Enrichment method and kit

Abstract

A mixture of aggregated magnetic beads and non-aggregated magnetic beads is generated from i) functionalization with a first primer of the primer set and ii) magnetic beads contained in the suspension. Each aggregated bead includes a first amplicon attached to a first primer and a 5 '-labeled second amplicon that hybridizes to the first amplicon. The 5 '-tag of the second amplicon is a binding pair first member. Coated non-magnetic beads (including bonded to a second member coating, and having a diameter that is at least ten times that of each magnetic bead) are introduced into the suspension. The aggregated magnetic beads are bonded to at least some of the coated non-magnetic beads to form a bead-on-bead composite. The non-aggregated magnetic beads remain free in the suspension and are separated from the suspension. The 5 '-labeled second amplicon is de-hybridized from the first amplicon to produce single-stranded aggregated magnetic beads, which are then separated from the suspension.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 489,346, filed on March 9, 2023, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] The sequence listing submitted herewith is hereby incorporated by reference in its entirety. The file name is ILI259BPCT_IP-2561-PCT_Sequence_Listing.xml, the file size is 7,223 bytes, and the file creation date is February 29, 2024. Background Art

[0005] Various protocols in biological or chemical research involve conducting a large number of controlled reactions on a local support surface or within a predefined reaction chamber. The specified reactions can then be observed or detected, and subsequent analysis can help identify or reveal the properties of the chemicals involved in the reactions. In some examples, the controlled reactions change the charge, conductivity, or some other electrical property, so electronic systems can be used for detection. In other examples, the controlled reactions produce fluorescence, so optical systems can be used for detection. Summary of the invention

[0006] Disclosed herein is a method for enriching a population of aggregated beads in a suspension before they are captured on the surface of a circulation cell. The method enables library template inoculation to be carried out in a suspension at a sub-Poisson's ratio, which results in monoclonal aggregated beads while mitigating yield losses that would otherwise occur at such a low inoculation ratio. In order to mitigate the loss of yield, the method utilizes labeled primers to induce aggregation. As a result, labeled beads are aggregated, while unlabeled beads remain non-aggregated. The label is specifically selected as a member of a binding pair. Another member of the binding pair is coated on another non-magnetic bead, which is introduced into the suspension after aggregation. The label enables the aggregated beads to be separated from the non-aggregated beads. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly not identical parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0008] Figures 1A to 1E An example of the enrichment method disclosed herein is schematically depicted together, wherein Figure 1A shows the formation of a mixture of aggregated magnetic beads and non-aggregated magnetic beads in a magnetic bead suspension, Figure 1B The formation of bead-on-bead complexes using aggregated magnetic beads in suspension is shown. Figure 1C shows the separation of non-aggregated magnetic beads from a suspension containing bead-on-bead complexes, Figure 1D shows the formation of single-stranded aggregated magnetic beads in suspension, and Figure 1E The separation of single-stranded aggregated magnetic beads from a suspension is shown;

[0009] Figure 2 is a schematic flow diagram depicting an example of aggregation that occurs during the enrichment methods disclosed herein;

[0010] Figure 3 is a top view of an example flow cell;

[0011] Figure 4A is along Figure 3 4A-4A, depicting an example of a flow cell architecture including single-stranded aggregated magnetic beads anchored to a lane;

[0012] Figure 4B is along Figure 3 4B-4B, depicting another example of a flow cell architecture including single-stranded aggregated magnetic beads anchored to a column;

[0013] Figure 4C is along Figure 3 An enlarged cross-sectional view taken along line 4C-4C of , depicting yet another example of a flow cell architecture including single-stranded aggregated magnetic beads anchored in a recess;

[0014] Figure 4D is a device that describes the integration of complementary metal oxide semiconductor (CMOS) devices. Figure 4C An enlarged cross-sectional view of the flow cell architecture;

[0015] Figure 5 is a bar graph depicting the number of DNA chains per magnetic bead (Y-axis) at different aggregation times (hours, X-axis);

[0016] Figure 6 is a scanning electron microscope (SEM) image of a bead-on-bead complex generated during an example of an enrichment method disclosed herein; and

[0017] Figure 7 is a bar graph depicting the amount of DNA strands per quantitative polymerase chain reaction vial (Y-axis) for a control sample and two example samples (X-axis). DETAILED DESCRIPTION

[0018] The method disclosed herein generates an enriched population of aggregated beads before introducing the aggregated beads into a flow cell for capture and analysis. As will be described in more detail herein, this method increases i) monoclonality (i.e., the case where a single library template is seeded and amplified across a single bead), and ii) the overall yield of single-stranded aggregated beads captured on the flow cell surface. Both of these cases improve sequencing metrics.

[0019] Also disclosed herein is a flow cell for use with an enriched population of aggregated beads.The flow cell substrate includes capture sites that can anchor the aggregated beads at predetermined locations along the substrate.

[0020] definition

[0021] It should be understood that, unless otherwise indicated, the terms used herein are to be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0022] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0023] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0024] The terms top, bottom, lower, upper, and above are used herein to describe the various components of the flow cell and / or the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation.

[0025] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0026] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor variations (up to + / - 10%) from the specified value.

[0027] As used herein, the terms "anchored" and "connected" refer to the state in which two things are directly or indirectly joined, fastened, adhered, connected or bound to each other. For example, the primer can be connected to the polymer hydrogel by covalent bonds or non-covalent bonds. The characteristic of a covalent bond is that electron pairs are shared between atoms. Non-covalent bonds are physical bonds that do not involve shared electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions. Other examples of attachment include magnetic attachment.

[0028] A "binding pair" refers to two reagents (e.g., materials, molecules, moieties) that have a strong affinity for each other and can be reversibly attached to each other. In an example binding pair, the first member and the second member include a NiNTA (nickel-nitrilotriacetic acid) ligand and a histidine tag, or streptavidin or avidin and biotin, complementary DNA strands that can hybridize to each other, functional groups that can form disulfide bonds, functional groups that can form imines, etc. Any binding pair whose binding affinity can be reversed / released, for example, via external stimuli (such as pH, light and / or temperature) can be used in the examples listed herein.

[0029] As used herein, "capture site" refers to a portion of a flow cell substrate that has been magnetically modified to allow anchoring of single-stranded aggregated magnetic beads. In the examples listed herein, a capture site can include a magnetic capture agent, a chemical capture agent, and / or an electrostatic capture agent.

[0030] "Chemical capture agent" is a material, molecule or part of a functional agent that can be anchored to a single-stranded aggregated bead via a chemical mechanism. An example chemical capture agent includes a capture nucleic acid (e.g., a capture oligonucleotide) complementary to at least a portion of a target nucleic acid attached to a single-stranded aggregated bead. Another example chemical capture agent includes a member of a binding pair that can be bound to a second member of a binding pair attached to a single-stranded aggregated bead. Another example of a chemical capture agent is a chemical reagent that can form a hydrogen bond or a covalent bond with a single-stranded aggregated bead. Covalent bonds can be formed, for example, by thiol-disulfide exchange, click chemistry, Diels-Alder, Michael addition, amine-aldehyde coupling, amine-acyl chloride reaction, amine-carboxylic acid reaction, nucleophilic substitution reaction, etc. Some chemical capture agents can be light-triggered, i.e., activated to chemically bind to a functional agent of an aggregated bead when exposed to light.

[0031] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Generally speaking, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0032] As used herein, the term "recess" refers to a discrete concave feature in a substrate having a surface opening at least partially surrounded by a void region of the substrate. A recess may have any of a variety of shapes at its opening in the surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of a recess taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0033] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0034] As used herein, the term "electrostatic trapping agent" refers to a charged material capable of electrostatically anchoring charged or reversibly charged single-stranded aggregated beads. The amplicon of the aggregated beads is negatively charged. Therefore, positively charged pads (e.g., made of silane, polymers with azide functional groups, polylysine, polyimines (e.g., polyethyleneimine, polypropyleneimine, etc.)) and other positively charged materials can be used as electrostatic trapping agents. Another example of an electrostatic trapping agent is an electrode that can attract reversibly charged functional groups incorporated into aggregated beads when an appropriate voltage is applied. As an example, an amine or carboxylic acid can be reversibly switched between neutral and charged substances in response to pH changes, and the charged substance can be attracted to the electrode. The amine or carboxylic acid can be a functional group of polyacrylamide, poly (acrylic acid) copolymer, etc. coated on a magnetic core.

[0035] As used herein, the term "flow cell" is intended to mean a container having a reaction area in which a reaction can be performed, an inlet for delivering reagents to a flow channel in fluid communication with the reaction area, and an outlet for removing reagents from the flow channel. In some examples, the flow cell enables detection of reactions occurring in the reaction area. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc. within the flow channel.

[0036] As used herein, a "flow channel" or "channel" can be i) a closed area defined between two bonded components or ii) an open area defined in a single component, either of which can selectively receive a liquid sample. In some examples, the flow channel can be closed and defined between a substrate and a cover, and can therefore be in fluid communication with a capture site positioned on the substrate. In other examples, the flow channel can be closed and defined between two substrate surfaces bonded together. In other examples, the flow channel can be open to the surrounding environment.

[0037] "Functional agent" is a material, molecule or part of a single-stranded aggregated bead that can be anchored to a chemical capture site of a circulation pool via a chemical mechanism. An example of a functional agent includes a target nucleic acid that is complementary to a capture nucleic acid (e.g., a capture oligonucleotide) on a circulation pool. Another example functional agent includes a member of a binding pair that can bind to a second member of a binding pair connected to a circulation pool.

[0038] "Functionalized magnetic beads" include a magnetic particle core, a polymer hydrogel attached to the magnetic particle core, and a plurality of one type of primers attached to the side chains or arms of the polymer hydrogel. In some cases, the functionalized magnetic beads include an attachment mechanism to attach to a flow cell capture site.

[0039] As used herein, the term "void region" refers to, for example, an area of ​​a substrate that separates capture sites. For example, a void region can separate one capture site of an array from another capture site of the array. Two capture sites separated from each other can be discrete, i.e., lack physical contact with each other. In some examples, the void region is continuous, while the capture sites are discrete, for example, as in the case of a plurality of recesses defined in an otherwise continuous surface, each of the recesses comprising a capture site. The void region may have a surface material different from that of the capture site. For example, the capture site comprises a capture agent, and the void region may be free of a capture agent.

[0040] As used herein, the term "magnetic capture agent" refers to a magnetic material that is capable of magnetically anchoring single-stranded aggregated magnetic beads. Example magnetic capture agents include ferromagnetic materials and ferrimagnetic materials.

[0041] As used herein, the term "mechanism" refers to a functional agent, a magnetic material, or a reversibly charged functional group that is incorporated into the single-stranded aggregate-like beads to enable the single-stranded aggregate-like beads to be anchored to a capture site in a flow cell.

[0042] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is a monomeric unit of a nucleic acid sequence. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position of ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) may be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0043] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers referred to herein as amplification primers are used as the starting point for template amplification and cluster generation. Other primers referred to herein as sequencing primers are used as the starting point for DNA synthesis. The 5' end of each primer in the primer set can be modified to allow coupling reaction with the functional group of the polymer chain. The primer length can be any number of base lengths and can include a variety of non-natural nucleotides. In one example, the sequencing primer is a short chain ranging from 10 to 60 bases, or 20 to 40 bases.

[0044] The term "primer set" refers to a pair of primers that can amplify a template nucleic acid chain (also referred to herein as a library template) together. The opposite end of the template chain includes an adapter that hybridizes with the corresponding primer in the set. In the example method listed herein, one primer is attached to a magnetic bead, and another primer is introduced into a suspension of magnetic beads to trigger amplification and aggregation.

[0045] "Single-stranded aggregate beads" are core materials functionalized with amplicons of a single library template that are attached to the core via one of the primers in the primer set used to generate the amplicon.

[0046] The term "substrate" refers to a structure to which various components (e.g., capture sites) of a flow cell can be added. The substrate can be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The substrate is generally rigid and insoluble in aqueous liquids. For example, the substrate can be inert to chemicals used to capture single-stranded aggregated magnetic beads, for sequencing reactions, etc. The substrate can be a single-layer structure or a multilayer structure (e.g., including a support and a patterned resin on the support). Examples of suitable substrates will be further described herein.

[0047] The term "transparent" refers to a material that is capable of transmitting a specific wavelength or range of wavelengths, for example, in the form of a layer. For example, the material can be transparent to the wavelength used for sequencing operations. Transparency can be quantified using transmittance, that is, the ratio of light energy falling on a body to the light energy transmitted through the body. The transmittance of a transparent layer will depend on the thickness of the layer, the wavelength of the light, and the dose of light to which it is exposed. In the examples disclosed herein, the transmittance of a transparent metal layer can be in the range of 0.1 (10%) to 1 (100%). The material of the transparent metal layer can be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting layer is capable of having the desired transmittance.

[0048] Enrichment methods

[0049] exist Figures 1A to 1E An example of the enrichment method disclosed herein is schematically shown in FIG. Figure 2 Examples of amplification techniques used in the enrichment method are schematically shown. All figures in these figures will be referenced throughout the description of the enrichment method.

[0050] The enrichment method generally comprises generating a mixture of aggregated magnetic beads 12 and non-aggregated magnetic beads 14 from a plurality of magnetic beads 16, the plurality of magnetic beads i) being functionalized with a first primer 18 of a primer set and ii) being contained in a suspension 20, each of the aggregated magnetic beads 12 comprising a first amplicon 22 attached to the first primer 18 and a 5'-labeled second amplicon 24 hybridized to the first amplicon 22, wherein the 5'-labeled second amplicon 24 has a 5'-label 40 that is a first member of a binding pair (see Figure 1A and Figure 2 ); introducing a plurality of coated non-magnetic beads 26 into the suspension 20, each of the plurality of coated non-magnetic beads 26 comprising a coating 28 of a second member of a binding pair and having a diameter at least ten times that of each of the plurality of magnetic beads 16, whereby the aggregated magnetic beads 12 are bound to at least some of the coated non-magnetic beads 26 to form a bead-on-bead complex 30, and the non-aggregated magnetic beads 14 remain free in the suspension 20 ( Figure 1B ); separating the non-aggregated magnetic beads 14 from the suspension 20 containing the bead-on-bead complex 30 ( Figure 1C ); Dehybridization of the 5'-labeled second amplicon 24 from the first amplicon 22, thereby generating a single-stranded aggregated magnetic bead 10 ( Figure 1D ); and separating the single-stranded aggregated magnetic beads 10 from the suspension 20 ( Figure 1E ).

[0051] At the beginning of the enrichment process, a plurality of magnetic beads 16 functionalized with a first primer 18 of a primer set are introduced into a carrier fluid to generate a suspension 20. The magnetic beads 16 are Figure 2 'A' is shown in the figure and will now be described.

[0052] Since the magnetic beads 16 are functionalized with the first primers 18 , they are referred to herein as “functionalized magnetic beads.” The functionalized magnetic beads 16 include a magnetic core 32 and a plurality of first primers 18 attached to the magnetic core 32 . Figure 2 An example is depicted in .

[0053] The magnetic core 32 may be made of any suitable magnetic material, such as nickel, iron, cobalt, ferrite, magnetite, hematite, or other ferromagnetic materials (e.g., particles of Fe3O4 nanocomposite materials dispersed in polystyrene). In one example, the magnetic core 32 is made of Fe in a ratio of about 0.5:1 to about 4:1. 2+ :Fe 3+ Ratio contains Fe 2+ and Fe 3+ The magnetic core 32 is selected so as not to non-specifically bind to the sequencing reagent or the non-magnetic core 42.

[0054] In one example, the magnetic core 32 is a spherical nanoparticle. In another example, the magnetic core 32 is a non-spherical nanoparticle, such as a cube, a triangular prism, a rod, a thin sheet, a tube, etc. In yet another example, the magnetic core 32 is an irregularly shaped nanoparticle. The magnetic core 32 can also be a solid structure or a hollow structure.

[0055] The size of the magnetic core 32 may vary depending on its shape. In the examples disclosed herein, the maximum dimension (e.g., diameter, length, median, etc.) of the magnetic core 32 is on the nanometer scale, and therefore in the range of about 1 nm to less than 1000 nm. In some examples, the magnetic core 32 is a nanoparticle having a diameter greater than or equal to 1 nm, 2 nm, 3 nm, 4 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, or greater than or equal to 100 nm. In one example, the magnetic core 32 is about 250 nm.

[0056] When the flow cell capture sites are made of magnetic capture agents, the magnetic material of the core 32 can be used as a mechanism for attachment to the flow cell capture sites.

[0057] The magnetic core 32 is functionalized with the first primer 18 of the primer set. As will be described in more detail below, after the library template 36 is seeded to initiate strand invasion amplification, the second primer 34 of the primer set is introduced.

[0058] Examples of suitable primers 18, 34 include P5 primers and P7 primers or any combination of PA primers, PB primers, PC primers, and PD primers listed herein. For example, the primer set may include any two PA primers, PB primers, PC primers, and PD primers, or any combination of a PA primer and a PB primer, PC primer, or PD primer, or any combination of a PB primer and a PC primer or PD primer, or any combination of a PC primer and a PD primer. Examples of P5 primers and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example, in HiSeq TM 、HiSeqX TM 、MiSeq TM 、MiSeqDX TM 、MiNISeq TM 、NextSeq TM 、NextSeqDX TM 、NovaSeq TM 、iSEQ TM 、Genome Analyzer TM Each of these primers 18, 34 has a universal sequence for seeding and / or amplification purposes.

[0059] The P5 primers are:

[0060] P5:5'→3'

[0061] AATGATACGGCGACCACCGAGACTACAC(SEQ.ID.NO.1)

[0062] The P7 primers are:

[0063] P7#1: 5' → 3'

[0064] CAAGCAGAAGACGGCATACGAAT(SEQ.ID.NO.2)

[0065] The above other primers (PA-PD) include:

[0066] PA 5'→3'

[0067] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.3)

[0068] PB 5'→3'

[0069] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.4)

[0070] PC 5'→3'

[0071] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.5)

[0072] PD 5'→3'

[0073] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC(SEQ.ID.NO.6)

[0074] A truncated version of any primer sequence in the primer sequence may be used, which includes 10 nucleotides to 20 nucleotides of a given sequence. The truncated version may be shortened at the 3' end or the 5' end, or shortened at both the 3' end and the 5' end. An example of a truncated version of P5 is:

[0075] Truncated P5: 5'→3'

[0076] TACGGCGACCACC (SEQ.ID.NO.7)

[0077] Each of the primers 18 and 34 disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes 2 T bases to 20 T bases. As a specific example, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases.

[0078] The end at the 5' end of the first primer 18 can be a linker that can be attached to the surface functional groups of the polymer hydrogel 38 coated on the magnetic core 32 or the surface functional groups of the magnetic core 32. In either case, the linker can be capable of single-point covalent attachment. The attachment will depend in part on the functional groups of the hydrogel 38 or the magnetic core 32. Examples of usable end-capped primers include alkyne-terminated primers, tetrazine-terminated primers, azido-terminated primers, amino-terminated primers, epoxy- or glycidyl-terminated primers, thiophosphate-terminated primers, thiol-terminated primers, aldehyde-terminated primers, hydrazine-terminated primers, phosphoramidite-terminated primers, and triazolinedione-terminated primers. In some specific examples, a succinimide (NHS) ester-terminated primer can react with an amine of the hydrogel 38 or the magnetic core 32, an aldehyde-terminated primer can react with a hydrazine of the hydrogel 38 or the magnetic core 32, or an alkyne-terminated primer can react with an azide of the hydrogel 38 or the magnetic core 32, or an azide-terminated primer can react with an alkyne or DBCO (dibenzocyclooctyne) of the hydrogel 38 or the magnetic core 32, or an amino-terminated primer can react with an activated carboxylate group or NHS ester of the hydrogel 38 or the magnetic core 32, or a thiol-terminated primer can react with an alkylating reactant (e.g., iodoacetamide or maleimide) of the hydrogel 38 or the magnetic core 32, or a phosphoramidite-terminated primer can react with a thioether of the hydrogel 38 or the magnetic core 32. While several examples have been provided, it should be understood that any functional group that is capable of attaching to primer 18 and capable of attaching to hydrogel 38 or magnetic core 32 may be used.

[0079] The 5' end of the second primer 34 is terminated by a 5'-tag 40 that can bind to the coating 28 of the coated non-magnetic bead 26. Therefore, the 5'-tag 40 and the coating 28 constitute a binding pair. In one example, the 5'-tag 40 is biotin and the coating 28 is streptavidin.

[0080] As mentioned, the magnetic core 32 may be coated with a polymer hydrogel 38 that includes functional groups to which the first primer 18 is attached.

[0081] Some examples of polymer hydrogel 38 may at least partially encapsulate magnetic core 32 without being covalently bonded thereto. For example, non-covalent bonding may attach polymer hydrogel 38 to magnetic core 32. As examples, polymer hydrogel 38 may be attached to magnetic core 32 by hydrogen bonding with silanols, or by physical adsorption via van der Waals, or by electrostatic interactions, or by affinity (lipophilicity / hydrophilicity).

[0082] Other examples of polymer hydrogel 38 can be covalently attached to magnetic core 32, and thus magnetic core 32 can include anchoring surface groups or be functionalized with anchoring surface groups to covalently attach to polymer hydrogel 38. As an example, magnetic core 32 can be functionalized with alkynes (e.g., dibenzocyclooctyne), and polymer hydrogel 38 can include azides that can be attached to alkynes; or magnetic core 32 can be functionalized with azides, and polymer hydrogel 38 can include diynes that can be attached to azides. Other covalent bonds between polymer hydrogel 38 and magnetic core 32 are also possible, including those obtained by nucleophilic substitution reactions (e.g., between nucleophilic groups and nucleofugal groups). Some specific examples include those involving aldehydes and hydrazines, or amines and activated carboxylates (e.g., N-hydroxysuccinimide esters), or thiols and alkylating agents, or phosphoramidites and thioethers.

[0083] In the examples disclosed herein, the polymer hydrogel 38 is a copolymer comprising at least one acrylamide monomer unit, and is a linear polymer hydrogel or a branched polymer hydrogel.

[0084] The linear or branched polymer hydrogel 38 may include a first repeating unit of formula (I): in:

[0085] R 1 is selected from the group consisting of: -H, halogen, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocycle, and optionally substituted variants thereof; R 2 is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate and thiol; each (CH2) p may be optionally substituted; and p is an integer from 1 to 50;

[0086] The second repeating unit of formula (II): Where: R 3 , R 3’ , R 4 , R 4’ Each of which is independently selected from the group consisting of: -H, R 5 、-OR 5 、-C(O)OR 5 、-C(O)R 5 、-OC(O)R 5 、-C(O)NR 6 R 7 and-NR 6 R 7 ; R 5is selected from the group consisting of -H, -OH, alkyl, cycloalkyl, hydroxyalkyl, aryl, heteroaryl, heterocycle, and optionally substituted variants thereof; and R 6 and R 7 Each of is independently selected from the group consisting of -H and alkyl.

[0087] In one example, R 1 Yes - H; R 2 is an azido group; R 3’ , R 4 and R 4’ Each of -H; R 3 Yes-C(O)NR 6 R 7 , where R 6 and R 7 Each of is -H; and p is 5. The polymer hydrogel 14 is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide, or PAZAM. In one variant of PAZAM, R 1 Yes - H; R 2 is an azido group; R 3’ , R 4 and R 4’ Each of -H; R 3 Yes-C(O)NR 6 R 7 , where R 6 and R 7 Each of is a C1-C6 alkyl group (eg, -CH3); and p is 5.

[0088] In some examples, some of the repeating units of formula (I) have R 2 is replaced by tetramethylethylenediamine (TeMED). TeMED is a reaction promoter that can be introduced during copolymerization. Due to side reactions, TeMED replaces azide (N3) or other R 2 Although this reaction reduces the azide (or other R 2 Example) content, but also introduces branching sites. Branching sites can provide locations where copolymer chains can branch off from each other.

[0089] In other examples, a third repeating unit of formula (II) may be included, provided that the second and third repeating units are different. For example, in the second repeating unit, R 3’ , R 4 and R 4’ Each of -H; R 3 Yes-C(O)NR 6 R 7 , where R 6 and R7 Each of is -H, and in the third repeating unit, R 3’ , R 4 and R 4’ Each of -H; R 3 Yes-C(O)NR 6 R 7 , where R 6 and R 7 Each of is a C1-C6 alkyl group.

[0090] The number of first repeating units (Formula (I)) can be an integer in the range of 2 to 50,000, and the number of second repeating units (Formula (II)) can be an integer in the range of 2 to 100,000. When a third repeating unit is included, the number of such units can be an integer in the range of 1 to 100,000. It should be understood that the incorporation of the individual units can be statistical, random, or block, and can depend on the method used to synthesize the polymer hydrogel 38.

[0091] In other examples of polymer hydrogel 38, the first repeating unit of formula (I) may be replaced by a heterocyclic azide group of formula (III):

[0092]

[0093] Where R 8 is H or C1-C6 alkyl; R 9 is H or C1-C6 alkyl; L is a linker including a straight chain having 2 to 20 atoms selected from carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain including 1 to 4 atoms selected from carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0094] In one example, formula (III) is the first repeating unit and formula (II) is the second repeating unit. In another example, formula (III) is the first repeating unit, an example of formula (II) is the second repeating unit, and a different example of formula (III) is the third repeating unit.

[0095] It should be understood that other polymer hydrogels 38 can be used as long as they are functionalized to graft the first primer 18 and can be attached to the magnetic core 32. Some examples of suitable hydrogels 38 include functionalized polysilanes, such as norbornene silanes, azido silanes, alkyne functionalized silanes, amine functionalized silanes, maleimide silanes, or any other polysilanes having functional groups that can attach the first primer 18. Other examples of suitable hydrogels 38 include those with colloidal structures, such as agarose; or those with polymer network structures, such as gelatin; or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA) or azidated versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of suitable polymer hydrogels 38 include mixed copolymers of acrylamide and acrylate. A variety of polymer architectures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) can be used in the examples disclosed herein, such as highly branched polymers, including dendrimers. For example, monomers (e.g., acrylamide, etc.) can be incorporated into the branches (arms) of dendrimers in a random or block manner.

[0096] Examples of dendritic polymer hydrogels 38 include a dendritic core having repeating units of formula (II) and (III) in the arms extending from the core. The dendritic core may have any number of arms between 3 arms and 30 arms.

[0097] The dendritic core can be any multifunctional component capable of achieving a controlled polymerization mechanism that results in defined arm lengths in the polymer structure and at least substantially uniform arm lengths between polymer structures. In one example, the arms of the dendritic core are identical to one another.

[0098] The central molecule / compound of the dendritic core can be any multifunctional molecule, such as a macrocycle (e.g., cyclodextrin, porphyrin, etc.), an extended π system (e.g., perylene, fullerene, etc.), a metal-ligand complex, a polymer core, etc. Some specific examples of the central molecule / compound of the dendritic core include phenyl groups, benzoic acid, pentaerythritol, phosphazene groups, etc.

[0099] The dendritic core includes arms extending from a central molecule / compound. Each arm may include a group that enables the incorporation of monomers of formula (II) and (III). In one example, a thiocarbonyl group is included in each arm and thus includes a reversible addition-fragmentation chain transfer agent (RAFT agent). In another example, the dendritic core includes an atom transfer radical polymerization (ATRP) initiator in each arm. In yet another example, the dendritic core includes a nitroxide (aminooxy) mediated polymerization (NMP) initiator in each arm.

[0100] It should be understood that the functional groups in one or more of the repeating units of the polymer hydrogel 38 are capable of attaching the first primer 18 of the primer set. These functional groups (e.g., R 2 , NH2, N3, etc.) can be located in the side chains of linear or branched polymer hydrogels or in the arms of dendritic polymer hydrogels. These functional groups can be introduced as part of the monomers used in the copolymerization. In order to control the number of anchor points of primer 18, the monomers with functional groups can be increased or decreased. These functional groups can also be introduced after the copolymerization.

[0101] The thickness of the polymer hydrogel 38 on the magnetic core 32 is in the range of about 10 nm to about 200 nm. The polymer hydrogel 38 may be in a dry state or may be in a swollen state, in which the polymer hydrogel absorbs liquid. A thickness of 10 nm indicates the polymer hydrogel 38 in a completely dry state, and a thickness of 200 nm indicates the polymer hydrogel 38 in a completely swollen state.

[0102] The weight average molecular weight of the polymer hydrogel 38 (linear or branched) is in the range of about 10 kDa to about 2,000 kDa. In other examples, the weight average molecular weight is about 100 kDa to about 400 kDa. Increasing the molecular weight will increase the thickness of the polymer hydrogel 38.

[0103] The polymer hydrogel 38 may be coated on the magnetic core 32 using any suitable deposition technique. Examples of suitable deposition techniques include dip coating, dunk coating, spin coating, spray coating, whipped dispensing, ultrasonic spray coating, etc. In one example, the magnetic core 32 may be suspended in the polymer hydrogel 38 and exposed to conditions (e.g., heat) that will cause the polymer hydrogel 38 to attach to the magnetic core 32.

[0104] Once the polymer hydrogel 38 is coated on the magnetic core 32, a plurality of first primers 18 can be grafted onto the polymer hydrogel 38. Grafting may include dip coating, which includes immersing the magnetic core 32 having the polymer hydrogel 38 thereon into a primer solution or mixture, which may include primers 18, water, a buffer and a catalyst. Other grafting techniques may include spraying, whipping distribution or another suitable method of connecting the primer 18 to the polymer hydrogel 38. For any of the grafting methods, the primer 18 reacts with the reactive groups of the polymer hydrogel 38. Alternatively, when the magnetic core 32 contains a suitable functional group for attaching the primer 18 or has been functionalized with the suitable functional group, any of these grafting techniques can be used to attach the primer 18 directly to the surface group of the magnetic core 32.

[0105] In other examples, the plurality of first primers 18 may be grafted onto the polymer hydrogel 38 prior to deposition on the magnetic core 32. The magnetic core 32 may be suspended in the pre-grafted polymer hydrogel 38 and exposed to conditions (e.g., heat) that will initiate attachment of the pre-grafted polymer hydrogel 38 to the magnetic core 32. In these examples, no additional grafting is performed.

[0106] Functionalized magnetic beads 16 (and thus the single-stranded aggregated magnetic beads 10 formed therefrom) may also include or be functionalized by a mechanism capable of anchoring to a capture site on a flow cell substrate. The mechanism may be chemical (eg, a functional agent), electrostatic or magnetic.

[0107] In some examples, the mechanism is a component of the functionalized magnetic bead 16, which enables it to be anchored without further functionalization. For example, the magnetic core 32 can be a mechanism for anchoring to a magnetic capture agent on a circulation pool substrate. For another example, a reversibly charged functional group (such as an amine or carboxylic acid) can be attached (e.g., via a thiol bond) to the surface of the magnetic core 32 or polymer hydrogel 38 together with the primer 18, 34. In this example, the reversibly charged functional group (as the mechanism) enables the single-chain aggregated bead 10 to be anchored to an electrostatic capture agent on a circulation pool substrate.

[0108] In other examples, the mechanism is a functional agent added to the functionalized magnetic beads 16, which enables it to be anchored on the circulation pool substrate. As an example, the target nucleic acid can be attached to the magnetic core 32 or the polymer hydrogel 38 by a suitable linking group, wherein the target nucleic acid is complementary to the capture oligonucleotide on the circulation pool substrate. As another example, the functional group or member of the binding pair for covalent attachment can be attached to the magnetic core 32 or the polymer hydrogel 38 by a suitable linking group. The member of the binding pair attached to the functionalized magnetic beads 16 for the purpose of attachment to the circulation pool capture site (i.e., the mechanism defined herein) can be different from the member of the binding pair introduced during amplification, so that the mechanism does not interfere with amplification and cluster generation.

[0109] Referring back to the enrichment method, the functionalized magnetic beads 16 are introduced into the liquid carrier to form a suspension 20. In one example, the concentration of the functionalized magnetic beads 16 is in the range of about 0.05 mg / mL to about 1 mg / mL. In a specific example, the concentration of the functionalized magnetic beads 16 is in the range of about 0.1 mg / mL to about 0.2 mg / mL.

[0110] The liquid carrier can be any suitable liquid in which extension reactions, chain invasion and amplification can occur. In one example, the liquid carrier can include water and ionic salt buffers, such as citrate water, sodium citrate, sodium chloride, potassium chloride, phosphate buffered saline, etc., and other buffers, such as tris (hydroxymethyl) aminomethane (TRIS) or (4- (2-hydroxyethyl) -1- piperazineethanesulfonic acid) (HEPES). Any ionic salt buffer can be present in millimolar concentrations, for example, in the range of about 350mM to about 800mM. The liquid carrier can also include a non-ionic surfactant, such as TWEEN TM Polysorbate.

[0111] Generating a mixture of aggregated magnetic beads 12 and non-aggregated magnetic beads 14 from the multiple magnetic beads 16 in the suspension 20 includes: i) introducing a plurality of library templates 36 into the suspension 20 at a ratio of at least 4:1 of magnetic beads 16:library template 36, whereby some of the multiple library templates 36 are hybridized with the first primers 18 of some of the multiple magnetic beads 16, respectively, and some other magnetic beads in the multiple magnetic beads 16 remain unseeded; ii) initiating a first primer extension reaction to generate a first amplicon 22; and iii) initiating chain invasion amplification on some of the multiple magnetic beads 16 by introducing a 5'-labeled second primer 34 of a primer set into the multiple magnetic beads 16.

[0112] Library template 36 can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample). DNA nucleic acid samples can be fragmented into single-stranded DNA fragments of similar size (e.g., <1000bp). RNA nucleic acid samples can be used to synthesize complementary DNA (cDNA), and cDNA can be fragmented into single-stranded cDNA fragments of similar size (e.g., <1000bp). During preparation, adapters can be added to the ends of any fragments. By reducing cyclic amplification, different motifs can be introduced into the adapters, such as sequencing primer binding sites, indexes, and regions complementary to primers 18 and 34 in the primer set. In some examples, fragments from a single nucleic acid sample have the same adapter added to them. The final library template 36 includes DNA or cDNA fragments and adapters at both ends. The DNA or cDNA fragments represent the portion to be sequenced of the final library template 36.

[0113] Under conditions (e.g., salt content, temperature) that allow the library templates 36 to hybridize with the first primers 18 of the functionalized magnetic beads 16, respectively, the plurality of library templates 36 are introduced into a suspension 20 containing the plurality of functionalized magnetic beads 16. In one example, the high salt content of the liquid carrier of the suspension provides a suitable environment for hybridization. The temperature of the suspension 20 may be up to about 60°C. In a specific example, the inoculation temperature is about 40°C.

[0114] The library template 36 is introduced at a ratio of at least 4:1 of magnetic beads 16:library template 36. In one example, the ratio of magnetic beads 16:library template 36 is in the range of 4:1 to 60:1. In these cases, the seeding of the library template 36 is performed at a sub-Poisson's ratio. This results in a high percentage (e.g., at least 97%) of single seeded magnetic beads 16 (i.e., a single library template 36 is seeded onto a single bead 16 (see Figure 2 "B")) and thus result in a high percentage of monoclonality in the seeded beads 16. However, at this / these ratios, some functionalized magnetic beads 16 also remain unseeded and thus do not aggregate (e.g. Figure 1A The non-aggregated magnetic beads 14 are not seeded with the library template 36 and therefore do not undergo amplification and cluster generation. Therefore, the "non-aggregated magnetic beads" 14 are synonymous with the functionalized magnetic beads 16.

[0115] The inoculation reaction may be allowed to proceed for a period of time ranging from about 30 minutes to about 120 minutes with or without consistent shaking.

[0116] After the library template is seeded, the suspension 20 can be exposed to a washing solution to remove the unseeded library template 36. The liquid carrier of the suspension 20 can also be replenished. It should be understood that after washing, the seeded and unseeded functionalized magnetic beads 16 remain in the suspension 20. The washing solution can be an aqueous solution containing any ionic salt buffer and surfactant listed herein. The washing solution generally has a lower salt content than the liquid carrier of the functionalized magnetic beads 16.

[0117] Then, a first primer extension reaction is initiated to generate an amplicon 22, such as Figure 2In order to initiate the first primer extension reaction, a nucleotide mixture containing non-cleavable nucleotides and a polymerase are introduced into the suspension 20. Non-cleavable nucleotides include the following bases: adenine, cytosine, guanine and thymine. Any polymerase that can accept non-cleavable nucleotides and can successfully incorporate the base of the non-cleavable nucleotide into the 3' end of the first primer 18 can be used. Example polymerases include those from family A, such as Bsu polymerase, Bst polymerase, Taq polymerase, T7 polymerase, and many others; polymerases from families B and B2, such as Phi29 polymerase and other highly processive polymerases (family B2), Pfu polymerase (family B), KOD polymerase (family B), 9oN (family B), and many others; polymerases from family C, such as Escherichia coli DNA Pol III, and many others; polymerases from family D, such as Pyrococcus furiosus DNA Pol II, and many others; polymerases from family X, such as DNA Polμ, DNA Polβ, DNA Polσ, and many others. The nucleotide mixture may also include a liquid carrier such as water and / or an ionic salt buffer, for example, millimolar to molar concentrations of citrate solution, sodium chloride, potassium chloride, phosphate buffered saline, and the like, and other buffers such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES). The liquid carrier may also include a catalytic metal intended for the extension reaction, such as Mg. 2+ , Mn 2+ Etc. A single catalytic metal or a combination of catalytic metals may be used, and the total amount may be in the range of about 0.01 mM to about 100 mM.

[0118] The temperature of the suspension 20 can be adjusted to initiate the template extension reaction. In one example, the temperature is about 60° C. The polymerase enables extension of the 3′ end of the primer 18 using the library template 36 as a template for nucleotide incorporation. The polymerase extension generates an amplicon 22 that is complementary to the seeded library template 36.

[0119] The extension reaction can be allowed to proceed for a time ranging from about 10 minutes to about 90 minutes with or without consistent shaking.

[0120] After the extension reaction, the suspension 20 can be exposed to a washing solution to remove unincorporated nucleotides and other components of the nucleotide mixture. The liquid carrier of the suspension 20 can also be replenished. It should be understood that the functionalized magnetic beads 16 to which the amplicons 22 are attached and the unseeded functionalized magnetic beads 16 remain in the suspension 20 after washing.

[0121] Strand invasion amplification can then be initiated within the suspension 20. Figure 2 . Strand invasion amplification is initiated by introducing a 5'-labeled second primer 34 into the suspension 20. The primer sequence of the 5'-labeled second primer 34 is complementary to a portion of the amplicon 22 (due to the presence of an adapter incorporated into the library template 36). The amplification relies on the recombinase-dependent insertion of the 5'-labeled second primer 34 into a double-stranded target nucleic acid, which is composed of the library template 36 and the first amplicon 22. The duplex region surrounding the insertion site dissociates, thereby enabling the 5'-labeled second primer 34 to bind. The polymerase then extends the 5'-labeled second primer 34 along the first amplicon 22 to generate a 5'-labeled second amplicon 24, which displaces the library template 36. The adapter of the displaced library template 36, which is complementary to the surface-bound first primer 18, hybridizes to the nearby first primer 18, where it can be extended to generate another first amplicon 22 (such as Figure 2 The strand invasion and extension reactions can be repeated, resulting in exponential amplification of the library template 36 across the surface of the functionalized magnetic beads 16 (as shown in FIG. Figure 2 This process produces monoclonal aggregated magnetic beads 12. Although one example technique has been described, other non-bridging amplification techniques may also be used.

[0122] The 5'-labeled second primer 34 can be introduced into the aggregation mixture without poly(ethylene glycol) to reduce or prevent aggregation. The aggregation mixture includes a surfactant (e.g., TWEEN TM polysorbates), solvents (e.g., ionic buffers), polymerases, recombinases, nucleotides, nucleoside triphosphates, proteins, other enzymes, reducing agents, and magnesium sources.

[0123] To perform amplification and aggregation, the suspension 20 containing the aggregation mixture can be heated to a temperature in the range of about 37° C. to about 40° C. (e.g., about 38° C.). Amplification can be allowed to proceed for a time in the range of about 30 minutes to about 90 minutes. In one example, amplification is allowed to proceed for about 60 minutes (1 hour) with or without consistent shaking.

[0124] After amplification, the suspension 20 can be exposed to a washing solution to remove the aggregated mixture. The liquid carrier of the suspension 20 can also be replenished.

[0125] As mentioned, Figure 2 The method shown in results in the formation of aggregated magnetic beads 12 and non-aggregated magnetic beads 14 (i.e., those functionalized magnetic beads 16 that are not seeded with library template 36). This mixture is shown in Figure 1A , in which the enrichment method begins.

[0126] Reference now Figure 1B , a plurality of coated non-magnetic beads 26 are added to the suspension 20. Figure 1B In FIG. 1 , for simplicity of illustration, one coated non-magnetic bead 26 is shown.

[0127] Each coated non-magnetic bead 26 includes a non-magnetic core 42 coated with a coating 28 of a second member of a binding pair.

[0128] The non-magnetic core 42 can be any non-magnetic material. Some examples of suitable materials for the non-magnetic core 42 include polytetrafluoroethylene (PTFE), some polyacrylic acids, polypropylene, polyethylene, polybutylene, polyurethane, polystyrene and other styrene copolymers, nylon (i.e., polyamide), polycaprolactone (PCL), nitrocellulose, silicon dioxide (SiO2), silicon dioxide-based materials (e.g., functionalized SiO2) and carbon. The diameter of the non-magnetic core 42 is at least ten times the diameter of each magnetic bead in the plurality of magnetic beads 16. Therefore, the diameter of the non-magnetic bead 26 (including the thickness of the coating 28) is also at least ten times the diameter of each magnetic bead in the plurality of magnetic beads 16. In one example, the diameter of the non-magnetic core 42 is in the range of about 100nm to about 10μm. In another example, the diameter of the non-magnetic core 42 is in the range of about 1μm to about 3μm. It should be understood that the greater the difference between the diameters, the easier it is to separate by filtration or tangential flow filtration (TFF).

[0129] As mentioned, the coating 28 of the coated non-magnetic bead 26 is the second member of the binding pair and is therefore dependent on the 5'-label 40 of the 5'-labeled second primer 34 (which is the first member of the binding pair). In one example, the coated non-magnetic bead 26 is a coated silica bead (i.e., the non-magnetic core 42 is silica), and the coating 28 is streptavidin.

[0130] The coated non-magnetic beads 26 may be commercially available or may be prepared by depositing streptavidin onto the non-magnetic core 42 using any of the deposition techniques listed herein.

[0131] The plurality of coated non-magnetic beads 26 are added to the suspension 20 at a ratio of magnetic beads 16: coated non-magnetic beads 26 in the range of greater than 1:1 to 300:1. If larger non-magnetic beads 26 are used, the ratio may be higher. In this ratio, the number of magnetic beads 16 reflects the approximate or actual number of magnetic beads 16 present at the beginning of the method. The ratio can be adjusted according to the diameter of the beads 16, 26. It is expected that the aggregated magnetic beads 12 are attached to the coating 28 of the coated non-magnetic beads 26 without aggregation. In some cases, the ratio can be selected so that the desired number of smaller magnetic beads 16 can be attached substantially uniformly across the surface of the larger coated non-magnetic beads 26 without overcrowding. In order to avoid aggregation with beads 16, 26 of any size, the surface of the non-magnetic beads 26 should not be covered by more than 50% of the magnetic beads 16. The negative charge of the aggregated beads 10 should also help to mitigate aggregation.

[0132] The plurality of coated non-magnetic beads 26 can be introduced into a suspension 20 in a buffer containing a non-ionic surfactant at about 0.1% active (w / v) to about 0.5% active (w / v). The salt content in the buffer can promote bioconjugation of the first and second members of the binding pair, and the non-ionic surfactant can help reduce aggregation of the aggregated magnetic beads 12. Figure 1B The mixture shown in can be incubated at room temperature (e.g., from about 18°C ​​to about 22°C) with or without consistent shaking for up to 24 hours. The incubation can range from about 30 minutes to about 24 hours, depending on the bead ratio (bead 16: bead 26) and the bonding chemistry utilized. In one example, the incubation is performed for about 16 hours.

[0133] Since the aggregated magnetic beads 12 include the first member of the binding pair (as the 5'-tag 40 of the second amplicon 24), and the coated non-magnetic beads 26 include the second member of the binding pair (as the coating 28), the aggregated magnetic beads 12 bind to the surface of the coated non-magnetic beads 26 during the incubation. Similarly, since the non-aggregated magnetic beads 14 do not include the first member of the binding pair (because no amplicons 22, 24 are generated on these magnetic beads 14, 16), the non-aggregated magnetic beads 14 do not bind to the surface of the coated non-magnetic beads 26, but remain dispersed in the liquid carrier of the suspension 20, as shown. Figure 1B This process forms a bead-on-bead complex 30 that is capable of separating unbound (free), non-aggregated magnetic beads 14 from bound, aggregated magnetic beads 12 .

[0134] After the plurality of coated non-magnetic beads 26 are added to the suspension 20 and incubated, the non-aggregated magnetic beads 14 are separated from the suspension 20 containing the bead-on-bead complexes 30. Figure 1CDepicted in . In one example, non-aggregated magnetic beads 14 are filtered out of the suspension. This can be accomplished using a membrane filtration system such as tangential flow filtration (TFF). The system and technique allow smaller non-aggregated magnetic beads 14 to be removed and reused. In addition, the modularity of the system and technique allows different membrane pore sizes, thereby allowing non-aggregated magnetic beads 14 of various sizes to be removed. Other techniques that can be used include sedimentation filtration (in which the bead-on-bead complex 30 will precipitate faster than the non-aggregated magnetic beads 14), or differential magnetic pull (in which the bead-on-bead complex 30 will be pulled at a different speed than the non-aggregated magnetic beads 14), or standard filtration with a size cutoff just below the size of the bead-on-bead complex 30. Regardless of the technique used, removing the non-aggregated magnetic beads 14 will leave a suspension rich in aggregated magnetic beads 12.

[0135] like Figure 1D As shown, the enrichment method then includes dehybridization of the 5'-tagged second amplicon 24 from the first amplicon 22, which generates single-stranded aggregated magnetic beads 10. This releases the single-stranded aggregated magnetic beads 10 from the bead-on-bead complex 30 without having to disrupt the binding pair connection (between the 5'-tag 40 and the coating 28).

[0136] In one example, dehybridization of the 5'-labeled second amplicon 24 from the first amplicon 22 includes introducing an alkaline solution into the suspension 20, which denatures the 5'-labeled second amplicon 24 from the first amplicon 22 and dissolves at least a portion of the plurality of coated non-magnetic beads 26. For example, the alkaline solution can be an aqueous solution of sodium hydroxide (NaOH). The molar concentration of the solution can be in the range of about 0.01M NaOH to about 1M. Dissolving at least a portion of the coated non-magnetic beads 26 facilitates dehybridization because it is not necessary to introduce additional smaller molecules that are usually added to compete for rehybridization.

[0137] The suspension 20 (including the bead-on-bead complex 30) and the alkaline solution may be allowed to incubate for a time ranging from about 3 minutes to about 10 minutes at a temperature ranging from about 18° C. to about 37° C. This process may also be performed with or without consistent shaking.

[0138] In another example, dehybridization of the 5'-tagged second amplicon 24 from the first amplicon 22 includes introducing formamide into the suspension 20. 100% formamide may be used, or a diluted sample containing 50% to less than 100% formamide may be used.

[0139] The suspension 20 (including the bead-on-bead complex 30) and formamide may be allowed to incubate at a temperature in the range of about 55° C. to about 95° C. for a time in the range of about 10 minutes to about 30 minutes. Multiple stages of dehybridization may be performed, with each stage in the range of about 5 minutes to about 15 minutes. The process may also be performed with or without consistent shaking.

[0140] Each of these examples separates the 5'-labeled second amplicon 24 from the first amplicon 22, which remains attached to the magnetic core 32 via the first primer 18. Thus, the aggregated magnetic beads 12 are released from the coated non-magnetic beads 26, even though the corresponding 5'-labeled second amplicon 24 remains attached to the coated non-magnetic beads 26. Figure 1D As shown, this process also releases a 5'-labeled second amplicon 24 which hybridizes to the first amplicon 22 but is not attached to the coating 28. It should be appreciated that the first primer 22 remains intact on the aggregated magnetic beads 12 even when a portion of the coated non-magnetic beads 26 are dissolved.

[0141] Then the single-stranded aggregated magnetic beads 10 are separated from the suspension 20 ( Figure 1E ). Since the single-stranded aggregated magnetic beads 10 are magnetic, and the coated non-magnetic magnetic beads 26 are not magnetic, a magnetic pull can be used to remove the single-stranded aggregated magnetic beads 10. Any suitable magnet can be used. The separated single-stranded aggregated magnetic beads 10 can be washed (as described herein) and then introduced into a flow cell ( Figure 3 The reference numeral 44 in the figure is used for sequencing operations.

[0142] Flow cell

[0143] The separated single-stranded aggregated magnetic beads 10 can be combined with the capture sites 46, 46' ( FIG. 4A to FIG. 4D ) of any flow cell 44 ( Figure 3 ) Figure 3 An example of a flow cell 44 is depicted from a top view in FIG. Figure 4A , Figure 4B , Figure 4C and Figure 4D Different examples of flow cell architectures comprising different capture sites 46, 46' are shown in FIG.

[0144] A top view of an example of a flow cell 44 is shown in FIG. Figure 3 As shown in the reference Figure 4A , Figure 4B and Figure 4CAs discussed, some examples of the flow cell 44 include two opposing substrates 48A, 48A', or 48B, 48B', or 48C, 48C', each of which is configured with a capture site 46, 46'. In these examples, a flow channel 50 is defined between the two opposing substrates 48A, 48A', or 48B, 48B', or 48C, 48C'. In other examples, the flow cell 44 includes one substrate 48A or 48B or 48C configured with a capture site 46 and a cover 52 attached to the substrate 48A or 48B or 48C (see Figure 4D ). In these examples, flow channel 50 is defined between base 48A or 48B or 48C and cover 52.

[0145] Different substrates 48A, 48A', or 48B, 48B', or 48C, 48C' are shown in Figure 4A , Figure 4B and Figure 4C middle.

[0146] exist Figure 4A In the example shown, substrates 48A, 48A' are single-layer structures. Examples of suitable single-layer structures for substrates 48A, 48A' include epoxysilicone, glass, modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours) ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxides, silicon dioxide, fused silica or silicon dioxide-based materials, aluminum silicates, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc.

[0147] exist Figure 4B and Figure 4C In the example shown, the substrates 48B, 48B' and 48C, 48C' are multi-layer structures. The multi-layer structures of the substrates 48B, 48B' and 48C, 48C' include base supports 54, 54' and patterned materials 56, 56' on the base supports 54, 54'.

[0148] The base supports 54, 54' may be any of the examples described herein for the single layer structure of the substrates 48A, 48A'.

[0149] Patterned material 48A or 48A' may be a material that can be patterned with pillars 58, 58' ( Figure 4B ) or recessed portion 60, 60'( Figure 4C ) patterned any material.

[0150] In one example, the patterned material 56, 56' can be an inorganic oxide that is selectively applied to the base support 54, 54' in a desired pattern, such as via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), etc.

[0151] In another example, the patterning material 56, 56' can be a resin matrix material that is applied to the base support 54, 54' and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, bubble coating, spin coating, spray coating, whipping dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), imprinting technology, embossing technology, molding technology, micro-etching technology, printing technology, etc. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins, non-polyhedral oligomeric silsesquioxane epoxy resins, poly (ethylene glycol) resins, polyether resins (e.g., ring-opened epoxides), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., available from Bellex) ) and their combinations.

[0152] As used herein, the term "polyhedral oligomeric silsesquioxane" (trade name Commercially available from Hybrid Platics) refers to a hybrid intermediate between silicon dioxide (SiO2) and silicone (R2SiO2) (e.g., RSiO2). 1.5 ). Examples of polyhedral oligomeric silsesquioxanes may be as described in Kehagias et al., Microelectronic Engineering 86 (2009) pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition is a composition having the formula [RSiO 3 / 2 ] nof an organosilicon compound, wherein the R groups may be the same or different. Example R groups of polyhedral oligomeric silsesquioxanes include epoxy, azide / azide, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or additionally for example alkyl, aryl, alkoxy and / or haloalkyl groups. The resin compositions disclosed herein may include one or more different cage or core structures as monomer units. The average cage content may be adjusted during synthesis and / or controlled by purification methods, and the cage size distribution of the monomer units may be used in the examples disclosed herein.

[0153] In one example, substrate 48A, 48A' or 48B, 48B' or 48C, 48C' (whether single layer or multilayer) can be circular and have a diameter in the range of about 2mm to about 300mm, or can be a rectangular sheet or panel with a maximum size of up to about 10 feet (about 3 meters). In one example, substrate 48A, 48A' or 48B, 48B' or 48C, 48C' is a wafer with a diameter in the range of about 200mm to about 300mm. The wafer can then be cut to form a separate circulation cell substrate. In another example, substrate 48A, 48A', or 48B, 48B', or 48C, 48C' is a tube core with a width in the range of about 0.1mm to about 10mm. Although example sizes have been provided, it should be understood that substrates 48A, 48A', or 48B, 48B', or 48C, 48C' with any suitable size can be used. As another example, a panel can be used as a rectangular support, which has a larger surface area than a 300 mm round wafer. The panel can then be cut to form individual flow cells.

[0154] The flow cell 44 also includes a flow channel 50. Figure 3 Several flow channels 50 are shown, but it should be understood that any number of flow channels 50 (e.g., a single channel 50, four channels 50, etc.) may be included in the flow cell 44. Each flow channel 50 may be isolated from every other flow channel 50 in the flow cell 44 so that fluid introduced into any particular flow channel 50 does not flow into any adjacent flow channel 50.

[0155] A portion of flow channel 50 may be defined in substrate 48A, 48A', or 48B, 48B', or 48C, 48C' using any suitable technique, which may depend in part on the material of substrate 48A, 48A', or 48B, 48B', or 48C, 48C'. In one example, a portion of flow channel 50 is etched into a glass substrate, such as substrate 48A, 48A'. In another example, a portion of flow channel 50 may be patterned into a multilayer structure using photolithography, nanoimprint lithography, or the like. A single material (e.g., FIG. 4A to FIG. 4DA material 62 in FIG. 1 is applied to the substrate 48A, 48A′, or 48B, 48B′, or 48C, 48C′ such that the separate material 62 defines at least a portion of the wall of the flow channel 50 .

[0156] In one example, the flow channel 50 has a substantially rectangular configuration with rounded ends. The length and width of the flow channel 50 may be smaller than the length and width of the substrate 48A, 48A', or 48B, 48B', or 48C, 48C', respectively, so that the portion of the substrate surface surrounding the flow channel 50 can be used to attach to another substrate 48A, 48A', or 48B, 48B', or 48C, 48C' or to the cover 52. In some cases, the width of each flow channel 50 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm or more. In some cases, the length of each flow channel 50 can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm or more. The width and / or length of each flow channel 50 can be greater than, less than, or between the values ​​specified above. In another example, the flow channel 50 is a square (e.g., 10 mm×10 mm).

[0157] For example, when micro-contact, aerosol or inkjet printing is used to deposit a separate material 62 defining the flow channel wall, the depth of each flow channel 50 can be as small as a few monolayers thick. In other examples, the depth of each flow channel 50 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm or more. In one example, the depth can be in the range of about 10 μm to about 100 μm. In another example, the depth is about 5 μm or less. It should be understood that the depth of each flow channel 50 may also be greater than, less than, or between the values ​​specified above. For example, when using columns 58, 58' or recesses 60, 60', the depth of the flow channel 50 may also vary along the length and width of the circulation pool 44.

[0158] exist Figure 4A In the example shown, each substrate 48A, 48A' has a substantially planar surface 64, 64'; and the plurality of capture sites 46, 46' are positioned in a pattern across the substantially planar surface 64, 64'.

[0159] The substantially flat surface 64, 64' may be the bottom surface of a lane 66, 66' defined in a single layer substrate 48A, 48A'. The lanes 56, 56' may also be defined in a patterned layer 64, 64' of a multilayer substrate 48B, 48B', 48C, 48C'. The lanes 56, 56' may be etched into the substrate or defined, for example, by photolithography or another suitable technique.

[0160] The plurality of capture sites 46, 46' are positioned in a pattern across a substantially planar surface 64, 64'.

[0161] Many different patterns of capture sites 46, 46' can be envisioned, including regular, repeated and irregular patterns. In one example, capture sites 46, 46' are arranged in a hexagonal grid to closely pack and improve density. Other layouts may include, for example, a straight (rectangular) layout, a triangular layout, etc. In some examples, the layout or pattern may be an xy format of capture sites 46, 46' in the form of rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of capture sites 46, 46' separated by regions of substantially flat surfaces 64, 64'. In other examples, the layout or pattern may be a random arrangement of capture sites 46, 46'. The pattern may include bars, swirls, lines, triangles, rectangles, circles, arcs, plaids, diagonals, arrows and / or squares.

[0162] The layout or pattern of capture sites 46, 46' can be characterized with respect to the density of capture sites 46, 46' (eg, the number of capture sites 46, 46') in a defined area. For example, capture sites 46, 46' can be approximately 2 million / mm 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 pieces / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 Or a greater or lesser density. It should also be understood that the density of capture sites 46, 46' can be between a value selected from the lower limit value of the above range and a value in the upper limit value. As an example, a high-density array can be characterized as having capture sites 46, 46' separated by less than about 100nm, a medium-density array can be characterized as having capture sites 46, 46' separated by about 400nm to about 1μm, and a low-density array can be characterized as having capture sites 46, 46' separated by more than about 1μm. Although example densities have been provided, it should be understood that any suitable density can be used. In some cases, it may be desirable that the spacing between capture sites 46, 46' is even greater than the examples listed herein.

[0163] The layout or pattern of capture sites 46, 46' may also be characterized according to or alternatively according to the average pitch or spacing (center-to-center spacing) from the center of one capture site 46, 46' to the center of an adjacent capture site 46, 46' or the average pitch or spacing (edge-to-edge spacing) from the left edge of one capture site 46, 46' to the right edge of an adjacent capture site 46, 46'. The pattern may be regular, so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch of a particular pattern of capture sites 46, 46' may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. In one example, the capture sites 46, 46' have a pitch (center-to-center spacing) of about 1.5 μm. While example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0164] The capture sites 46, 46' may have any suitable shape, geometry, and size, which may depend at least in part on the single-stranded aggregated magnetic beads 10 to be captured by the capture sites 46, 46'.

[0165] The capture sites 46, 46' can be electrostatic capture sites, chemical capture sites or magnetic capture sites.

[0166] In some of the examples listed herein, the capture sites 46, 46' are magnetic capture sites. The magnetic capture sites include any of the examples described herein that can be deposited at predetermined locations on a substantially flat surface 64, 64'. For example, magnetic material can be deposited using chemical vapor deposition, masking and deposition, or another suitable technique to form the capture sites 46, 46'.

[0167] In other examples of the examples listed herein, the capture sites 46, 46' are chemical capture sites. The chemical capture sites include any example of the chemical capture agents described herein, which can be deposited on or otherwise connected to a predetermined position of a substantially flat surface 64, 64'. In one example, the chemical capture agent can be deposited in a desired position on a substantially flat surface 64, 64', for example, using microcontact printing, aerosol printing, etc., to form capture sites 46, 46'. In another example, a mask (e.g., a photoresist) can be used to define the space / position where the chemical capture agent will be deposited. The chemical capture agent can then be deposited, and the mask can be removed (e.g., by stripping, dissolving or another suitable technique). In this example, the chemical capture agent can form a monolayer or thin layer of chemical capture agent. In yet another example, a polymer grafted with capture nucleic acid can be selectively applied to a substantially flat surface 64, 64' to form a chemical capture site.

[0168] In still other examples listed herein, the capture sites 46, 46' are chemical capture sites. The electrostatic capture sites include any example of an electrostatic capture agent described herein that can be deposited at a predetermined location on a substantially flat surface 64, 64'. For example, chemical vapor deposition, masking and deposition, or another suitable technique can be used to deposit electrode materials to form the capture sites 46, 46'. When electrostatic capture sites are used, the substrate 48A, 48A' can include additional circuitry to address each capture site 46, 46'.

[0169] exist Figure 4A In the example of FIG. 5 , areas of the substantially planar surface 64 , 64 ′ that do not contain capture sites 46 , 46 ′ serve as interstitial areas between the capture sites 46 , 46 ′.

[0170] exist Figure 4B In the example shown, the substrate 48B, 48B' includes recessed portions 58, 58' separated by void regions 68, 68'; and capture sites 46, 46' are positioned above each of the pillars 58, 58'.

[0171] Each post 58, 58' is a three-dimensional structure that extends outward (upward) from an adjacent surface. Thus, the posts 58, 58' are raised areas relative to the void areas 68, 68' surrounding the posts 58, 58'. The posts 58, 58' may be formed in or on the substrate 48B, 48B'. Figure 4B, pillars 58, 58' are formed in substrate 48B, 48B'. When pillars 58, 58' are formed in a "substrate", it is meant that they are patterned (e.g., via etching, photolithography, imprinting, etc.) such that the resulting patterned material 56, 56' includes pillars 58, 58' extending above adjacent surrounding void regions 68, 68'. Alternatively, when pillars 58, 58' are formed on a "substrate", it is meant that additional material may be deposited on a substrate (e.g., a single layer substrate) such that it extends above the underlying substrate.

[0172] The layout or pattern of the columns 58, 58' can be any of the examples listed herein for the capture sites 46, 46'. The layout or pattern of the columns 58, 58' can be characterized relative to the density of the columns 58, 58' in a defined area (e.g., the number of columns 58, 58'). Any of the densities listed for the capture sites 46, 46' can be used for the columns 58, 58'. The layout or pattern of the columns 58, 58' can also be characterized according to the average pitch or spacing (center-to-center spacing) from the center of one column 58, 58' to the center of the adjacent column 58, 58' or from the left edge of one column 58, 58' to the right edge of the adjacent column 58, 58' (edge-to-edge spacing). Any of the average spacings described for the capture sites 46, 46' can be used for the columns 58, 58'.

[0173] While any suitable three-dimensional geometry may be used for posts 58, 58', a geometry having at least a substantially flat top surface may be desirable so that capture sites 46, 46' may be formed thereon. Example post geometries include spheres, cylinders, cubes, polygonal prisms (e.g., rectangular prisms, hexagonal prisms, etc.), and the like.

[0174] The size of each post 58, 58' may be characterized by its top surface area, height, and / or diameter.

[0175] The top surface area of ​​each column 58, 58' can be selected based on the size of the single-stranded aggregated magnetic beads 10 to be anchored to the capture sites 46, 46' supported by the columns 58, 58'. For example, the top surface area of ​​each column 58, 58' can be at least about 1×10 -4 μm 2 , at least about 1×10 -3 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or in addition, the top surface area of ​​each post 58, 58' may be at most about 1×10 4 μm 2, up to about 100μm 2 , up to about 10μm 2 , up to about 1μm 2 , up to about 0.1μm 2 , at most about 1×10 -2 μm 2 The area occupied by each column top surface can be greater than, less than, or in between the values ​​specified above.

[0176] The height of each pillar 58, 58' may depend on the size of the flow channel 50. In one example, the height may be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the height may be at most about 1×10 3 um, up to about 100 μm, up to about 10 μm, or less. In some examples, the depth is about 0.4 μm. The height of each pillar 58, 58' may be greater than, less than, or between the values ​​specified above.

[0177] In some cases, the diameter or length and width of each pillar 58, 58' can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the diameter or length and width can be at most about 1×10 3 In some examples, the diameter or length and width is about 0.4 μm. The diameter or length and width of each pillar 58, 58' may be greater than, less than, or between the values ​​specified above.

[0178] exist Figure 4B In the example shown, capture sites 46, 46' are positioned on each of the pillars 58, 58'. Any of the examples of magnetic, chemical or electrostatic capture sites 46, 46' described herein may be used.

[0179] Magnetic capture sites include any example of magnetic capture agents described herein that may be deposited on the top surface of each post 58, 58'. For example, magnetic material may be deposited using chemical vapor deposition, masking and deposition, or another suitable technique to form capture sites 46, 46'.

[0180] The chemical capture site includes any example of a chemical capture agent described herein, which may be deposited on or otherwise connected to the top surface of each column 58, 58'. In one example, the chemical capture agent may be deposited on each column 58, 58', for example, using microcontact printing, aerosol printing, etc., to form capture sites 46, 46'. In another example, a mask (e.g., a photoresist) may be used to cover the void regions 68, 68' and not cover the columns 58, 58'. The chemical capture agent may then be deposited on the exposed columns 58, 58', and the mask may be removed (e.g., via stripping, dissolution, or another suitable technique). In this example, the chemical capture agent may form a monolayer or thin layer of chemical capture agent on the columns 58, 58'. In yet another example, a polymer grafted with capture nucleic acids may be selectively applied to the top surface of each column 58, 58' to form a chemical capture site.

[0181] Electrostatic capture sites include any of the examples of electrostatic capture agents described herein that may be deposited on the top surface of each pillar 58, 58'. For example, chemical vapor deposition, masking and deposition, or another suitable technique may be used to deposit electrode materials to form capture sites 46, 46'. When electrostatic capture sites are used, substrates 48B, 48B' may include additional circuitry to address individual capture sites 46, 46'.

[0182] exist Figure 4C In the example shown, the substrate 48C, 48C' includes recessed portions 60, 60' separated by void regions 68, 68'; and a capture site 46, 46' is positioned in each of the recessed portions 60, 60'.

[0183] Each recessed portion 60, 60' is a three-dimensional structure extending inward (downward) from an adjacent surface. Therefore, the recessed portion 60, 60' is a recessed area relative to the void area 68, 68' surrounding the recessed portion 60, 60'. The recessed portion 60, 60' can be formed in the base 48C, 48C'. Figure 4C In the example shown, the material is patterned (eg, via etching, photolithography, embossing, etc.) recesses 60, 60' separated by void regions 68, 68' extending over and around each recess 60, 60'. This material is another example of a patterned material 56, 56'.

[0184] The layout or pattern of the recesses 60, 60' can be any of the examples listed herein for the capture sites 46, 46'. The layout or pattern of the recesses 60, 60' can be characterized relative to the density of the recesses 60, 60' in a defined area (e.g., the number of recesses 60, 60'). Any of the densities listed for the capture sites 46, 46' can be used for the recesses 60, 60'. The layout or pattern of the recesses 60, 60' can also be characterized according to the average pitch or spacing from the center of one recess 60, 60' to the center of an adjacent recess 60, 60' (center-to-center spacing) or the average pitch or spacing from the left edge of one recess 60, 60' to the right edge of an adjacent recess 60, 60' (edge-to-edge spacing). Any of the average spacings described for the capture sites 46, 46' can be used for the recesses 60, 60'.

[0185] While any suitable three-dimensional geometry may be used for the recess 60, 60', a geometry having at least a substantially flat bottom surface may be desirable so that the capture sites 46, 46' may be formed thereon. Example recess geometries include spheres, cylinders, cubes, polygonal prisms (e.g., rectangular prisms, hexagonal prisms, etc.), and the like.

[0186] The size of each recess 60 , 60 ′ may be characterized by its volume, open area, depth, and / or diameter.

[0187] Each recess 60, 60' may have any volume that is capable of receiving the material of the capture site 46, 46'. For example, the volume may be at least about 1 x 10 -3 μm 3 , at least about 1×10 -2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 Alternatively or in addition, the volume may be at most about 1×10 4 μm 3 , at most about 1×10 3 μm 3 , up to about 100μm 3 , up to about 10μm 3 , up to about 1μm 3 , up to about 0.1μm 3 or smaller.

[0188] The area occupied by each recess opening can be selected based on the size of the single-stranded aggregated magnetic beads 10 to be anchored by the capture sites 46, 46'. It may be desirable for the single-stranded aggregated magnetic beads 10 to enter the recesses 60, 60', and thus the area occupied by the recess opening can be larger than the size of the single-stranded aggregated magnetic beads 10. For example, the area of ​​each recess opening can be at least about 1×10 -3 μm 2 , at least about 1×10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or in addition, the area may be at most about 1×10 3 μm 2 , up to about 100μm 2 , up to about 10μm 2 , up to about 1μm 2 , up to about 0.1μm 2 , at most about 1×10 -2 μm 2 The area occupied by each recess opening may be greater than, less than, or in between the values ​​specified above.

[0189] The depth of each recess 60, 60' is large enough to accommodate at least the capture sites 46, 46'. In one example, the recesses 60, 60' may be filled with capture sites 46, 46'. In this example, the single-stranded aggregated magnetic beads 10 are anchored to the capture sites 46, 46' but do not enter the recesses 60, 60'. In another example, the recesses 60, 60' may be partially filled with capture sites 46, 46'. In this example, the single-stranded aggregated magnetic beads 10 at least partially enter the recesses 60, 60' and are anchored to the capture sites 46, 46' in the recesses 60, 60'. In one example, the depth may be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the depth may be at most about 1×10 3 um, at most about 100 μm, at most about 10 μm or less. In some examples, the depth is about 0.4 μm. The depth of each recess 60, 60' may be greater than, less than, or between the values ​​specified above.

[0190] In some cases, the diameter or length and width of each recess 60, 60' can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or in addition, the diameter or length and width can be at most about 1×10 3 In some examples, the diameter or length and width is about 0.4 μm. The diameter or length and width of each recess 60, 60' can be greater than, less than, or between the values ​​specified above.

[0191] exist Figure 4C In the example shown, capture sites 46, 46' are positioned in each of the recesses 60, 60'.

[0192] In one example, the magnetic capture sites 46, 46' include any of the examples of magnetic capture agents listed herein that can be deposited on the bottom surface of each recess 60, 60'. For example, magnetic material can be deposited using chemical vapor deposition, masking and deposition, or another suitable technique to form the capture sites 46, 46'.

[0193] In another example, the capture site 46, 46' includes any example of a chemical capture agent listed herein, which can be deposited on or otherwise attached to the bottom surface of each recessed portion 60, 60'. In one example, the chemical capture agent can be deposited on each recessed portion 60, 60', for example, using microcontact printing, aerosol printing, etc., to form the capture site 46, 46'. In another example, a mask (e.g., a photoresist) can be used to cover the gap area 68, 68', and the recessed portion 60, 60' is not covered. The chemical capture agent can then be deposited in the exposed recessed portion 60, 60', and the mask can be removed (e.g., via stripping, dissolution or another suitable technique). In this example, the chemical capture agent can form a monolayer or thin layer of chemical capture agent in the recessed portion 60, 60'. In yet another example, a polymer grafted with capture nucleic acid can be selectively applied to the bottom surface of each recessed portion 60, 60'.

[0194] In yet another example, the magnetic capture sites 46, 46' include any of the examples listed herein that may be deposited on the bottom surface of each recess 60, 60'. For example, the electrode material may be deposited using chemical vapor deposition, masking and deposition, or another suitable technique to form the capture sites 46, 46'. When electrostatic capture sites are used, the substrate 48C, 48C' may include additional circuitry to address the individual capture sites 46, 46'.

[0195] Although Figure 4A , Figure 4B and Figure 4C The example architecture shown in depicts single-stranded aggregated magnetic beads 10 anchored at capture sites 46, 46', but it is understood that the flow cell 44 does not include single-stranded aggregated magnetic beads 10 until they are introduced therein, such as during sequencing.

[0196] Another example of a flow cell architecture is Figure 4D This example depicts a flow cell 44 ′ integrated with a complementary metal oxide semiconductor (CMOS) chip 70 .

[0197] In this example flow cell 44', substrate 48D is positioned over CMOS chip 70. Substrate 48D is similar to substrate 48A, except that it includes a plurality of recesses 60 defined therein and separated by void regions 68. Capture sites 46 are positioned on the bottom surface of each of the plurality of recesses 60.

[0198] In this example, substrate 48D can be a passivation layer. Using a passivation layer as substrate 48D, substrate 48D can provide primary corrosion protection for the embedded metal layer 78 of the CMOS chip 70 closest to substrate 48D. In this example, substrate 48D can include a passivation material that is transparent to light emission (e.g., visible light) generated by the reaction at the capture site 46 and at least initially resists the fluid environment and moisture that may be introduced or present in the flow channel 50. The "at least initially resistant material" acts as an etching barrier and moisture barrier for high pH reagents (e.g., pH in the range of 8 to 14). Examples of suitable passivation materials for substrate 48D include silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5), hafnium oxide (HfO2), boron-doped p+ silicon, etc. The thickness of substrate 48D is in the range of about 100nm to about 500nm.

[0199] As mentioned, at least a portion of the substrate 48D (i.e., the passivation layer) is in contact with the first embedded metal layer 78 of the CMOS chip 70, and is also in contact with the input region 80 of the optical waveguide 76. The contact between the substrate 48D and the first embedded metal layer 78 may be direct contact, or may be indirect contact through the shielding layer 82.

[0200] In the illustrated example, substrate 48D may be directly attached to, and thus in physical contact with, CMOS chip 70 via one or more fixing mechanisms (eg, adhesives, keys, fasteners, etc.) It should be understood that substrate 48D may be removably coupled to CMOS chip 70 .

[0201] The CMOS chip 70 includes a plurality of stacked layers 72, including, for example, a silicon layer, a dielectric layer, a metal-dielectric layer, a metal layer, etc. The stacked layers 72 constitute device circuits including a detection circuit.

[0202] The CMOS chip 70 includes optical components, such as optical sensors 74 and optical waveguides 76. The optical components are arranged so that each optical sensor 74 is at least substantially aligned with a single optical waveguide 76 and a single reaction site (i.e., each position forming a capture site 46) of the flow cell 44', and is therefore operatively associated therewith. However, in other examples, a single optical sensor 74 may receive photons through more than one optical waveguide 76 and / or from more than one reaction site. In these other examples, a single optical sensor 74 is operatively associated with more than one optical waveguide 76 and / or more than one reaction site.

[0203] As used herein, a single optical sensor 74 may be a light sensor including one pixel or more than one pixel. For example, each optical sensor 74 may have a resolution of less than about 50 μm. 2 For example, the detection area may be less than about 10 μm 2 As yet another example, the detection area may be less than about 2 μm 2 In the latter example, the optical sensor 74 may constitute a single pixel. The average read noise per pixel of the optical sensor 74 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor 98 may be greater than about 0.5 megapixels (Mpixel). In other examples, the resolution may be greater than about 5 Mpixel or greater than about 10 Mpixel.

[0204] In addition, as used herein, a single optical waveguide 76 may be an optical waveguide comprising a solidified filter material that i) filters the excitation light 84 (propagating from the outside of the flow cell 44' into the flow channel 50) and ii) allows light emission (not shown, generated by the reaction at the reaction site) to propagate through it toward the corresponding optical sensor 74. In one example, the optical waveguide 76 may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter the excitation light 84 of about 532nm wavelength and allow light emission of about 570nm or more wavelength. The optical waveguide 76 may be formed by first forming a guide cavity in the dielectric layer 86 and then filling the guide cavity with a suitable filter material.

[0205] The optical waveguide 76 can be configured relative to the dielectric material 86 to form a light-guiding structure. For example, the optical waveguide 76 can have a refractive index of about 2.0 so that light emission is substantially reflected at the interface between the optical waveguide 76 and the surrounding dielectric material 86. In some examples, the optical waveguide 76 is selected so that the optical density (OD) or absorptivity of the excitation light 84 is at least about 4 OD. More specifically, the filter material can be selected and the size of the optical waveguide 76 can be set to achieve at least 4 OD. In other examples, the optical waveguide 76 can be configured to achieve at least about 5 OD or at least about 6 OD.

[0206] The flow cell 44' also includes a cover 52 that is operably connected to the substrate 48D to partially define a flow channel 50 between the substrate 48D (and the reaction sites therein or thereon) and the cover 52. The cover 52 can be any material that is transparent to the excitation light 84 directed toward the reaction sites. As an example, the cover 52 can include glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable plastic materials (i.e., cycloolefin polymers) are available from Zeon Chemicals L.P. product.

[0207] Cover 52 can be physically connected to substrate 48D by material 62. Material 62 is coupled to a portion of the surface of substrate 48D and extends between the surface and the inner surface of cover 52. In some examples, material 62 and cover 52 can be integrally formed so that they 62, 52 are continuous sheets of material (e.g., glass or plastic). In other examples, material 62 and cover 52 can be separate components coupled to each other. In these other examples, material 62 can be the same material as cover 52, or a different material. As an example, material 62 can include a curable adhesive layer that bonds cover 52 to substrate 48D (at a portion of its surface).

[0208] In one example, the cover 52 can be a generally rectangular block having at least a generally flat outer surface 88 and at least a generally flat inner surface 90 that defines a portion of the flow channel 50. The block can be mounted to the material 62. Alternatively, the block can be etched to define the inner surface 90 and the sidewalls that are mounted to the material 62. For example, a groove can be etched into a transparent block. When the etched block is mounted to the substrate 48D, the groove can become at least a portion of the flow channel 50.

[0209] The cover 52 may include inlet and outlet ports 92, 94 configured to fluidly engage other ports (not shown) for directing fluid into the flow channel 50 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 50 (e.g., to a waste removal system).

[0210] The size and shape of the flow channel 50 can be set to guide the fluid along the reaction site. The height of the flow channel 50 and other dimensions of the flow channel 50 can be configured to maintain a substantially uniform flow of the fluid along the reaction site. The size of the flow channel 50 can also be configured to control bubble formation. In one example, the height of the flow channel 50 can be in the range of about 50 μm to about 400 μm. In another example, the height of the flow channel 50 can be in the range of about 80 μm to about 200 μm. It should be understood that the height of the flow channel 50 can vary, and when the reaction site is located in a reaction chamber (e.g., a recessed portion 60) defined in the surface of the substrate 48D, the height can be maximum. In these examples, the recessed portion 60 increases the height of the flow channel 50 at this specific area.

[0211] Each reaction site is a localized area in substrate 48D where capture sites 46 are located and where a specified reaction involving single-stranded aggregated magnetic beads 10 can occur. In the example shown, each reaction site is a recess 60 having a capture site 46 therein.

[0212] In one example, the reaction sites are at least substantially aligned with the input region 80 of a single optical waveguide 76. As such, light emissions at the reaction sites can be guided through the waveguide 76 into the input region 80 and to the associated optical sensor 74. In other examples, one reaction site 102 can be aligned with several input regions 110 of several optical waveguides 100. In other examples, several reaction sites 102 can be aligned with one input region 110 of one optical waveguide 76.

[0213] The embedded metal layer 78 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCu), tungsten (W), nickel (Ni), or copper (Cu). The embedded metal layer 78 is a functional part of the CMOS AVdd line and is also electrically connected to the optical sensor 74 through the stacked layer 72. Thus, the embedded metal layer 78 participates in the detection / sensing operation.

[0214] It should be understood that other optical sensors 74 and associated components may be configured in the same or similar manner. However, it should also be understood that the CMOS chip 70 may not be manufactured identically or consistently. Instead, one or more optical sensors 74 and / or associated components may be manufactured differently or have a different relationship with respect to each other.

[0215] The stacked layers 72 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) that may conduct electrical current. The circuit may be configured to selectively send data signals based on the detected photons. The circuit may also be configured for signal amplification, digitization, storage, and / or processing. The circuit may collect and analyze the detected light emissions and generate data signals for transmitting the detection data to a bioassay system. The circuit may also perform additional analog and / or digital signal processing in the CMOS chip 70.

[0216] CMOS chip 70 may be manufactured using integrated circuit manufacturing processes. CMOS chip 70 may include multiple layers, such as sensor base / layer 56 (e.g., silicon layer or wafer). The sensor base may include optical sensor 74. When CMOS chip 70 is fully formed, optical sensor 74 may be electrically coupled to the rest of the circuitry in stacked layers 72 through gates, transistors, etc.

[0217] As reference Figure 4D As used herein, the term "layer" is not limited to a single continuous body of material unless otherwise indicated. For example, the sensor base / layer may include multiple sub-layers having different materials and / or may include coatings, adhesives, etc. In addition, one or more of the layers (or sub-layers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.

[0218] The stack 72 96 also includes a plurality of metal dielectric layers. Each of these layers includes a metal element (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and a dielectric material 86 (e.g., SiO2). A variety of metal elements M1-M5 and dielectric materials 86 may be used, such as those suitable for integrated circuit manufacturing.

[0219] exist Figure 4D In the example shown, each of the multiple metal-dielectric layers L1-L6 includes metal elements M1, M2, M3, M4, M5 and dielectric material 86. In each layer of layer L1-L6, metal elements M1, M2, M3, M4, M5 are interconnected and embedded in dielectric material 86. In some of the metal-dielectric layers L1-L6, additional metal elements may also be included. Some of these additional metal elements may be used to address individual pixels through row and column selectors. The voltage at these elements may vary and switch between about -1.4V and about 4.4V depending on the pixel being read out by the device.

[0220] Metal components M1, M2, M3, M4, M5 and Figure 4DThe configuration of dielectric layer 86 in is an exemplary circuit, and it should be understood that other examples may include fewer or additional layers and / or may have different configurations of metal elements M1-M5.

[0221] exist Figure 4D In the example shown, the shielding layer 82 contacts at least a portion of the substrate 48D. The shielding layer 82 has an aperture at least partially adjacent to the input region 80 of the optical waveguide 76. The aperture enables the reaction site (and at least some of the light emissions therefrom) to be optically connected to the waveguide 76. It should be understood that the shielding layer 82 can have an aperture at least partially adjacent to the input region 80 of each optical waveguide 76. The shielding layer 82 can extend continuously between adjacent apertures.

[0222] The shielding layer 82 may include any material that can block, reflect and / or significantly attenuate an optical signal propagating through the flow channel 50. The optical signal may be excitation light 84 and / or light emission from a reaction site. For example, the shielding layer 82 may be tungsten (W).

[0223] It should be understood that the flow cell 44' may also be used for optical detection.

[0224] Enrichment kit

[0225] The beads 16, 26 and the primer solution comprising the 5'-labeled second primer 34 can be included in an enrichment kit. An example of a kit includes magnetic beads 16 functionalized with a first oligonucleotide primer 18 of a primer set; a primer solution comprising a liquid carrier and a 5'-labeled second oligonucleotide primer 34 of a primer set, wherein the 5'-label 40 of the 5'-labeled second oligonucleotide primer 34 is a first member of a binding pair; and a non-magnetic bead 60 comprising a coating 28 of a second member of the binding pair and having a diameter at least ten times that of each of the plurality of magnetic beads 16.

[0226] Any example of the functionalized magnetic beads 16 and the coated non-magnetic beads 26 can be used in the enrichment kit. In one example of the enrichment kit, each of the plurality of magnetic beads 16 has a diameter in the range of about 100 nm to about 1000 nm; and each of the plurality of coated non-magnetic beads 26 has a diameter in the range of about 100 nm to about 10 μm.

[0227] The functionalized magnetic beads 16 can be suspended in a suitable liquid carrier, or can be lyophilized and resuspended in a liquid carrier before use. Some examples of enrichment kits also include a flow cell 44, 44', which includes a plurality of recesses 60, 60', each of which is configured to receive one of the plurality of magnetic beads 16 (e.g., after aggregation outside the flow cell 44, 44').

[0228] Methods for using single-stranded aggregated magnetic beads

[0229] After forming the single-stranded aggregated magnetic beads 10, they can be introduced into the circulation pool 44, 44' as described herein. At least some of the single-stranded aggregated magnetic beads 10 will be magnetically attached to at least some of the capture sites 46, 46', respectively. The suspension containing the beads 10 can be allowed to incubate for a predetermined time to allow the single-stranded aggregated magnetic beads 10 to be anchored. When using electrostatic capture sites 22A, 22B, 22C, each site 22A, 22B, 22C can be electrically addressed to move the functionalized plasma nanostructures 10, 10' toward each capture site 22A, 22B, 22C. In this example, the functionalized plasma nanostructures 10, 10' may include reversibly charged functional groups that can be converted from neutral substances to charged substances at a suitable pH. Charged substances can be generated by adjusting the pH and then attracted to electrostatic capture sites 22A, 22B, 22C that are individually or globally addressed.

[0230] A wash cycle may be performed to remove any unanchored functionalized single-stranded aggregated magnetic beads 10 .

[0231] Sequencing primers may then be introduced into the flow cell 44, 44'. The sequencing primers hybridize to complementary portions of the sequence of the amplicons 22 that are attached to the single-stranded aggregated magnetic beads 10. These sequencing primers prepare the amplicons 22 for sequencing.

[0232] Then, the incorporation mixture containing the labeled nucleotides can be introduced into the circulation pool 44, 44', for example, via the input port 92. In addition to the labeled nucleotides, the incorporation mixture can also include water, a buffer and a polymerase capable of incorporating nucleotides. When the incorporation mixture is introduced into the circulation pool 44, 44', the mixture enters the flow channel 40 and contacts the anchored single-stranded aggregated magnetic beads 10.

[0233] The incorporation mixture is allowed to incubate in the flow cell 44, 44', and the labeled nucleotides (including optical labels) are incorporated into the nascent chain along the amplicon 22 on each single-stranded aggregated magnetic bead 10 by the corresponding polymerase. During incorporation, one of the labeled nucleotides is incorporated into a nascent chain by the corresponding polymerase, and the nascent chain extends a sequencing primer and is complementary to one of the template chains. Incorporation is performed in a template chain-dependent manner, and thus the detection of the order and type of labeled nucleotides added to the nascent chain can be used to determine the sequence of the amplicon 22. During a single sequencing cycle, incorporation occurs in at least some of the amplicon 22 across the single-stranded aggregated magnetic beads 10.

[0234] Due to the presence of the 3'OH capping group, the incorporated labeled nucleotides may include a reversible termination property that terminates further sequencing primer extension once the labeled nucleotides are added. After the incubation and incorporation required time, the incorporation mixture including the unincorporated labeled nucleotides may be removed from the flow cell 44, 44' during a wash cycle. The wash cycle may include a flow-through technique in which a wash solution (e.g., a buffer) is directed into, then through, and then out of the flow channel 50 (e.g., by a pump or other suitable mechanism).

[0235] Without further incorporation, the most recently incorporated labeled nucleotides can be detected by an imaging event or an electrical signal generated in response to an imaging event. During an imaging event, the illumination system can provide excitation light 84 to the flow cell 44, 44'. The optical labels of the incorporated labeled nucleotides emit light signals in response to the excitation light. These signals can be detected optically or electronically (e.g., using the flow cell 44').

[0236] After imaging and detection, the cleavage mixture can then be introduced into the flow cell 44, 44'. In one example, the cleavage mixture can i) remove the 3'OH capping group from the incorporated nucleotide, and ii) cleave the optical label from the incorporated nucleotide. Examples of 3'OH blocking groups and suitable deblocking agents / components in the cleavage mixture may include: ester moieties that can be removed by alkaline hydrolysis; allyl moieties that can be removed by Nal, trimethylsilyl chloride and Na2S2O3 or by acetone / water solution of Hg(II); azidomethyl groups that can be cleaved by phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP); acetals that can be cleaved by acidic conditions, such as tert-butoxy-ethoxy; MOM (—CH2OCH3) moieties that can be cleaved by LiBF4 and CH3CN / H2O; 2,4-dinitrobenzenesulfenyl groups that can be cleaved by nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ethers that can be cleaved by Ag(I) or Hg(II); and 3' phosphates that can be cleaved by phosphatases (e.g., polynucleotide kinases). Examples of suitable optical labeling cleaving agents / components in the cleavage mixture may include: sodium periodate, which can cleave vicinal diols; phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP), which can cleave azidomethyl bonds; palladium and THP, which can cleave allyl groups; bases, which can cleave ester moieties; or any other suitable cleaving agent.

[0237] Additional sequencing cycles may then be performed until amplicon 22 is sequenced.

[0238] In order to further illustrate the present disclosure, examples are given herein. It should be understood that the examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

[0239] Non-limiting working examples

[0240] 250 nm magnetic beads were coated with PAZAM, and P7 primers were grafted to PAZAM. Functionalized magnetic beads were suspended in high salt buffer at 0.1 mg / mL to form a suspension.

[0241] Prepare DNA library template. The library template is diluted from 10nM to 100pM in a low ionic strength salt buffer and kept at 95°C for about 5 minutes in a thermomixer with shaking at 1500rpm. After about 5 minutes, the library template is refrigerated at 4°C until they are mixed into a suspension containing functionalized magnetic beads at a ratio of 4:1 beads:library template. The suspension is vortexed and kept at 40°C for about 30 minutes in a thermomixer with shaking at 1150rpm. During this process, the library template is inoculated into the functionalized magnetic beads. The inoculated functionalized magnetic beads are washed with a buffer solution.

[0242] First strand extension was then performed by suspending the seeded functionalized magnetic beads in an enzyme mix (including native nucleotides, polymerase and buffer) and introducing the suspension into a thermomixer at 60°C with shaking at 1150 rpm for about 10 minutes.

[0243] The chain-extended functionalized beads were divided into 4 samples.

[0244] The PEG-free aggregation mixture (containing the modified polymerase) was added to 2 samples of the samples containing chain-extended functionalized magnetic beads (referred to herein as example samples). Biotinylated 10-mer truncated P5' primers were added to the example samples. These primers have the complementary sequence of P5, with 10 nucleotides removed from the 5' end and replaced with biotin. The example samples were kept at 38°C for 30 minutes or 60 minutes on a thermomixer with shaking at 1150 rpm. This allowed chain invasion amplification to occur.

[0245] For comparison, the aggregation mixture without PEG was added to 2 of the other samples (referred to herein as comparative samples) containing chain-extended functionalized magnetic beads. P5' primers were added to the comparative samples. These primers had complementary sequences to P5, with no biotin added. The comparative samples were kept on a thermomixer at 38°C for 30 minutes or 60 minutes, respectively, with shaking at 1150 rpm. This allowed chain invasion amplification to occur.

[0246] qPCR (quantitative polymerase chain reaction) was used to determine the DNA content on the magnetic beads in each example and comparative example sample, and the results are shown in Figure 5As depicted, the aggregation efficiency is similar for the example and comparative samples, indicating that the biotinylated 10-mer truncated P5' primer is effective for aggregating the library template on the magnetic bead surface.

[0247] Three additional example samples were prepared as described in this example.

[0248] One of the additional sample samples was used as a control. qPCR (quantitative polymerase chain reaction) was used to determine the DNA content on the magnetic beads of the control sample, and the results are shown in Figure 7 middle.

[0249] To the other two additional sample samples (of aggregated magnetic beads), streptavidin-coated silica beads (5 μm) were added at 0.1 mg / mL and allowed to incubate at room temperature (about 18° C.) for about 16 hours with shaking at 1150 rpm on a thermomixer. After one hour of incubation, a sample of one of the additional sample samples was collected and imaged using a scanning electron microscope (SEM). The SEM image is shown in Figure 6 As depicted, the biotinylated aggregated magnetic beads have begun to attach to the streptavidin-coated silica beads even after only one hour of incubation.

[0250] The bead-on-bead complexes from the other two additional example samples were washed with a buffer solution and exposed to a 0.1M NaOH solution, respectively, to dehybridize the double-stranded amplicons of the aggregated magnetic beads and dissolve some streptavidin-coated silica beads. The bead-on-bead complexes in one of the additional example samples (Example 1) were allowed to incubate in a 0.1M NaOH solution at room temperature for about 5 minutes, and the bead-on-bead complexes in another of the additional example samples (Example 2) were allowed to incubate in a 0.1M NaOH solution at 37°C for about 5 minutes.

[0251] qPCR (quantitative polymerase chain reaction) was used to determine the DNA content on the magnetic beads of each of Examples 1 and 2, and the results are shown in Figure 7 In. Figure 7 As shown, after dehybridization, the single-stranded DNA remains intact on the magnetic beads.

[0252] Terms

[0253] Clause 1. An enrichment method, comprising:

[0254] generating a mixture of aggregated magnetic beads and non-aggregated magnetic beads from a plurality of magnetic beads that are i) functionalized with a first primer of a primer set and ii) contained in a suspension, each of the aggregated magnetic beads comprising a first amplicon attached to the first primer and a 5'-tagged second amplicon hybridized to the first amplicon, wherein the 5'-tag of the 5'-tagged second amplicon is a first member of a binding pair;

[0255] introducing a plurality of coated non-magnetic beads into the suspension, each of the plurality of coated non-magnetic beads comprising a coating of the second member of the binding pair and having a diameter at least ten times greater than each of the plurality of magnetic beads, whereby the aggregated magnetic beads bind to at least some of the plurality of coated non-magnetic beads to form bead-on-bead complexes, and the non-aggregated magnetic beads remain free in the suspension;

[0256] separating the non-aggregated magnetic beads from the suspension containing the bead-on-bead complexes;

[0257] Dehybridizing the 5'-labeled second amplicon from the first amplicon to generate single-stranded aggregated magnetic beads; and

[0258] The single-stranded aggregated magnetic beads are separated from the suspension.

[0259] Clause 2. The enrichment method according to clause 1, wherein generating the mixture of aggregated magnetic beads and non-aggregated magnetic beads from the plurality of magnetic beads in the suspension comprises:

[0260] Introducing a plurality of library templates into the suspension at a magnetic bead:library template ratio of at least 4:1, whereby some of the plurality of library templates are respectively hybridized with first primers of some of the plurality of magnetic beads, and some other of the plurality of magnetic beads remain unseeded;

[0261] Initiating a first primer extension reaction to generate the first amplicon; and initiating strand invasion amplification on the some of the plurality of magnetic beads by introducing a 5'-labeled second primer of the primer set to the plurality of magnetic beads.

[0262] Item 3. An enrichment method according to any one of Items 1 or 2, wherein the plurality of coated non-magnetic beads are added to the suspension at a ratio of magnetic beads:coated non-magnetic beads in the range of greater than 1:1 to 300:1.

[0263] Item 4. An enrichment method according to any one of items 1 to 3, wherein dehybridization of the 5'-labeled second amplicon from the first amplicon comprises introducing an alkaline solution into the suspension, wherein the alkaline solution denatures the 5'-labeled second amplicon from the first amplicon and dissolves at least a portion of the plurality of coated non-magnetic beads.

[0264] Clause 5. The enrichment method according to Clause 4, wherein the alkaline solution is an aqueous sodium hydroxide solution.

[0265] Clause 6. The enrichment method according to Clause 4, wherein the suspension and the alkaline solution are incubated at a temperature in the range of about 18°C ​​to about 22°C for a time in the range of about 3 minutes to about 10 minutes.

[0266] Clause 7. The enrichment method according to any one of clauses 1 to 3, wherein dehybridization of the 5'-labeled second amplicon from the first amplicon comprises introducing formamide into the suspension.

[0267] Clause 8. The enrichment method according to Clause 7, wherein the suspension and the formamide are incubated at a temperature in the range of about 55°C to about 65°C for a time in the range of about 15 minutes to about 30 minutes.

[0268] Item 9. An enrichment method according to any one of items 1 to 8, wherein the plurality of coated non-magnetic beads are introduced into the suspension in a buffer comprising about 0.1% active (w / v) to about 0.5% active (w / v) non-ionic surfactant.

[0269] Item 10. The enrichment method according to any one of items 1 to 9, further comprising incubating the plurality of coated non-magnetic beads and the suspension for up to 24 hours before filtering out the non-aggregated magnetic beads from the suspension containing the bead-on-bead complexes.

[0270] Clause 11. The enrichment method according to any one of clauses 1 to 10, wherein the coated non-magnetic beads are coated silica beads.

[0271] Item 12. An enrichment method according to any one of Items 1 to 11, the enrichment method further comprising introducing the single-stranded aggregated magnetic beads into a circulation pool comprising a plurality of recessed portions, each of the plurality of recessed portions being configured to receive one of the single-stranded aggregated magnetic beads.

[0272] Clause 13. The enrichment method according to any one of clauses 1 to 12, wherein:

[0273] The first member of the binding pair is biotin and the second member of the binding pair is streptavidin; or

[0274] The first member of the binding pair is a NiNTA (nickel-nitrilotriacetic acid) ligand and the second member of the binding pair is a histidine tag; or

[0275] The first member and the second member of the binding pair are complementary DNA strands capable of hybridizing to each other; or

[0276] The first member and the second member of the binding pair are functional groups capable of forming a disulfide bond; or

[0277] The first member and the second member of the binding pair are functional groups capable of forming an imine.

[0278] Clause 14. An enrichment kit, comprising:

[0279] magnetic beads functionalized with a first oligonucleotide primer of a primer set;

[0280] a primer solution comprising a liquid carrier and a 5'-labeled second oligonucleotide primer of the primer set, wherein the 5'-label of the 5'-labeled second oligonucleotide primer is a first member of a binding pair; and

[0281] A non-magnetic bead comprises a coating of the second member of the binding pair and has a diameter at least ten times greater than each magnetic bead of the plurality of magnetic beads.

[0282] Clause 15. The enrichment kit according to clause 14, wherein:

[0283] Each magnetic bead of the plurality of magnetic beads has a diameter in a range of about 100 nm to about 1000 nm; and

[0284] The diameter of each coated non-magnetic bead of the plurality of coated non-magnetic beads is in a range from about 100 nm to about 10 μm.

[0285] Clause 16. The enrichment kit according to any one of clauses 14 or 15, further comprising a flow cell comprising a plurality of recesses, each of the plurality of recesses being configured to receive one of the plurality of magnetic beads.

[0286] Clause 17. An enrichment kit according to any one of clauses 14 to 16, wherein:

[0287] A surface of each of the magnetic beads has a polymer hydrogel coating applied thereon; and

[0288] The first oligonucleotide primer is attached to the polymer hydrogel.

[0289] Clause 18. An enrichment kit according to any one of clauses 14 to 17, wherein:

[0290] The first member of the binding pair is biotin and the second member of the binding pair is streptavidin; or

[0291] The first member of the binding pair is a NiNTA (nickel-nitrilotriacetic acid) ligand and the second member of the binding pair is a histidine tag; or

[0292] The first member and the second member of the binding pair are complementary DNA strands capable of hybridizing to each other; or

[0293] The first member and the second member of the binding pair are functional groups capable of forming a disulfide bond; or

[0294] The first member and the second member of the binding pair are functional groups capable of forming an imine.

[0295] Additional Notes

[0296] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0297] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0298] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 2 mm to about 300 mm should be interpreted as including not only the explicitly listed limits of about 2 mm to about 300 mm, but also single values ​​such as about 40 mm, about 250.5 mm, etc., and sub-ranges such as about 25 mm to about 175 mm, etc.

[0299] Furthermore, when "about" and / or "substantially" are used to describe values, they are intended to encompass minor variations (up to + / - 10%) from the specified value.

[0300] While several examples have been described in detail, it should be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. An enrichment method, comprising: generating a mixture of aggregated magnetic beads and non-aggregated magnetic beads from a plurality of magnetic beads that are i) functionalized with a first primer of a primer set and ii) contained in a suspension, each of the aggregated magnetic beads comprising a first amplicon attached to the first primer and a 5'-tagged second amplicon hybridized to the first amplicon, wherein the 5'-tag of the 5'-tagged second amplicon is a first member of a binding pair; introducing a plurality of coated non-magnetic beads into the suspension, each of the plurality of coated non-magnetic beads comprising a coating of the second member of the binding pair and having a diameter at least ten times greater than each of the plurality of magnetic beads, whereby the aggregated magnetic beads bind to at least some of the plurality of coated non-magnetic beads to form bead-on-bead complexes, and the non-aggregated magnetic beads remain free in the suspension; separating the non-aggregated magnetic beads from the suspension containing the bead-on-bead complexes; Dehybridizing the 5'-labeled second amplicon from the first amplicon to generate single-stranded aggregated magnetic beads; as well as The single-stranded aggregated magnetic beads are separated from the suspension.

2. The enrichment method according to claim 1, wherein generating the mixture of aggregated magnetic beads and non-aggregated magnetic beads from the plurality of magnetic beads in the suspension comprises: Introducing a plurality of library templates into the suspension at a magnetic bead:library template ratio of at least 4:1, whereby some of the plurality of library templates are respectively hybridized with first primers of some of the plurality of magnetic beads, and some other of the plurality of magnetic beads remain unseeded; Initiating a first primer extension reaction to generate the first amplicon; as well as By introducing a 5'-labeled second primer of the primer set into the plurality of magnetic beads, strand invasion amplification is initiated on the some of the plurality of magnetic beads.

3. The enrichment method of claim 1, wherein the plurality of coated non-magnetic beads are added to the suspension at a ratio of magnetic beads: coated non-magnetic beads in a range of greater than 1:1 to 300:

1.

4. The enrichment method of claim 1, wherein dehybridizing the 5'-labeled second amplicon from the first amplicon comprises introducing an alkaline solution into the suspension, wherein the alkaline solution denatures the 5'-labeled second amplicon from the first amplicon and dissolves at least a portion of the plurality of coated non-magnetic beads.

5. The enrichment method according to claim 4, wherein the alkaline solution is an aqueous sodium hydroxide solution.

6. The enrichment method according to claim 4, wherein the suspension and the alkaline solution are incubated at a temperature in the range of about 18°C ​​to about 22°C for a time in the range of about 3 minutes to about 10 minutes.

7. The enrichment method of claim 1, wherein dehybridizing the 5'-labeled second amplicon from the first amplicon comprises introducing formamide into the suspension.

8. The enrichment method of claim 7, wherein the suspension and the formamide are incubated at a temperature in the range of about 55°C to about 65°C for a time in the range of about 15 minutes to about 30 minutes.

9. The enrichment method of claim 1, wherein the plurality of coated non-magnetic beads are introduced into the suspension in a buffer comprising about 0.1% active (w / v) to about 0.5% active (w / v) non-ionic surfactant.

10. The enrichment method of claim 1, further comprising incubating the plurality of coated non-magnetic beads with the suspension for up to 24 hours before filtering out the non-aggregated magnetic beads from the suspension containing the bead-on-bead complexes.

11. The enrichment method of claim 1, wherein the coated non-magnetic beads are coated silica beads.

12. The enrichment method according to claim 1 further comprises introducing the single-stranded aggregated magnetic beads into a circulation pool comprising a plurality of recessed portions, each of the plurality of recessed portions being configured to receive one of the single-stranded aggregated magnetic beads.

13. The enrichment method according to claim 1, wherein: The first member of the binding pair is biotin and the second member of the binding pair is streptavidin; or The first member of the binding pair is a NiNTA (nickel-nitrilotriacetic acid) ligand and the second member of the binding pair is a histidine tag; or The first member and the second member of the binding pair are complementary DNA strands capable of hybridizing to each other; or The first member and the second member of the binding pair are functional groups capable of forming a disulfide bond; or The first member and the second member of the binding pair are functional groups capable of forming an imine.

14. An enrichment kit, comprising: magnetic beads functionalized with a first oligonucleotide primer of a primer set; a primer solution comprising a liquid carrier and a 5'-labeled second oligonucleotide primer of the primer set, wherein the 5'-label of the 5'-labeled second oligonucleotide primer is a first member of a binding pair; as well as A non-magnetic bead comprises a coating of the second member of the binding pair and has a diameter at least ten times greater than each magnetic bead of the plurality of magnetic beads.

15. The enrichment kit according to claim 14, wherein: Each magnetic bead of the plurality of magnetic beads has a diameter in a range of about 100 nm to about 1000 nm; and The diameter of each coated non-magnetic bead of the plurality of coated non-magnetic beads is in a range from about 100 nm to about 10 μm. 16 . The enrichment kit according to claim 14 , further comprising a flow cell comprising a plurality of recesses, each of the plurality of recesses being configured to receive one of the plurality of magnetic beads.

17. The enrichment kit according to claim 14, wherein: A surface of each of the magnetic beads has a polymer hydrogel coating applied thereon; and The first oligonucleotide primer is attached to the polymer hydrogel.

18. The enrichment kit according to claim 14, wherein: The first member of the binding pair is biotin and the second member of the binding pair is streptavidin; or The first member of the binding pair is a NiNTA (nickel-nitrilotriacetic acid) ligand and the second member of the binding pair is a histidine tag; or The first member and the second member of the binding pair are complementary DNA strands capable of hybridizing to each other; or The first member and the second member of the binding pair are functional groups capable of forming a disulfide bond; or The first member and the second member of the binding pair are functional groups capable of forming an imine.

Images