Porphyra yezoensis 10K liquid phase chip and design method and application thereof

Abstract

The invention relates to the technical field of molecular detection, and particularly discloses a porphyra yezoensis 10K liquid phase chip as well as a design method and application thereof. The genetic typing sites of the porphyra yezoensis 10K liquid phase chip comprise 12942 SNP (Single Nucleotide Polymorphism) sites; the physical positions of the 12942 SNP loci are determined on the basis of comparison of a whole genome sequence of a porphyra yezoensis reference genome, and the version number of the whole genome sequence of the porphyra yezoensis reference genome is GCA009829735.1. According to the method, group structure analysis and whole genome association analysis of the porphyra yezoensis can be realized.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection, and in particular to a Porphyra yezoensis 10K liquid phase chip and a design method and application thereof. Background Art

[0002] Porphyra yezoensis is an important large economic seaweed in my country and Asia. Resequencing it and developing high-density SNP markers will help to conduct association analysis and population structure analysis of important economic traits of Porphyra yezoensis at the whole genome level, and provide support for whole genome selection breeding. Therefore, it is essential to establish an effective, rapid, stable, high-throughput, and low-cost genotype identification method.

[0003] Currently, SNP-based gene chips have been developed for multiple crops, but there is still a gap in large seaweeds. Summary of the invention

[0004] The object of the present invention is to provide a Porphyra yezoensis 10K liquid phase chip and a design method and application thereof, so as to realize population structure analysis and whole genome association analysis of Porphyra yezoensis.

[0005] The present invention is achieved through the following technical solutions: A 10K liquid phase chip of Porphyra yezoensis, wherein the genotyping sites of the 10K liquid phase chip of Porphyra yezoensis include 12942 SNP sites; the physical positions of the 12942 SNP sites are determined based on the whole genome sequence alignment of the Porphyra yezoensis reference genome, and the version number of the whole genome sequence of the Porphyra yezoensis reference genome is GCA_009829735.1; wherein the 12942 SNP sites are as shown in Table 1 of the specification.

[0006] Table 1

[0007]

[0008]

[0009]

[0010]

[0011]

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150] Note: The genomic position - "The numbers before it indicate chromosomes," - "The number after the " indicates the physical location of the locus on the corresponding chromosome.

[0151] The 12942 SNP sites of the present invention are obtained through screening based on the DNA sample of Porphyra yezoensis, and the obtained 12942 SNP sites can be used as the basis for genotyping of Porphyra yezoensis; the liquid phase chip designed according to the 12942 SNP sites can realize genotyping of the target SNP sites quickly and at low cost, and the obtained genotyping data can be used for population structure analysis and whole genome association analysis of Porphyra yezoensis.

[0152] In a preferred embodiment, the Porphyra yezoensis 10K liquid phase chip further comprises probes designed based on gene sequences covering 12942 SNP sites.

[0153] A method for designing a Porphyra yezoensis 10K liquid phase chip comprises the following steps: S1. Obtain the original SNP site; S2, compare the original SNP site with the target reference genome to ensure that the original SNP site is consistent with the target reference genome; S3, screening out functional SNP sites for which probes can be successfully designed from the original SNP sites; S4. From the screened functional SNP sites, 12,942 SNP sites were screened according to the principle of uniform distribution of the genome, which are the target SNP sites.

[0154] In a preferred embodiment, in step S3, the screening process includes site filtering and site evaluation.

[0155] In a preferred embodiment, the conditions for site filtering include minimum sequencing depth ≥5X, deletion rate <10%, MAF>0.35 and heterozygosity rate <10%.

[0156] In a preferred embodiment, the principles of site evaluation include a probe length of 110 bp, a probe GC content of 30%-70%, and a number of homologous regions ≤5.

[0157] In a preferred embodiment, in step S3, when screening for functional SNP sites, the probe design segment coverage is required to be greater than or equal to 70%.

[0158] Application of a Porphyra yezoensis 10K liquid phase chip in the analysis of Porphyra yezoensis population structure.

[0159] Application of a Porphyra yezoensis 10K liquid phase chip in genome-wide association analysis of Porphyra yezoensis.

[0160] Application of a Porphyra yezoensis 10K liquid phase chip in Porphyra yezoensis breeding.

[0161] Compared with the prior art, the present invention has the following advantages and beneficial effects: The liquid phase chip designed according to the present invention based on 12942 SNP sites can realize the genotyping of the target SNP sites quickly and at low cost, and the obtained genotyping data can be used for population structure analysis and whole genome association analysis of Porphyra yezoensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0162] The drawings described herein are used to provide a further understanding of the embodiments of the present invention, constitute a part of this application, and do not constitute a limitation of the embodiments of the present invention. In the drawings: Figure 1 This is a statistical diagram of the chromosome distribution of SNP markers drawn based on 12942 SNP sites in Example 1 of the present invention; wherein the right vertical coordinate Length represents the chromosome length; the left vertical coordinate Count represents the number of sites and the number of segments; Figure 2 The SNP marker chromosome distribution map drawn based on 12942 SNP sites in Example 1 of the present invention; Figure 3 This is a Gap distribution diagram drawn based on 12942 SNP sites in Example 1 of the present invention, wherein the abscissa Chrom represents the chromosome, and Position represents the position of the Gap on the chromosome; Figure 4 This is a MAF distribution statistical diagram drawn based on 12942 SNP sites in Example 1 of the present invention; wherein the horizontal axis MAF represents different ranges of the minimum allele frequency, and the vertical axis Count represents the number of sites within each MAF range; Figure 5This is a statistical diagram of SNP marker types drawn based on 12942 SNP sites in Example 1 of the present invention; wherein the horizontal axis Type represents different site types, and the vertical axis Count represents the number of the site type; Figure 6 The PCA population distribution diagram based on 12942 SNP sites drawn in Example 1 of the present invention; Figure 7 This is an evolutionary tree drawn based on 12942 SNP sites in Example 1 of the present invention; Figure 8 This is a polymorphism statistical diagram based on 12942 SNP sites drawn in Example 1 of the present invention; wherein the horizontal axis Diversity is the diversity between samples, and the vertical axis Count represents the number of sample combinations within each diversity range; Fig. 9 This is a principal component analysis diagram of the population structure analysis of the genotypes of 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1 in Example 3 of the present invention; Fig.10 This is a phylogenetic tree diagram of population structure analysis of genotypes of 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1 in Example 3 of the present invention; Fig.11 The line graph of CV value changes at different K values ​​for population structure analysis of 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1 in Example 3 of the present invention; Fig.12 This is a Manhattan plot of leaf length when whole-genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1 in Example 4 of the present invention. The dotted line in the figure represents the screening threshold (−log10(P) = 5.03; Fig.13 This is a leaf length QQ diagram when whole genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1 in Example 4 of the present invention; wherein the horizontal axis expected −log10(P) represents the logarithm of the theoretical expected value, and the vertical axis Observed −log10(P) represents the logarithm of the measured expected value; Fig.14 This is a Manhattan plot of leaf width when whole-genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1 in Example 4 of the present invention. The dotted line in the figure represents the screening threshold (−log10(P) = 5.03; Fig.15This is a leaf width QQ plot of Example 4 of the present invention when whole genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1; wherein the abscissa expected −log10(P) represents the logarithm of the theoretical expected value, and the ordinate Observed −log10(P) represents the logarithm of the measured expected value; Fig.16 This is a fresh weight Manhattan plot of Example 4 of the present invention when the whole genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1. The dotted line in the figure represents the screening threshold (−log10(P) = 5.03; Fig.17 This is a fresh weight QQ graph of Example 4 of the present invention when the whole genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1; wherein the horizontal axis expected−log10(P) represents the logarithm of the theoretical expected value, and the vertical axis Observed−log10(P) represents the logarithm of the measured expected value; Fig.18 This is a dry weight Manhattan plot of Example 4 of the present invention when the liquid phase chip prepared in Example 1 was used to perform genome-wide association analysis on 146 Porphyra yezoensis samples. The dotted line in the figure represents the screening threshold (−log10(P) = 5.03; Fig.19 This is a dry weight QQ plot of Example 4 of the present invention when whole genome association analysis was performed on 146 Porphyra yezoensis samples using the liquid phase chip prepared in Example 1; wherein the abscissa expected−log10(P) represents the logarithm of the theoretical expected value, and the ordinate Observed−log10(P) represents the logarithm of the measured expected value. DETAILED DESCRIPTION

[0163] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the embodiments and drawings. The schematic implementation mode of the present invention and its description are only used to explain the present invention and are not intended to limit the present invention. The embodiments described below are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0164] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is apparent to those of ordinary skill in the art that these specific details do not have to be employed to practice the present invention. In other embodiments, in order to avoid confusing the present invention, known structures, materials or methods are not specifically described. The materials, instruments and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources. The technical means used in the examples, unless otherwise specified, are conventional means well known to those skilled in the art.

[0165] Embodiment 1: Design and preparation of Porphyra yezoensis 10K liquid phase chip: S1. 90 DNA samples of Porphyra yezoensis were resequenced (individual sequencing depth was 10X) and merged to obtain 1,070,946 SNP sites, which are the original SNP sites.

[0166] The 90 strains of Porphyra yezoensis include 21 Lianyungang cultured strains (LX), 21 Rushan cultured strains (XX), 18 Yantai wild strains (YX), 17 Qingdao wild strains (ZX), and 13 Weihai wild strains (WX).

[0167] S2. Use the software BWA (-mem v0.7.17, parameter: -t10-MR) to compare and remove duplicates between the original SNP sites and the target reference genome (the Porphyra yezoensis reference genome GCA_009829735.1 (GCA_009829735.1_ASM982973v1_genomic.fna)) to ensure that the original SNP sites are consistent with the target reference genome, and obtain 1,070,946 SNP sites that are consistent with the target reference genome.

[0168] S3. Screen out functional SNP sites that can successfully design probes from the original SNP sites: The screening process includes site filtering and site evaluation in sequence: According to the conditions of minimum sequencing depth ≥5X, deletion rate <10%, MAF>0.35 and heterozygosity rate <10%, 89284 SNP sites were selected for evaluation and probe design, of which 63562 SNP sites were successfully evaluated. The principles of site evaluation include probe length of 110 bp, probe GC content of 30%-70% and number of homologous regions ≤5.

[0169] S4. From the screened functional SNP sites, 12942 SNP sites were screened according to the principle of uniform distribution of the genome, which are the target SNP sites; the 12942 SNP sites are shown in Table 1.

[0170] The SNP marker chromosome distribution statistics based on the above 12942 SNP loci are shown in the figure below: Figure 1 As shown; the SNP marker chromosome distribution map drawn based on the above 12942 SNP loci is shown as Figure 2 As shown; the Gap distribution map based on the above 12942 SNP sites is as follows Figure 3 As shown; the MAF distribution statistics based on the above 12942 SNP sites are shown in Figure 4 As shown; the SNP marker type statistics based on the above 12942 SNP loci are shown in Figure 5 As shown; the PCA population distribution diagram based on the above 12942 SNP loci is shown as Figure 6 As shown; the evolutionary tree based on the above 12942 SNP sites is as follows Figure 7 As shown; The polymorphism statistics based on the above 12942 SNP sites are shown in Figure 8 shown.

[0171] S5. Acquisition of nucleotide probe combination: GenoBaits Probe Designer software was used to design probes based on the evaluation results of the upstream and downstream sequences of the target site. The probes were designed with reference to the above-mentioned principles of site evaluation. The probe length was 110 bp, and the 5' end had a DNA nucleotide sequence modified with a biotin group.

[0172] The probe combination obtained above was adjusted with the 12942 SNP sites in Table 1, and finally a nucleotide probe combination capable of capturing 12942 SNP sites was obtained.

[0173] Since the probe is determined based on the SNP site and the principle of DNA complementarity, a person skilled in the art can determine the corresponding probe sequence when knowing the SNP site, and will not list them one by one here. For example, there are two probe sequences corresponding to CM020618.1_1114274, which are shown in SEQ ID NO.1: TCCCCGCCGCTGCCGAGGCGGTCCTGGCAGCAGACCTGACCGACGTGTGTGTGCGTTGGGGGCTGTTGTCGTCGTGTGACGAGAGAAGGGGGGGGGGAGGGGGAGATGGG; and CAGCAGACCTGACCGACGTGTGTGTGCGTTGGGGGCTGTTGTCGTCGTGTGACGAGAGAAGGGGGGGGGGAGGGGGAGATGGG; shown in SEQ ID NO.2: CAGCAGACCTGACCGACGTGTGTGTGCGTTGGGGGCTGTTGTCGTCGTGTGACGAGAGAAGGGGGGGGGGAGGGGGAGATGGGGCGCTCTGGGCGTTTTGGTGGAGTGCG.

[0174] The evaluation results of this embodiment are shown in Table 2: Table 2

[0175] Remark: 1. This evaluation result is the result of probe design. It does not mean that the target site can be captured as long as the probe is designed. 2. Probe design segment coverage = number of designed probe target segments / number of target segments. 3. If the probe type is chip synthesis probe, the total number of probe designs will not be displayed.

[0176] Liquid phase chip is based on the principle of DNA complementarity. Probes covering the target SNP are designed at each site to be tested, and the target probes are modified by biotin labeling. Then, the biotin-modified probes are hybridized with the target region of the genome in the liquid to form a double strand. Subsequently, the biotin-modified probes are molecularly adsorbed by streptavidin-coated magnetic beads to capture the target hybridized with the probe. Finally, the captured target sequence is eluted, amplified and sequenced to finally obtain the genotype of the target SNP.

[0177] Finally, the Porphyra yezoensis 10K liquid phase chip prepared in this embodiment includes a set of nucleotide probes for detecting 12942 SNP sites, and the physical positions of the 12942 SNP sites are determined based on the whole genome sequence alignment of the Porphyra yezoensis reference genome, and the version number of the whole genome sequence of the Porphyra yezoensis reference genome is GCA_009829735.1; among them, the 12942 SNP sites are shown in Table 1 of the specification.

[0178] The Porphyra yezoensis 10K liquid phase chip prepared in this example was used to detect 12 samples, and the test results are shown in Table 3: Table 3

[0179] Among the 12 test samples in Table 3, the detection rates were between 98.25% and 99.01%, and the average detection rate was 98.62%, indicating that the detection accuracy of the Porphyra yezoensis 10K liquid phase chip was high.

[0180] Embodiment 2: The method for obtaining genotype data of Porphyra yezoensis using the Porphyra yezoensis 10K liquid phase chip prepared in Example 1 comprises the following steps: Step 1: Genomic DNA extraction The thallus of Porphyra yezoensis was selected, and nucleic acid was extracted using a plant genomic DNA extraction kit produced by Shijiazhuang Boridi Biotechnology Co., Ltd., and the concentration of the extracted DNA was accurately quantified using Qubit.

[0181] Step 2: DNA fragmentation and end repair PCR amplification system: 300 ng DNA; 2.6 μL end repair enzyme, 4 μL buffer; add nuclease-free water to make up the system to 20 μL.

[0182] PCR amplification program: 37℃ 20min; 72℃ 20min.

[0183] Step 3, introducing a linker connection system into the system of step 2 by PCR; PCR system: 4 μL adapter; 2 μL ligase; 8 μL buffer; add nuclease-free water to 20 μL.

[0184] PCR amplification program: 22°C 60min.

[0185] Step 4, purifying the ligation system product; 4.1 Add magnetic beads to the PCR product and shake evenly; 4.2 After standing at room temperature for 5 minutes, briefly centrifuge; 4.3 Place the PCR tube on a magnetic rack until the solution becomes clear; 4.4 Carefully remove the supernatant, making sure not to aspirate the magnetic beads.

[0186] 4.5 Keep the PCR tube / plate in the magnetic rack, add 100 μL 80% ethanol, and let it stand at room temperature for 30 seconds; 4.6 Remove the supernatant and keep the PCR tube / plate in the magnetic rack at room temperature until the ethanol is completely evaporated.

[0187] Step 5: Perform PCR amplification using the extracted Porphyra yezoensis genomic DNA as a template to obtain a DNA library.

[0188] PCR amplification system: add 10 μL of the mixture of PCR enzyme and buffer to the product of step 4; 2 μL of sequencing barcode; and add nuclease-free water to make up the system to 20 μL.

[0189] PCR amplification program: 98°C 2 min 1 cycle; (98°C 30 s, 65°C 30 s, 72°C 40 s) 5 cycles; 72°C 4 min 1 cycle.

[0190] Step 6: Purify the obtained DNA library.

[0191] 6.1 Add 20 μl GenoPrep DNA Clean Beads to the product obtained in step 6 and vortex to mix. Avoid creating bubbles during the vortex. 6.2 After standing for 5 minutes, briefly centrifuge; 6.3 Place the PCR tube / plate on a magnetic rack until the solution is clear, which is expected to be at room temperature for at least 3 minutes; 6.4 Remove the supernatant, making sure not to aspirate the magnetic beads.

[0192] 6.5 Keep the PCR tube / plate in the magnetic rack, add 100 μL 80% ethanol and place at room temperature for 30 seconds.

[0193] 6.6 Remove the supernatant and keep the PCR tube / plate in the magnetic rack at room temperature until the ethanol evaporates.

[0194] 6.7 Take the PCR tube or plate out of the magnetic rack, add 35 μL Eultion Buffer, shake and mix, let stand for 5 minutes, and briefly centrifuge. 6.8 Place the PCR tube on a magnetic rack until the solution becomes clear; 6.9 Transfer the supernatant to a new 0.2 ml low-binding PCR tube / plate.

[0195] Step 7: The purified DNA libraries were mixed in equal amounts.

[0196] Step 8: The mixed library is concentrated and added to the hybridization system, and hybridization capture is performed using the prepared probe; PCR amplification system: 1.5-2.5 μg of mixed library; 300 ng of probe; add nuclease-free water to make up the system to 16 μl.

[0197] PCR amplification program: 95℃ 10min (hot cover temperature 105℃); 65℃ 2-4h (hot cover temperature 75℃).

[0198] Step 9: Elute to remove unbound DNA 9.1 Step 9 After hybridization is completed, open the lid of the PCR instrument, open the lid of the PCR tube, and transfer 16 μL of hybridization capture solution to the prepared magnetic beads.

[0199] 9.2 Vortex for 10 seconds to mix thoroughly and centrifuge immediately.

[0200] 9.3 Place the PCR tube in the PCR instrument, incubate at 65°C for 45 min, with the heated cover at 75°C.

[0201] 9.4 Every 12 minutes, oscillate for 5 seconds and centrifuge immediately.

[0202] 9.5 Add 100 μL of elution buffer preheated at 65℃ to each PCR tube.

[0203] 9.6 Vortex briefly for 5 seconds and centrifuge for 5 seconds.

[0204] 9.7 Place the PCR tube on the magnetic rack until the magnetic beads are completely separated from the solution.

[0205] 9.8 Remove the supernatant with a pipette, retain the magnetic beads, and place the PCR tube in a PCR machine at 65°C.

[0206] 9.9 Add 150 μL of GenoBaits 1X Stringent Wash Buffer preheated at 65℃, and slowly pipette up and down 10 times to mix the beads thoroughly. After the last set of samples is mixed, place them on the PCR instrument for 2 minutes.

[0207] 9.10 Place the PCR tube on the magnetic rack until the magnetic beads are completely separated from the solution, and quickly remove the supernatant with a pipette.

[0208] 9.11 Remove the PCR tube from the magnetic stand, add 150 μL of room temperature elution buffer I, and shake for 2 minutes.

[0209] 9.12 Place the PCR tube on a magnetic stand until the magnetic beads are completely separated from the solution. Remove the supernatant with a pipette.

[0210] 9.13 Remove the PCR tube from the magnetic stand, add 150 μL of room temperature elution buffer II, and shake for 1 min.

[0211] 9.14 Place the PCR tube on a magnetic stand until the magnetic beads are completely separated from the solution. Remove the supernatant with a pipette.

[0212] 9.15 Add 150 μL of room temperature elution buffer III and shake for 30 seconds.

[0213] 9.16 Place the PCR tube on a magnetic stand until the magnetic beads are completely separated from the solution. Remove the supernatant with a pipette.

[0214] 9.17 Remove the tube containing the captured DNA beads from the magnetic rack and add 20 μL of nuclease-free water. Use a pipette to slowly pipette 10 times to ensure that all the beads are resuspended.

[0215] Step 10: Enrich the library.

[0216] PCR system: DNA enriched on magnetic beads in step 9; 15 μL of enzyme mixture; 1.2 μL of primers; and nuclease-free water to make up the system to 30 μL.

[0217] PCR amplification program: 1 cycle at 98°C for 45 s; 13 cycles of (98°C for 15 s, 60°C for 30 s, 72°C for 30 s); 72°C for 1 min.

[0218] Step 11: Purify the enriched product to complete the preparation of the sequencing library 11.1 Place the PCR tube on a magnetic rack until the solution becomes clear; 11.2 Transfer the supernatant to a new PCR tube; 11.3 Add 45 μl of magnetic beads to each reaction and vortex to mix.

[0219] 11.4 After standing at room temperature for 5 minutes, briefly centrifuge; 11.5 Place the PCR tube on a magnetic rack until the solution becomes clear; 11.6 Remove the supernatant with a pipette; 11.7 Keep the PCR tube on the magnetic rack and add 100 μL 80% ethanol. Incubate at room temperature for 30 seconds; 11.8 Remove the supernatant with a pipette; 11.9 Keep the PCR tube on the magnetic rack at room temperature until the ethanol evaporates; 11.10 Move the PCR tube from the magnetic rack to room temperature, add 35 μL of elution buffer, shake and mix. After standing at room temperature for 5 minutes, centrifuge briefly.

[0220] 11.11 Place the PCR tube on a magnetic rack until the solution becomes clear; 11.12 Transfer the supernatant to a new 0.2 mL low-adsorption tube, making sure not to absorb the magnetic beads. The purified DNA library can be stored at -20°C until sequencing is required.

[0221] Step 12: Equal amounts of the sequencing libraries were mixed and high-throughput sequencing was performed using a BGI T7 sequencer; Step 13, split the original sequencing bases according to the barcodes of different materials, filter the low-quality sequencing data, align them with the Porphyra yezoensis reference genome, and perform variation mining; Step 14: Obtain the corresponding genotype based on the obtained SNP information.

[0222] Embodiment 3: Application of the Porphyra yezoensis 10K liquid phase chip prepared in Example 1 in the analysis of the Porphyra yezoensis population structure: Population structure analysis is a method used to study the genetic structure of a population and the genetic relationship between individuals. It divides individuals into different subgroups or populations by analyzing genotype data, and evaluates the genetic similarities and genetic differences between individuals. Common population structure analysis methods include: (1) Cluster Analysis: Through clustering algorithms, individuals are divided into different groups or subgroups to evaluate the genetic differences and population structure between individuals; (2) Principal Component Analysis (PCA): By reducing the dimensionality of high-dimensional genotype data into low-dimensional principal components, revealing the genetic similarities and population structure between individuals; (3) Structure analysis: Based on the Bayesian statistical model, through model selection and parameter estimation, individuals are divided into different subgroups or populations, and the probability distribution of individuals in each subgroup is estimated.

[0223] The genotype data of 146 Porphyra yezoensis samples were obtained using the Porphyra yezoensis 10K liquid phase chip prepared in Example 1. The 146 samples included 81 wild strains from Yantai, corresponding to the YT population, and 65 wild strains from Weihai, corresponding to the WH population.

[0224] Based on the characteristic vectors of the genotypes of the above 146 Porphyra yezoensis samples, this example selected the principal components PC1 and PC2 for mapping, as shown in FIG. Fig. 9 As shown in the figure, the variance contribution of these two principal components to the genetic structure is 18.44% and 9.57% respectively, and the cumulative variance contribution is 28.01%. The sequencing population can be divided into three subgroups, and the subgrouping is not strictly divided according to geographical regions. This may be because the collection sites are relatively close, and migration in and out leads to gene exchange between different groups.

[0225] like Fig.10 As shown, through cluster analysis, individuals from different regions were labeled, and the phylogenetic tree diagram showed that there were obvious genetic differences between different geographical groups, and the clustering effect was consistent with the results of PCA analysis; Fig.10 The numbers beginning with Y correspond to the YT group; the numbers beginning with W correspond to the WH group.

[0226] like Fig.11 As shown in the figure, the population structure analysis was performed using Admixture software, and a line graph of CV value changes and a population structure graph were drawn under different K values, with the K value ranging from 1 to 10. When the cross-validation error rate (CV) was the smallest, the corresponding K value was 4, which meant that the 146 Porphyra yezoensis samples were most suitable for being divided into 4 subpopulations.

[0227] In summary, the Porphyra yezoensis 10K liquid phase chip prepared in Example 1 can be used to perform population structure analysis on the above 146 Porphyra yezoensis samples; the two geographical groups WH and YT can be roughly divided into two large groups, but there is a gene exchange phenomenon between the YT group and the WH group, thus presenting 4 subgroups.

[0228] Embodiment 4: Application of the Porphyra yezoensis 10K liquid phase chip prepared in Example 1 in Porphyra yezoensis genome-wide association analysis: Kinship and population stratification are important factors that lead to false positive results in whole-genome association analysis. A mixed linear model can be used to reduce the impact of these two factors. The model is as follows: y = = SNP+ PCs + Kinship + e where y is the observed value of the phenotypic trait, SNP represents the genotype matrix of the population, PCs represents the fixed effect caused by population stratification, Kinship represents the random effect caused by kinship, and e represents the random error.

[0229] The genotype data of the 146 Porphyra yezoensis samples were obtained using the Porphyra yezoensis 10K liquid phase chip prepared in Example 1. Based on the filled genotyping data, the kinship matrix was calculated using the GEMMA software, and the first 30 principal components and the kinship matrix in the PCA analysis were introduced as covariates into the mixed linear model (y = = SNP + PCs + Kinship + e), and the four traits of leaf length, leaf width, dry weight and fresh weight of Porphyra yezoensis were subjected to genome-wide association analysis.

[0230] The Manhattan plot and QQ plot were drawn using the CMplot package in R software. The Manhattan plot was used to display the marker sites on the genome that were significantly associated with the trait, and the QQ plot was used to determine whether the false positive sites in the association analysis were well controlled. According to the principle of Bonferroni correction, the threshold was set to 1 / the number of SNP markers, and according to the formula of Shim et al.: ; The phenotypic variance explained (PVE) of each SNP locus was calculated. Finally, SNPs significantly associated with leaf length, leaf width, fresh weight and dry weight were screened according to the P value and the set threshold. With reference to the annotation information of the Porphyra yezoensis genome, genes within the 20 KB region upstream and downstream of the significant SNP locus were selected as candidate genes.

[0231] Based on the analysis results of population structure and kinship, this example conducted a genome-wide association analysis on leaf length, leaf width, fresh weight and dry weight of Porphyra yezoensis. Figure 12-19 As shown in the figure, the Manhattan plot shows the degree of association between each SNP and the trait, and the dashed line in the figure corresponds to the significance threshold; according to the QQ plot, it can be observed that the distribution of the scattered points is basically consistent with the diagonal line, and only deviates at the end, which indicates that the false positive results of the association analysis have been corrected.

[0232] In this example, -log10(P)>5.03 was used as the threshold of significant association, and 17, 32 and 1 loci were screened out that were significantly associated with leaf length, leaf width and fresh weight, respectively. In addition, 1 locus was screened out that was significantly associated with dry weight, and the phenotypic explanation rates of the loci were 14.4%~21.2%, 14.4%~20.0%, 14.9% and 14.6%, respectively. Among them, 1 SNP (Chr3:10908946) was detected in both leaf width and fresh weight, and a total of 49 SNPs were removed after repeated SNPs were removed, as shown in Table 4. According to the distribution of significant association loci, SNPs are distributed on three chromosomes, indicating that the growth of Porphyra yezoensis is controlled by multiple genes. Finally, the genes within 20 KB upstream and downstream of the 49 SNP sites were screened, and a total of 103 candidate genes were obtained, as shown in Table 5, among which the candidate gene I4F81_005486 located on chromosome CM020619.1 was associated with both leaf length and dry weight.

[0233] Table 4 SNP loci significantly associated with leaf length, leaf width, fresh weight and dry weight traits (Chip)

[0234]

[0235]

[0236] Table 5 Candidate genes associated with leaf length, leaf width, fresh weight and dry weight traits (Chip)

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Porphyra yezoensis 10K liquid phase chip, characterized in that: The genotyping sites of the Porphyra yezoensis 10K liquid phase chip include 12942 SNP sites; the physical positions of the 12942 SNP sites are determined based on the whole genome sequence alignment of the Porphyra yezoensis reference genome, and the version number of the whole genome sequence of the Porphyra yezoensis reference genome is GCA_009829735.1; wherein the 12942 SNP sites are shown in Table 1: Table 1 ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； 。 2. The Porphyra yezoensis 10K liquid phase chip according to claim 1, characterized in that: It also includes probes designed based on the gene sequence covering 12,942 SNP sites.

3. The method for designing a Porphyra yezoensis 10K liquid phase chip according to claim 1 or 2, characterized in that: The steps include: S1. Obtain the original SNP site; S2, comparing the original SNP site with the target reference genome to ensure that the original SNP site is consistent with the target reference genome; S3, screening out functional SNP sites for which probes can be successfully designed from the original SNP sites; S4. From the functional SNP sites screened out, 12942 SNP sites were screened out according to the principle of uniform distribution of the genome, which were the target SNP sites.

4. The design method according to claim 3, characterized in that: In step S3, the screening process includes site filtering and site evaluation.

5. The design method according to claim 4, characterized in that: The conditions for site filtering include minimum sequencing depth ≥5X, deletion rate <10%, MAF>0.35 and heterozygosity rate <10%.

6. The design method according to claim 4, characterized in that: The principles of site evaluation include probe length of 110 bp, probe GC content of 30%-70%, and the number of homologous regions ≤5.

7. The design method according to claim 3, characterized in that: In step S3, when screening the functional SNP sites, the probe design segment coverage is required to be greater than or equal to 70%.

8. Use of the Porphyra yezoensis 10K liquid phase chip as claimed in claim 1 or 2 in the analysis of the population structure of Porphyra yezoensis.

9. Use of the Porphyra yezoensis 10K liquid phase chip as claimed in claim 1 or 2 in genome-wide association analysis of Porphyra yezoensis.

10. Use of the Porphyra yezoensis 10K liquid phase chip according to claim 1 or 2 in Porphyra yezoensis breeding.

Images