the mRNA level did not change significantly in the HFD+Prevotella copri group, its protein level was significantly reduced. ( Figure 1 )

[0066] 2.2 Prevotella copri upregulates the expression of genes related to inflammation and fibrosis in HFD-fed mice. Figure 2 )

[0067] 2.3 Prevotella copri changes the composition of the intestinal microbiota of mice fed with HFD: Compared with the HFD group, the α diversity of the intestinal microbiota in the HFD+Prevotella copri group was significantly decreased; the clustering patterns of the intestinal microbiota between different groups of mice were significantly different; in the HFD+Prevotella copri group of mice, the abundance of Firmicutes increased significantly, while the abundance of Bacteroidetes decreased significantly. ( Figure 3 )

[0068] 2.4Prevotella copri culture supernatant can increase lipid accumulation in hepatocytes in vitro. Figure 4 )

[0069] 2.5 The metabolite 5-aminovaleric acid (S-AVA) derived from Prevotella copri can promote lipid accumulation in hepatocytes in vitro. Figure 5 )

[0070] 2.65-AVA disrupts lipid metabolism in mouse hepatocytes: increases lipogenesis and fatty acid uptake, and decreases VLDL output. Figure 6 )

[0071] 3. Conclusion

[0072] Prevotella copri is an important pathogen that promotes the development of metabolic-associated fatty liver disease (MASLD) in children. On the one hand, it induces intestinal flora dysbiosis, increasing the proportion of Firmicutes while reducing the proportion of Bacteroidetes, and this change in flora is considered to be a possible factor in the progression of metabolic-associated fatty liver disease (MASLD) in children; on the other hand, importantly, its derived metabolite 5-aminovaleric acid 5-AVA further exacerbates fat accumulation in the liver by promoting lipid synthesis and fatty acid uptake while reducing VLDL output.

[0073] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. Application of Prevotella copri as a biomarker for metabolic-associated fatty liver disease in children.

2. The use according to claim 1, characterized in that: Prevotella copri promotes metabolic-associated fatty liver disease in children through its metabolite 5-aminovaleric acid.

3. Application of Prevotella copri as a therapeutic target for metabolic-related fatty liver disease in children.

4. The use according to claim 3, characterized in that: Prevotella copri promotes metabolic-associated fatty liver disease in children through its metabolite 5-aminovaleric acid.

5. A drug for treating metabolic-related fatty liver disease in children, characterized in that: The drug targets Prevotellacopri or its metabolite 5-aminovaleric acid.

6. The drug according to claim 5, characterized in that The drug can reduce or eliminate Prevotella copri or its metabolite 5-aminovaleric acid in children.

7. Use of reagents for detecting Prevotella copri or its metabolite 5-aminovaleric acid in the preparation of a kit for diagnosing metabolic-related fatty liver disease in children.

8. The use according to claim 7, characterized in that: The diagnosis of metabolic-related fatty liver disease in children includes: Collect samples from the experimental group; Determine the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the samples of the experimental group by using a reagent for detecting Prevotella copri or its metabolite 5-aminovaleric acid; The expression levels of the experimental group were compared with those of the control group to determine whether the experimental group had childhood metabolic-related fatty liver disease.

9. The use according to claim 7 or 8, characterized in that: If the expression level of Prevotella copri or its metabolite 5-aminovaleric acid was elevated, the experimental group was determined to have childhood metabolic-related fatty liver disease.

10. A system for evaluating and diagnosing metabolic-related fatty liver disease in children, characterized in that: The invention comprises a detection device and a comparison device, wherein the detection device is used to detect the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the experimental group; the comparison device is used to compare the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the experimental group with the expression level of Prevotella copri or its metabolite 5-aminovaleric acid in the control group to determine whether the experimental group suffers from pediatric metabolism-related fatty liver disease.

Images