Application of saccharomycetes in rice product processing

Abstract

The invention discloses application of saccharomycetes in processing of rice products, the saccharomycetes are CDLB-YE05 Kazakstein saccharomycetes, the saccharomycetes are preserved in Institute of Microbiology, Chinese Academy of Sciences on July 17, 2023, the preservation number is CGMCC NO.27948, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. When the yeast rice product is used, the yeast is applied to the preparation of the rice product, so that the generation of polysaccharide compounds and flavor substances in the rice product is increased, the viscosity of the rice product is enhanced, the taste is chewy, the flavor is better, and the quality of the rice product is comprehensively improved.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to application of yeast in rice product processing. Background Art

[0002] Rice products are starch foods that people love. Their production technology is mature, and there are many types and methods. They are specifically divided into staple foods and snacks. Staple foods include rice wrappers, rice noodles, rice rolls, rice noodles, glutinous rice balls, sushi, rice dumplings, rice cakes, rice balls, glutinous rice cakes, rice tofu, steamed pork with rice flour, rice tea, etc., and snacks include various rice cakes and snacks. Although the production technology of these rice products is mature, they generally do not use microorganisms for fermentation. The flavor and taste of the rice products depend on the characteristics of the food itself and the edible additives used, which makes it difficult to improve the flavor and taste of the rice products. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide an application of yeast in rice product processing, which solves the problem that there is no microorganism for fermentation during the existing rice product processing, resulting in poor flavor and taste.

[0004] In order to achieve the above-mentioned purpose, the technical solution of the present invention is implemented as follows: an application of yeast in rice product processing, the yeast is CDLB-YE05 Kazakhstan yeast, which was deposited in the Institute of Microbiology, Chinese Academy of Sciences on July 17, 2023, with a deposit number of CGMCC NO.27948, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0005] Furthermore, the specific method is:

[0006] After the rice is soaked, it is evenly mixed with the yeast and fermented;

[0007] The fermented rice is mixed with water and beaten to make rice products.

[0008] Furthermore, the rice is soaked in water for 1 to 4 hours and then drained.

[0009] Further, the soaked rice is evenly mixed with the yeast and fermented, specifically:

[0010] Mix yeast and rice in a mass ratio of 3: (900-1100) and the number of live yeast cells should be no less than 10 7 CFU;

[0011] Place the evenly mixed rice under ventilated conditions at 30℃~35℃, maintain the relative humidity at 60%~80%, and stir at 8rpm~45rpm for 2h~6h.

[0012] Furthermore, the fermented rice is mixed with water and beaten into pulp, specifically:

[0013] Mix rice and water in a mass ratio of 1:(1.25-1.65) and grind into rice slurry at room temperature.

[0014] Furthermore, the ITS nucleotide sequence of the yeast is shown in SEQ No.1.

[0015] Furthermore, the 18s rDNA nucleotide sequence of the yeast is shown in SEQ No.2.

[0016] Furthermore, the 26s rDNA nucleotide sequence of the yeast is shown in SEQ No.3.

[0017] Furthermore, the characteristic metabolites of the yeast in the processing of rice products are hypoxanthine and mevalonic acid.

[0018] Furthermore, the rice products include: rice noodles, rice vermicelli, rice rolls, and rice cakes.

[0019] Compared with the prior art, the present invention has the following beneficial effects: the present invention increases the production of polysaccharide compounds and aromatic substances in rice products by applying yeast to the preparation of rice products, thereby enhancing the viscosity of the rice products, making the taste more chewy and the flavor more abundant, and comprehensively improving the quality of the rice products. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a cell morphology diagram of CDLB-YE05 Kazakh yeast;

[0021] Figure 2 The electrophoresis diagram of CDLB-YE05 Kazakh yeast strain sergeri;

[0022] Figure 3 It is the ITS nucleotide sequence alignment of CDLB-YE05 Kazakh yeast;

[0023] Figure 4 It is a 26S rDNA sequence alignment diagram of CDLB-YE05 Kazakh yeast strain Serki;

[0024] Figure 5 This is a comparison of the 18S rDNA sequences of CDLB-YE05 Kazakh yeast. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0026] Example

[0027] 1. Isolate and purify yeast that does not produce gas or alcohol

[0028] 1.1 Sample source

[0029] Hand-kneaded dough was collected at an altitude of 1700m, longitude and latitude E 103°27′35.4″, N 36°8′16.6″ in Lanzhou, Gansu Province, and used as the source of yeast samples.

[0030] 1.2 Culture medium: potato dextrose agar (PDA), malt extract medium

[0031] The specific components of potato dextrose agar per liter are: 300.0 g of potato (from which the extract powder is extracted), 20.0 g of glucose, 15.0 g of agar, and 0.1 g of chloramphenicol.

[0032] The specific components of each liter of malt extract culture medium are: 130.0 g of malt extract powder and 0.1 g of chloramphenicol.

[0033] 1.3 Reagents and instruments

[0034] Table 1 List of reagents and instruments used in this example

[0035] Reagents / Instruments source phenol Nanjing Chemical Reagent Co., Ltd. sulfuric acid Nanjing Chemical Reagent Co., Ltd. Sodium chloride Tianjin Damao Chemical Reagent Factory Potassium dichromate Tianjin Best Chemical Co., Ltd. FA2204B Electronic Analytical Balance Shanghai Youke Instrument Co., Ltd. DSX-280B Portable Pressure Steam Sterilizer Shanghai Shen'an Medical Equipment Factory SW-CJ-1FD vertical clean bench Suzhou Bolaier Purification Equipment Co., Ltd. SPX-250 Biochemical Incubator Shanghai Shenxian Constant Temperature Equipment Factory 723CRT Visible Spectrophotometer Shanghai Youke Instrument Co., Ltd. ZD-85A Digital Display Gas Bath Constant Temperature Oscillator Changzhou Putian Instrument Manufacturing Co., Ltd. H2-16 Desktop High Speed ​​Centrifuge Hunan Kecheng Instrument Equipment Co., Ltd.

[0036] 1.4 Isolation of yeast

[0037] Weigh 25g of Lanzhou ramen dough, add 225mL of sterile saline to make a 1:10 sample solution, and dilute it by 10 times to 10 6 Gradient sample homogenate;

[0038] At each dilution, take 1 mL of the sample solution and add it to two plates. Then, take 20 mL of potato dextrose agar cooled to 46°C and inject it into the plates. After cooling and solidifying, place them in a fungal incubator at 28°C and culture for five days.

[0039] Observe the colony morphology and select single colonies from them, continuously streak the selected single colonies on potato dextrose agar plates for culture, and observe the morphology of the single colonies until different single strains are isolated.

[0040] 1.5 Screening of non-gas-producing strains

[0041] Prepare 180 mL of malt extract medium, sterilize it at 115°C for 15 min, cool it, and dispense it into 18 15 mL sterile glass test tubes. Empty the air in the Duroc tubes and place the Duroc tubes with the opening facing downwards in each test tube.

[0042] Select a single strain obtained in 1.4 and inoculate it into the malt juice medium of each test tube, and add a breathable filter membrane to seal each test tube. Shake and culture at 30±1℃ and 160rpm for 72h, observe the turbidity rate and gas production of the strain growth, and select the strain with fast turbidity rate and no gas production.

[0043] 1.6 Screening for non-alcohol producing strains

[0044] The non-gas-producing strain selected in 1.5 was diluted 10-fold to 10 6 For the gradient sample homogenate, take 1 mL of the sample homogenate in each dilution into two sterile plates, measure 20 mL of potato dextrose agar cooled to 46°C and inject it into the plates. After cooling and solidification, place it in a fungal incubator at 28°C for five days, observe the colony morphology, and select medium-to-large single colonies with smooth surfaces and neat edges;

[0045] The medium-to-large single colony is inoculated into a malt extract medium, and cultured under shaking at 30±1° C. and 160 rpm for 72 hours to obtain a bacterial solution;

[0046] Take 1 mL of bacterial solution, add 1 mL of potassium dichromate solution with a molar concentration of 0.1 mol / L, shake and observe the color change of the mixed solution;

[0047] Select the strain that has not changed color and repeat the above screening steps until a yeast strain that produces neither gas nor alcohol is selected.

[0048] The non-gas-producing and non-alcohol-producing yeast and the gas-producing and alcohol-producing yeast obtained in the above process were inoculated into the malt wort culture medium at the same time to observe their reproduction and metabolism. The results showed that the non-gas-producing and non-alcohol-producing yeast made the malt wort culture medium more viscous and had a rose scent.

[0049] 2. Detection of microscopic morphology and physiological and biochemical characteristics of non-gas-producing and non-alcohol-producing yeast

[0050] 2.1 Microscopic morphology

[0051] like Figure 1 As shown, the non-gas-producing and non-alcohol-producing yeast was cultured in a malt extract medium at 25°C for three days. At this time, the cell size was (1.6-2.2)×(1.8-2.2)μm, and the cells were oval or elliptical; a precipitate was formed, and the malt extract agar slant was cultured at 25°C for one month. The colonies were light brown, flat, waxy, shiny, with faint stripes on the surface, and neat edges, slightly scalloped; the non-gas-producing and non-alcohol-producing yeast was cultured on a corn flour agar Dalmau plate, and no pseudohyphae were produced.

[0052] 2.2 Physiological and biochemical characteristics

[0053] Table 2 Physiological and biochemical characteristics of yeasts that do not produce gas or alcohol

[0054]

[0055] 3. Genome sequencing of non-gas-producing and non-alcohol-producing yeast

[0056] 3.1 Genome sequencing

[0057] 3.1.1 Cultivation of non-gas-producing and non-alcohol-producing yeast:

[0058] Prepare 100 mL of malt wort culture medium in a conical flask, sterilize it under high pressure at 115℃ for 20 min, take a prepared non-gas-producing and non-alcohol-producing yeast test tube slope, add a small amount of malt wort culture medium to suspend it, pour the suspended bacterial liquid into the malt wort conical flask through aseptic operation, seal it with a breathable filter membrane, and culture it at 28℃±1℃ and 180rpm for 24 hours.

[0059] 3.1.2 Bacteria collection

[0060] After the culture was completed, the cell morphology of the bacterial solution was confirmed by microscopic examination, and then centrifuged at 4800 rpm for 15 min at room temperature in a high-speed centrifuge. The supernatant was discarded, and the bacterial precipitate was washed with PBS buffer, suspended and centrifuged at 12000 rpm for 120 s. The washing of the bacterial cells was repeated twice until the residual culture medium in the bacterial cells was reduced.

[0061] The washed bacterial pellet was quickly frozen with liquid nitrogen, placed in a sample tube, and sent to the BGI Wuhan Sequencing Center with dry ice for genome sequencing.

[0062] 3.1.3 Sequencing

[0063] Genomic DNA was extracted from non-gas-producing and non-alcohol-producing yeast, and the concentration of DNA samples was detected by fluorescence quantification instrument; the integrity of DNA samples was detected by 1% agarose gel electrophoresis, and qualified samples were used for library preparation and sequencing.

[0064] 3.2 Sequencing results

[0065] The total raw data obtained by sequencing was 2187Mb, of which 2135Mb was available. The GC content of the genome was 34.25%, the BGISEQ type data volume was 2135Mb, the sequencing depth was 158X, there were 26 assembled fragments, the total size of the genome was 13468544bp, the number of genes identified in the genome was 5415, the total length of the genes was 8998861bp, the average length of the genes was 1661.84bp, and the gene length accounted for 66.81% of the total length of the genome. There were 6260 exons, the total length of the exons was 8687977bp, the average length of the exons was 1387.86bp, and the exon length was The length of the genome accounts for 64.51% of the total length of the genome. There are 5415 coding sequences (CDS), the total length of the coding sequence (CDS) is 8687977bp, the average length of the coding sequence (CDS) is 1604.43bp, there are 845 introns, the total length of introns is 310884bp, the average length of introns is 367.91bp, and the length of introns accounts for 2.31% of the total length of the genome. The number of non-coding RNAs that have been identified is 1046. Specifically, the number of tRNA copies is 251, the average length is 79.19, the total length is 19878, and the percentage of the genome is 0.1476%; the number of rRNA copies is The number of copies of sRNA is 57, the average length is 64.75, the total length is 3691, and the percentage of the genome is 0.0274%; the number of copies of snRNA is 99, the average length is 106.38, the total length is 10532, and the percentage of the genome is 0.0782%; the number of copies of miRNA is 616, the average length is 41.58, the total length is 25617, and the percentage of the genome is 0.1902%; the total repeat sequence size is 2034046bp, accounting for % of the genome The size of the repetitive sequence predicted by the Repbase method is 250922bp, accounting for 1.8630% of the genome; the size of the repetitive sequence predicted by the ProMask method is 152286bp, accounting for 1.1307% of the genome; the size of the repetitive sequence predicted by the denovo method is 1597472bp, accounting for 11.8608% of the genome; the size of the repetitive sequence predicted by the TRF method is 374775bp, accounting for 2.7826% of the genome; the total length of the transposon is 1838382bp, accounting for 13.The length of DNA transposon predicted by Repbase method was 101509bp, the length of LINE transposon was 54335bp, the length of LTR transposon was 117526bp, the length of SINE transposon was 3016bp, the length of other types of transposon was 14bp and 2766bp respectively, the total length was 250922bp, accounting for 1.8630% of the genome; the length of DNA transposon predicted by ProteinMask method was 8994bp, the length of LINE transposon was 471bp, the length of LTR transposon was 82924bp, the length of SINE transposon was 0bp, the length of other types of transposon was 60110bp, the total length was 152286bp, accounting for 1.1307% of the genome; the length of DNA transposon predicted by Denovo method was 101509bp, the length of LINE transposon was 54335bp, the length of LTR transposon was 117526bp, the length of SINE transposon was 3016bp, the length of other types of transposon was 14bp and 2766bp respectively, the total length was 250922bp, accounting for 1.8630% of the genome The measured length of DNA transposon is 41958bp, the length of LINE transposon is 0bp, the length of LTR transposon is 151613bp, the length of SINE transposon is 9739bp, the length of other types of transposon is 0bp and 1396238bp, the total length is 1597472bp, accounting for 11.8608% of the genome; according to the data in the comprehensive transposon classification statistics table, the percentage of DNA transposon in the genome is 1.1166%, the percentage of LINE transposon in the genome is 0.4061%, the percentage of LTR transposon in the genome is 2.0541%, the percentage of SINE transposon in the genome is 0.0851%, the percentage of other types of transposon in the genome is 0.4464%, and the percentage of unknown types of transposon in the genome is 10.3872%. .

[0066] The assembled genome was annotated with 16 databases, including P450, TF, CAZY, KINASE, SWISSPROT, NOG, CARD, CWDE, NR, DBCAN, TCDB, IPR, KEGG, GO, PHOSPHATASE, and KOG. Among them, the number of genes annotated in the P450 database was 602, accounting for 11.11% of the total number of genes; the number of genes annotated in the TF transcription factor database was 180, accounting for 3.32% of the total number of genes; the number of genes annotated in the CAZY database was 235, accounting for 4.33% of the total number of genes; the number of genes annotated in the KINASE kinase database was 126, accounting for 2.32% of the total number of genes; the number of genes annotated in the SwissProt database was 3757, accounting for 69.38% of the total number of genes; the number of genes annotated in the NOG database was 4252, accounting for 78.52% of the total number of genes; the CARD resistance gene database The number of genes annotated by the CWDE cellulose degradation enzyme database is 3, accounting for 0.05% of the total number of genes; the number of genes annotated by the NR database is 5033, accounting for 92.94% of the total number of genes; the number of genes annotated by the DBCAN database is 131, accounting for 2.41% of the total number of genes; the number of genes annotated by the TCDB database is 589, accounting for 10.87% of the total number of genes; the number of genes annotated by the IPR database is 4718, accounting for 87.12% of the total number of genes; the number of genes annotated by the KEGG database is 3300, accounting for 60.94% of the total number of genes; the number of genes annotated by the GO database is 3668, accounting for 67.73% of the total number of genes; the number of genes annotated by the PHOSPHATASE phosphatase database is 40, accounting for 0.73% of the total number of genes; the number of genes annotated by the KOG database is 3131, accounting for 57.82% of the total number of genes.

[0067] The number of genes annotated in at least one of the databases was 5183, accounting for 95.71% of the total number of genes. In the carbohydrate enzyme classification annotation, the number of auxiliary function enzymes (AAs) was 28, the number of carbohydrate binding modules (CBMs) was 24, the number of carbohydrate esterases (CEs) was 4, the number of glycoside hydrolases (GHs) was 82, the number of glycosyltransferases (GTs) was 109, and the number of polysaccharide lyases (PLs) was 0.

[0068] The yeast genome data have been uploaded to the National Center for Biotechnology Information (NCBI) of the United States and the National Microbiological Data Center (NMDC) of China, with NCBI's submission number SUB13928360, bioproject number PRJNA1030441, and biosample number SAMN37909528, and NMDC's submission number SUB1712721148789, bioproject number NMDC10018828, and biosample number NMDC20160095.

[0069] 4. Identification of non-gas-producing and non-alcohol-producing yeasts

[0070] 4.1 Main materials and reagents

[0071] Table 3 Main materials and reagents used in this example

[0072] Reagent name supplier Ezup Column Fungal Genomic DNA Extraction Kit Bioengineering SanPrep Column-Based DNA Gel Extraction Kit Bioengineering Taq Plus DNA Polymerase BBI Agarose B BBI 4S Red Plus Nucleic Acid Stain (10,000X aqueous solution) BBI GeneRuler DNA Ladder Mix Thermo Scientific

[0073] 4.2 Main instruments used

[0074] Table 4 Instruments used in this example

[0075] name model factory Clean bench SW-CJ-1D Jiangsu Su Clean Equipment Factory PCR Amplifier PCR-96 BBI High-speed microcentrifuge, 100~14800rpm G508009 Bioengineering Electrophoresis Apparatus DYY-6C Beijing Children's Day Gel imaging system FR980 Shanghai FuRi Technology Co., Ltd. Micro-volume spectrophotometer SMA4000 Merinton Instrument,Inc Sequencer 3730XL ABI,Foster,CA,USA

[0076] 4.3 Primer sequences

[0077] ITS1:TCCGTAGGTGAACCTGCGG

[0078] ITS4-R:TCCTCCGCTTATTGATATGC

[0079] NL1:GCATATCAATAAGCGGAGGAAAAG

[0080] NL4: GGTCCGTGTTTCAAGACGG

[0081] NS1:GTAGTCATATGCTTGTCTC

[0082] NS6: GCATCACAGACCTGTTATTGCCTC

[0083] 4.4 Preparation before identification

[0084] 20 mg of dried yeast strain was ground into powder with liquid nitrogen and added into a 1.5 mL centrifuge tube. 200 μL of buffer digestion, 2 μL of β-mercaptoethanol and 20 μL of proteinase K solution were injected into the tube, and the mixture was shaken and mixed. The tube was incubated in a water bath at 56°C for 1 h until the cells were completely lysed.

[0085] Add 100 μL Buffer PF, mix thoroughly by inversion, and place at -20°C for 5 min;

[0086] Centrifuge at 10,000 rpm for 5 min at room temperature and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0087] Add 200 μL Buffer BD; invert thoroughly to mix;

[0088] Add 200 μL of anhydrous ethanol and mix thoroughly by inversion;

[0089] Place the adsorption column in the collection tube, use a pipette to add all the solution and translucent fibrous suspension into the adsorption column, let it stand for 2 minutes, centrifuge at 10000 rpm and room temperature for 1 minute, and discard the waste liquid in the collection tube;

[0090] Put the adsorption column back into the collection tube, add 500 μL PW Solution, centrifuge at 10,000 rpm for 30 seconds, and discard the waste liquid in the collection tube;

[0091] Put the adsorption column back into the collection tube, add 500 μL Wash Solution, centrifuge at 10,000 rpm for 30 seconds, and discard the waste liquid in the collection tube;

[0092] Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm at room temperature for 2 minutes to remove the remaining WashSolution. Open the cover of the adsorption column and leave it at room temperature for several minutes to completely dry the remaining WashSolution in the adsorption material.

[0093] Take out the adsorption column, put it into a new 1.5mL centrifuge tube, add 50μL TE Buffer and let it stand for 3min, centrifuge at 12000rpm and room temperature for 2min, and collect the DNA solution; the extracted DNA can be used for the next experiment immediately or stored at -20℃.

[0094] 4.5 Identification

[0095] 4.5.1 PCR amplification and electrophoresis

[0096] The extracted DNA was subjected to PCR amplification, and the PCR system and PCR amplification conditions used are shown in Tables 5 and 6.

[0097] 1.5% agarose gel, 1x TAE, 150V, 100mA, 20min electrophoresis observation, the results are as follows Figure 2 As shown by Figure 2The electrophoresis results show that the size of the DNA band after amplification with primers ITS1 and ITS4-R is about 700bp, the size of the DNA band after amplification with primers NL1 and NL4 is about 1200bp, and the size of the DNA band after amplification with primers NS and NS6 is about 600bp, all of which are consistent with the size of the target DNA band.

[0098] Table 5 PCR reaction system

[0099] Reaction components Volume (μL) 10X PCR Buffer dNTP (each 10mM) Taq Plus DNA Polymerase(5U / μL) <![CDATA[50mM MgSO4]]> Total 12.5 Primer F (10 μM) 1 Primer R (10 μM) 1 Template(DNA) 1 <![CDATA[ddH2O]]> 9.5 Total 25

[0100] Table 6 PCR reaction conditions

[0101]

[0102] 4.5.2 Dideoxy chain termination sequencing

[0103] The dideoxy chain termination method was used to detect the ITS nucleotide sequence, 18s rDNA nucleotide sequence and 26s rDNA nucleotide sequence of the non-gas-producing and non-alcohol-producing yeast. Among them, the ITS nucleotide sequence is a specific identifier of the non-gas-producing and non-alcohol-producing yeast, with a total of 647 bp, and the specific nucleotide sequence is shown in SEQ No.1. The 18s rDNA nucleotide sequence is used as a further clear classification and identity confirmation of the non-gas-producing and non-alcohol-producing yeast, with a total of 1329 bp, and the specific nucleotide sequence is shown in SEQ No.2. The 26s rDNA nucleotide sequence is used for the distinction and supplementary instructions of the non-gas-producing and non-alcohol-producing yeast, with a total of 586 bp, and the specific nucleotide sequence is shown in SEQ No.3.

[0104] The ITS nucleotide sequence alignment results of the non-gas-producing and non-alcohol-producing yeast are as follows: Figure 3 The 26s rDNA sequence alignment results are shown in Figure 4 The 18s rDNA sequence alignment results are shown in Figure 5 As shown, combined Figure 3-Figure 5 It can be seen that the non-gas-producing and non-alcohol-producing yeast belongs to Kazachstania servazzii, and the yeast has obvious genetic differentiation within the species of Kazachstania servazzii, and is determined to be CDLB-YE05 Kazachstania servazzii.

[0105] 5. Deposit of CDLB-YE05 Yeast of Kazakhstan

[0106] The obtained CDLB-YE05 Kazakh yeast was delivered by mail on July 17, 2023 and stored at the Institute of Microbiology, Chinese Academy of Sciences. The yeast preservation number is CGMCC No. 27948, and the preservation location is Building 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China.

[0107] 6. Processing rice products using CDLB-YE05 Kazakh yeast

[0108] Step S1, soaking indica rice: clean the indica rice, soak it for 1 to 4 hours and then drain it;

[0109] Step S2, yeast inoculation: CDLB-YE05 Kazakh yeast and indica rice are mixed evenly according to a mass ratio of 3:900-1100, wherein the number of live yeast cells of the yeast is not less than 10 7 CFU;

[0110] Step S3, indica rice fermentation: the inoculated indica rice is fermented at 30-35° C. with open ventilation for 2-6 hours, during which the stirring speed is between 8 and 45 rpm and the relative humidity is maintained between 60% and 80%;

[0111] Step S4, rice slurry preparation: the fermented indica rice and drinking water are slurried in a mass ratio of 1:1.25-1.65, the water temperature is controlled at room temperature, and the slurry is not heated during the slurrying process to avoid starch gelatinization. The rice slurry particles after slurrying are fine and uniform, without obvious large particles, and the ideal particle diameter should be less than 80 μm.

[0112] 7. Detection of aroma components in rice milk fermented by CDLB-YE05 Kazakh yeast

[0113] 7.1 Main instruments

[0114] Table 7 List of instruments used to detect aroma components Instrument and reagent manufacturers

[0115] Ultra-high pressure liquid chromatography (Agilent 7820A GC) Agilent Technologies Mass spectrometry (Agilent 5977) Agilent Technologies Chromatographic column 19091S-433UI HP-5MS Vltra Inert Agilent Technologies

[0116] 7.2 Detection process

[0117] 7.2.1 Sample pretreatment

[0118] Take liquid nitrogen-frozen rice milk fermented with CDLB-YE05 Kazakh yeast and set aside;

[0119] Prepare the internal standard solution with methanol, 5 μg / mL deuterated styrene solution, cut the sample into pieces, weigh 3 g of sample into the injection bottle, and add 100 μL of the internal standard solution.

[0120] 7.2.2 GCMS Method

[0121] Extraction conditions:

[0122] Oscillate at 250 rpm for 15 min at 60 °C, insert the SPME extraction head into the headspace bottle, and extract at 60 °C for 30 min; insert the extraction needle into the GC injection port for desorption, the desorption temperature is 260 °C, and the desorption time is 5 min.

[0123] Chromatographic column:

[0124] 19091S-433HP-5MS (30m×0.25mm×0.25μm); carrier gas: high purity He (99.999%); flow rate 1.0mL / min; injection mode: splitless injection; gas phase temperature program: 15℃ / min, 40~125℃; 5℃ / min, 125~210℃; 10℃ / min, 210~270℃; 20℃ / min, 270~305℃, maintain at 305℃ for 5min.

[0125] GC / MS interface temperature: 270℃; EI ion source, ion polarity: positive, electron energy: 70V; ion source temperature: 240℃, quadrupole temperature: 160℃; mass scanning range: 50~600MZ, delay 5min to start acquisition; scanning speed: 1562u / s, frequency: 2.7 times / s, step size: 0.1m / z.

[0126] 7.2.3 Data Analysis

[0127] 1) Use Qualitative Workflows B.08.00 software to perform peak deconvolution on the original file, extract the peak, and then search NIS17.0 to obtain the identification result; then use Qualitative Workflows B.08.00 quantitative analysis software to align and quantify the peak, and correct it through the internal standard response.

[0128] 2)Qualitative Workflows B.08.00 software setting parameters:

[0129] Compound Discovery: Find by Molecular Feature, Peak filtering: Use peaks with height ≥ 600 counts, Compound Identification: Asymmetry (m / z): -0.3Da+0.7Da, Minimum match (m / z): 30Da, Abundance ratio uncertainty: 40%, Score (rev): 60.00.

[0130] 7.2.4 Measurement results

[0131] A total of 124 volatile components were detected in the rice milk fermented by CDLB-YE05 Kazakh yeast, mainly including fatty acid esters, ketones, siloxanes, halogenated hydrocarbons, cycloalkanes, alcohols, ethers, esters, amines, phenols, triazoles, thiols and other heterocyclic compounds. The specific compounds are shown in Table 8. It can be seen from Table 8 that the fermented rice milk contains a variety of alcohols (such as 1-hexanol), esters (such as methyl hexadecanoate) and ketones (such as 2,2,5,5-tetramethyl-3-hexanone) and other compounds. These compounds work together to form the unique flavor of rice products made from the rice milk.

[0132] Table 8 Aroma components in fermented rice milk

[0133]

[0134]

[0135]

[0136]

[0137] Among them, Hits refers to the number of times the compound is detected, and the proportion refers to the proportion of the compound in the total mixture.

[0138] 8. Comparative evaluation of rice noodles fermented by CDLB-YE05 Kazakh yeast and blank rice noodles

[0139] 8.1 Rice milk preparation

[0140] The preparation of fermented rice milk is the same as that in method 6. The preparation of blank rice milk is the same as that in method 6 except that CDLB-YE05 Kazakhstan yeast is not added for fermentation;

[0141] 8.2 Steaming rice noodles:

[0142] The fermented rice slurry and the blank rice slurry were mixed with vegetable oil at a mass ratio of 50:1, and the oil and rice slurry were stirred at a speed of 60 rpm to 150 rpm for 20 s to 60 s using an egg beater to mix the two evenly and ensure that the oil was completely emulsified;

[0143] Measure 150mL of rice slurry, pour it into a stainless steel plate with a bottom area of ​​230mm×275mm and spread it evenly to a thickness of about 2.4mm. Steam it in boiling water for 3min30s, until small bubbles appear on the surface of the rice noodle rolls, take out the rice noodles and let them cool.

[0144] 8.3 Cut rice noodles into strips:

[0145] After folding the rice noodles in half, use a knife to cut them into 1cm wide strips.

[0146] 8.4 Tensile force measurement: A tensile force meter was used to measure the tensile force of rice noodles at a length of 15 cm, with each piece being the unit. The measurement results are shown in Table 9.

[0147] Table 9 Tensile test results of rice flour prepared from fermented rice slurry and blank rice slurry

[0148] Serial number 1 2 3 4 5 6 7 8 9 10 Fermented rice milk group 26 25.5 28.5 30 25 28 30 26.5 29 30 Blank rice milk group 18 18 10 15 12 9 12 12 14 12

[0149] 8.5 Determination of texture characteristics

[0150] 1) Hardness measurement

[0151] Determination scheme: compression method, determination speed: constant speed, condition value: ≥ deformation (70% of the thickness of rice noodles), maximum force is the hardness value;

[0152] 2) Determination of elasticity value

[0153] Determine the elasticity of rice noodles, measurement scheme: compression method, measurement speed: constant speed, condition value: ≥ deformation (70% of the thickness of 1 root), elasticity value = retraction height / pressing depth × 100%, retraction height = rebound thickness after compression - thickness before compression + pressing depth, pressing depth = thickness before compression × 70% (maximum deformation), thickness before compression and rebound thickness after compression are measured with a vernier caliper.

[0154] The measurement results are shown in Table 10. It can be seen from Table 10 that:

[0155] Taste: The rice noodles fermented with CDLB-YE05 Kazakhstan yeast have a chewier, smoother and more elastic taste, accompanied by the unique fermentation aroma of yeast; in contrast, the unfermented rice noodles have poor elasticity, lack of fermentation aroma, and are fragile.

[0156] Tensile strength: The average tensile strength of fermented rice noodles is 27.9, while the average tensile strength of unfermented rice noodles is only 13. This shows that the fermented rice noodles are significantly better than the unfermented rice noodles in terms of tensile strength.

[0157] Hardness: The average hardness of fermented rice noodles is 47.368, and the average hardness of unfermented rice noodles is 42.248. Fermentation increases the hardness of rice noodles. The harder the rice noodles, the chewier and smoother their taste.

[0158] Elasticity: The average elasticity of fermented rice noodles is 85.57%, while the average elasticity of unfermented rice noodles is 51.949%. The elasticity of fermented rice noodles is significantly better than that of unfermented rice noodles, showing more prominent elastic characteristics.

[0159] Table 10 Hardness and elasticity of rice noodles made from fermented rice slurry and blank rice slurry

[0160]

[0161] 9. Characteristic metabolites of CDLB-YE05 Kazakhstan yeast in food processing applications

[0162] 9.1 Metabolomics analysis of CDLB-YE05 Kazakh yeast in flour fermentation

[0163] 9.1.1 Fermented flour sample preparation

[0164] Pour flour, salt and alkali into a bowl-type dough mixer according to the material ratio shown in Table 11, turn on the machine to stir, slowly add 500mL of drinking water during the stirring process, continue stirring for 30 minutes, and let the flour become semi-wet and fluffy; sprinkle CDLB-YE05 Ser Kazakhstan yeast evenly in the flour, continue stirring for 30 minutes, keep the surface temperature of the stainless steel basin at 30℃±2℃, stir for 15 minutes every hour, and the total fermentation time is 4 hours, subject to the production of fragrance. The fermented flour was sampled 6 times in parallel, 10g each time, and stored at -80℃ to fix the biological state.

[0165] Table 11 Material Proportion

[0166] raw material Ratio flour 2Kg Salt 1g Baking Soda 1g drinking water 500mL CDLB-YE05 Kazakhstan yeast <![CDATA[2g(10 8 CFU)]]>

[0167] 9.1.2 Preparation of blank flour samples

[0168] On the basis of the preparation of fermented flour samples in 9.1.1, after mixing the flour and water, before inoculation with CDLB-YE05 Kazakh yeast, 6 parallel samples of 10 g each were taken and also stored at -80℃ to fix the biological state.

[0169] 9.1.3 Yeast liquid preparation

[0170] Prepare 100 mL of malt wort medium in a conical flask, sterilize it under high pressure at 115°C for 20 min, take a prepared CDLB-YE05 Kazakhstan yeast test tube slant, add a small amount of malt wort medium to suspend it, aseptically pour the suspended bacterial liquid into the malt wort conical flask, seal it with a breathable filter membrane, and culture it at 28°C±1°C with shaking (180rpm) for 24 h.

[0171] The samples were taken in parallel 6 times, 10 mL each time, and stored at -80°C to fix the biological state.

[0172] 9.1.4 Preparation of blank culture medium

[0173] After the wort medium in 9.1.3 yeast liquid preparation was autoclaved, 6 parallel samples of 10 mL each were taken and stored at -80°C to fix the biological state.

[0174] 9.1.5 Metabolomics assay

[0175] The instruments and reagents used are shown in Table 12. The internal standards are d3-Leucine, 13C9-Phenylalanine, d5-Tryptophan, and 13C3-Progesterone.

[0176] Table 12 Instruments and reagents used

[0177] Equipment model / reagent specifications factory Low temperature high speed centrifuge Centrifuge 5430 Eppendorf Vortex Analyzer QL-901 Qilin Bell Instrument Manufacturing Co., Ltd. Ultrapure Water Milli-Q Integral Millipore Corporation Maxi Vacbeta Freeze Vacuum Concentrator GENE COMPANY Tissue grinder JXFSTPRP Shanghai Jingxin LCMS grade methanol Thermo Fisher Scientific LCMS grade acetonitrile Thermo Fisher Scientific Ammonium formate Honeywell Fluka Formic acid DIMKA

[0178] 1) Metabolite extraction

[0179] 50 μg of sample was weighed into 1.5 mL Eppendorf tubes and soaked with 800 μL of pre-cooled extraction solution (methanol: H2O = 7:3, v / v) and 20 μL of internal standard 1 (IS1);

[0180] Homogenize with a braided grinder at 50 Hz for 10 min, then sonicate in a water bath at 4 °C for 30 min;

[0181] After standing at −20°C for 1 h, the extract was centrifuged at 14,000 rpm for 15 min at 4°C;

[0182] 600 μL of supernatant was filtered with a 0.22 μm membrane, and 20 μL of the filtered solution from each sample was compounded with a pooled QC sample to evaluate the repeatability and stability of the LC / MS analysis;

[0183] The filtered samples and pooled QC samples were transferred to 1.5 mL sample vials for instrument runs.

[0184] 2) UPLC-MS analysis

[0185] In this experiment, Waters UPLC I-Class Plus (Waters, USA) was used in tandem with Q Exactive high-resolution mass spectrometer (Thermo Fisher Scientific, USA) for separation and detection of metabolites.

[0186] Chromatographic conditions: The chromatographic column used was a Hypersil GOLD aQ Dim column (1.9 μm 2.1*100 mm, Thermo Fisher Scientific, USA);

[0187] The mobile phases were 0.1% formic acid in water (liquid A) and 0.1% formic acid in acetonitrile (liquid B), and the following gradient was used for elution: 0-2 min, 5% liquid B; 2-22 min, 5%-95% liquid B; 22-27 min, 95% liquid B; 27-27.1 min, 95% liquid B-5% liquid B; 27.1-30 min, 5% liquid B; the flow rate was 0.3 mL / min, the column temperature was 40°C, and the injection volume was 5 μL.

[0188] Mass spectrometry conditions: Q Exactive mass spectrometer (Thermo Fisher Scientific, USA) was used for primary and secondary mass spectrometry data acquisition, with a mass-to-nuclear ratio range of 125–1500 for positive ions and 100–1500 for negative ions, a primary resolution of 70,000, an AGC of 1e6, and a maximum injection time IT of 100 ms.

[0189] According to the parent ion intensity, Top3 was selected for fragmentation and secondary information was collected. The secondary resolution was 35000, the AGC was 2e5, the maximum injection time IT was 50ms, and the fragmentation energy (stepped nce) was set to: 20, 40, 60 eV.

[0190] The ion source (ESI) parameter settings were as follows: sheath gas flow rate was 40, auxiliary gas flow rate was 10, spray voltage (|KV|) was 3.80 in positive ion mode, 3.20 in negative ion mode, capillary temp was 320°C, and auxiliary gas heater temp was 350°C.

[0191] 3) Software and parameters

[0192] The mass spectrometry data were imported into Compound Discoverer 3.3 software, and after mass spectrometry data analysis was performed in combination with BMDB (BGI Metabolome Database), mzCloud database and ChemSpider online database, a data matrix containing information such as metabolite peak area and identification results was obtained, and the data matrix was further analyzed and processed.

[0193] 9.1.5 Metabolomics results

[0194] The metabolome level in this process was measured, and a total of 3772 compounds were detected, of which 1162 were identifiable. In the overall metabolite classification, they were mainly concentrated in the categories of amino acid metabolism, biosynthesis of other secondary metabolites, carbohydrate metabolism, lipid metabolism, nucleotide metabolism, biodegradation and metabolism of exogenous substances, and metabolism of cofactors and vitamins.

[0195] 9.2 Metabolomics analysis of CDLB-YE05 Kazakh yeast in indica rice fermentation

[0196] 9.2.1 Sample preparation

[0197] The indica rice was sampled 6 times after fermentation for 2 h in 6, with 10 g sampled each time, and stored at -80°C to fix the biological state. The unfermented indica rice was sampled and frozen in the same way.

[0198] 9.2.2 Metabolomics results

[0199] The metabolome level in the fermented indica rice was measured, and a total of 2,265 compounds were detected, of which 763 were identified. In the overall metabolite classification, they were mainly concentrated in categories such as lipids, amino acids, peptides and their analogs, carbohydrates, organic acids, benzene and its derivatives, nucleic acids, terpenoids, vitamins, purines and their derivatives, and cinnamic acid compounds.

[0200] The differential metabolites were obtained by screening under the following conditions: 1) VIP of the OPLS-DA model ≥ 1, 2) Fold Change ≥ 1.2 or ≤ 0.83, 3) q-value < 0.05. A total of 215 differential metabolites were obtained, including 188 up-regulated differential metabolites and 27 down-regulated differential metabolites.

[0201] 9.3 Characteristic metabolites

[0202] By combining the metabolomics data of CDLB-YE05 Kazakhstan yeast in fermented flour, yeast liquid and fermented indica rice, two differential metabolites, hypoxanthine and mevalonic acid, were screened out through KEGG PATHWAY enrichment analysis as the characteristic metabolites of CDLB-YE05 Kazakhstan yeast in edible processing applications.

[0203] The yeast of the present invention can be used in rice products including but not limited to rice noodles, rice noodles, rice rolls, and rice cakes.

[0204] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. An application of yeast in rice product processing, characterized in that: The yeast is CDLB-YE05 Serebrensis Kazakhstan yeast, which was deposited at the Institute of Microbiology, Chinese Academy of Sciences on July 17, 2023, with the deposit number CGMCCNO.27948, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

2. The use of a yeast in rice product processing according to claim 1, characterized in that: The specific method is: After the rice is soaked, it is evenly mixed with the yeast and fermented; The fermented rice is mixed with water and beaten to make rice products.

3. The use of a yeast in rice product processing according to claim 2, characterized in that: The specific steps of soaking the rice are as follows: soak the rice in water for 1 hour to 4 hours and then drain it.

4. The use of a yeast in rice product processing according to claim 2, characterized in that: The soaked rice is mixed evenly with the yeast and fermented, specifically: Mix yeast and rice in a mass ratio of 3: (900-1100) and the number of live yeast cells should be no less than 10 7 CFU; Place the evenly mixed rice under ventilated conditions at 30℃~35℃, maintain the relative humidity at 60%~80%, and stir at 8rpm~45rpm for 2h~6h.

5. The use of a yeast in rice product processing according to claim 2, characterized in that: The fermented rice is mixed with water and beaten into pulp, specifically: Mix rice and water in a mass ratio of 1:(1.25-1.65) and grind into rice slurry at room temperature.

6. The use of a yeast according to any one of claims 1 to 5 in rice product processing, characterized in that: The ITS nucleotide sequence of the yeast is shown in SEQ No.

1.

7. The use of a yeast according to any one of claims 1 to 5 in rice product processing, characterized in that: The 18s rDNA nucleotide sequence of the yeast is shown in SEQ No.

2.

8. The use of a yeast according to any one of claims 1 to 5 in rice product processing, characterized in that: The 26s rDNA nucleotide sequence of the yeast is shown in SEQ No.

3.

9. The use of a yeast according to any one of claims 1 to 5 in rice product processing, characterized in that: The characteristic metabolites of the yeast in the processing of rice products are hypoxanthine and mevalonic acid.

10. The use of a yeast according to any one of claims 1 to 5 in rice product processing, characterized in that: The rice products include: rice noodles, rice vermicelli, rice rolls, and rice cakes.

Images