Preparation method of bionic calculus bovis, bionic calculus bovis and application of bionic calculus bovis

Abstract

The invention relates to a preparation method of bionic calculus bovis, the bionic calculus bovis and application of the bionic calculus bovis, and belongs to the technical field of traditional Chinese medicine raw material preparation. According to the preparation method, natural oxgall is used as a fermentation substrate, a fermentation and / or enzymatic reaction system is used for preparing the bionic calculus bovis, and the fermentation and / or enzymatic reaction system is selected from at least one of synthetase plasmids, synthetase high-expression engineering bacteria and calculus bovis forming bacteria as a fermentation strain for direct in-vitro fermentation. The strains of the bezoar forming bacteria, the carriers of the synthetase high-expression engineering bacteria and the specific types of the synthetase plasmids are described in the specification. The bionic calculus bovis prepared by the method is highly consistent with natural calculus bovis in component, the content of cholic acid (CA) is 8.5%-20.0%, the content of deoxycholic acid (DCA) is 2.0%-6.5%, the fingerprint similarity is greater than or equal to 88.0%, and pharmacological experiments show that the bionic calculus bovis prepared by the method has the same acting effect as the natural calculus bovis and is superior to that of each pair of calculus bovis.

Description

Technical Field

[0001] The invention belongs to the technical field of preparation of raw materials of traditional Chinese medicine, and in particular relates to a preparation method of bionic bezoar, bionic bezoar and application thereof. Background Art

[0002] Bezoar (Bovis Calculus) is the dried gallstone of the cattle (Bos taurus domesticus Gmelin), a bovine animal. It is one of the most valuable traditional Chinese medicines. The "Shennong Bencao Jing" once recorded: "Bezoar is the essence of all herbs, a divine object in the world, and unmatched by other medicines." It is known as the "treasure of medicine." As a traditional precious Chinese medicinal material, bezoar is widely used in clinical Chinese medicine and has a large demand. The "Chinese Pharmacopoeia" uses more than 90 varieties of Chinese patent medicines using bezoar. Since the probability of natural bezoar production is extremely low and the resource is becoming increasingly scarce, there is an urgent need to find an effective substitute for natural bezoar to alleviate the shortage of natural bezoar and meet the demand for clinical medication.

[0003] At present, the substitutes for bezoar mainly include artificial bezoar, bezoar cultivated in vivo and bezoar cultivated in vitro. Among them, artificial bezoar is made by a simple mixture of ox bile powder, bile acid, hyodeoxycholic acid, taurine, bilirubin, cholesterol, trace elements, etc. In vitro cultivated bezoar is made by adding deoxycholic acid, bile acid, complex bilirubin calcium, etc. to fresh ox bile. In vivo cultivated bezoar is to cultivate stones in the living body of cattle. However, the composition of artificial bezoar and in vitro cultivated bezoar is quite different from that of natural bezoar, and their efficacy, especially in the treatment of clinical acute and severe diseases, still cannot completely replace natural bezoar; the composition of in vivo cultivated bezoar is similar to that of natural bezoar, but it is difficult to industrialize, causing serious harm to animals, and is affected by individual differences, cultivation time and other factors, and the quality is difficult to control. Therefore, substitutes for natural bezoar still cannot meet clinical needs.

[0004] Chinese invention patent CN103316046B discloses an enzymatic production process for in vitro cultivation of bezoar. First, fresh ox bile is enzymatically fermented to prepare biological ox bile, calcium hydroxide is added to the biological ox bile, stirred and ultrasonically treated, fully dissolved and heated to boiling, and prepared into stone ox bile. During the process of shaking and cultivating the stone ox bile, dilute acid is added to destroy the colloid balance of the stone ox bile and promote the formation of gallstone cores. Hydrochloric acid is continued to be added, and after brown-red spheres appear, the finished product is obtained by static stratification cultivation. The properties, structure, composition and other indicators of the in vitro cultivated bezoar product of the present invention are consistent with those of natural bezoar, but the content of related components needs to be further improved. Chinese invention patent application CN1563393A discloses an enzymatic method for preparing natural bezoar, wherein Escherichia coli is cultured, β-GA enzyme is prepared based on the formation of bezoar, β-GA enzyme solution is added to cattle bile stored at room temperature for several hours, β-GA enzyme catalyzes the reaction of effective ingredients bilirubin, bile acid, bezoar solution, cholesterol and inorganic salt to form brown-yellow bilirubin calcium salt precipitate, which is dried and pressed into bezoar shape, namely "enzymatic natural bezoar". However, the content of bile acid and deoxycholic acid in the product obtained by this method needs to be further improved.

[0005] It is reported that no less than 43 components have been isolated and identified from bezoar and its substitutes, mainly bile pigments, bile acids, amino acids, proteins, cholesterol and trace elements. Among them, bile pigments and bile acid compounds are considered to be the main active ingredients of bezoar and its substitutes and important indicators for quality evaluation. Our research group conducted research on the formation mechanism, pharmacological basis and mechanism of action of natural bezoar earlier, and first revealed that the main pharmacological substance of natural bezoar is active bile acid component, pointing out that its formation mechanism is the fermentation and transformation of bile acid in vivo mediated by gallbladder (tract) inflammatory pathogens, that is, bile is fermented and transformed under the action of bacteria to produce a variety of active bile acids and their derivatives, which constitute the main pharmacological basis of bezoar.

[0006] Therefore, there is an urgent need to provide a method for preparing a bezoar substitute that has high bile acid and deoxycholic acid content and is similar to the composition of natural bezoar. Summary of the invention

[0007] The present invention aims at the problems existing in the prior art and provides a method for preparing bionic bezoar by in vitro fermentation and enzyme engineering bioengineering technology. The method adopts the principle of synthetic biology: constructing a synthase plasmid, using engineered bacteria to highly express the target synthase, using natural bovine bile as a substrate, using engineered bacteria, synthase or bezoar-forming bacteria as any form of fermentation biological reaction system, and transforming the substances in the bovine bile by in vitro fermentation or enzyme transformation to prepare bionic bezoar, which is highly consistent with the components of natural bezoar, wherein the content of bile acid (CA) is 8.5%-20.0%, the content of deoxycholic acid (DCA) is 2.0%-6.5%, and the similarity of liquid fingerprint spectrum is ≥88.0%. The bionic bezoar prepared by this method has excellent quality, can replace the shortage of natural bezoar resources, protect animals, is easy to obtain, and achieves the same therapeutic effect as natural bezoar, and is used to adjust body metabolism, clear away heat and detoxify, upper respiratory tract infection, protect nerves, stroke, protect liver and gallbladder or reduce blood lipids.

[0008] The first aspect of the present invention is to provide a method for preparing bionic bezoar, wherein the method uses bezoar from bovine ( Bos taurus domesticus Gmelin ) as a fermentation substrate, construct a fermentation and / or enzymatic reaction system, and utilize fermentation and / or enzyme engineering bioengineering technology to prepare bionic bezoar.

[0009] Preferably, the fermentation and / or enzymatic reaction system is directly fermented in vitro using at least one of a synthetase plasmid, a synthetase high-expression engineered bacterium and a bezoar-forming bacterium as the fermentation strain.

[0010] Preferably, the species of bezoar-forming bacteria include: Lactobacillus sachsii ( Lactobacillus sakei )、St.Georgia Georgenia satyanarayanai )、Rompercoccus( Vagococcus fessus ) Lactobacillus curvus ( Lactobacillus curvatus ), Weissella cephalosporin Weissella ceti ), Bacillus siamensis ( Bacillus siamensis ) and Citrobacter freundii ( Citrobacter Freundii ), Escherichia coli ( Escherichia Coli ), Klebsiella pneumoniae ( Klebsiella pneumoniae )、Raoultia ornithinei Raoultella ornithino- lytica ) or Candida albicans ( Candida zeylanoides ) at least one of the following.

[0011] Preferably, the engineered bacterial vector is selected from Escherichia coli ( Escherichia Coli )、Yeast( Saccharomyces )、Lactic acid bacteria( Lactococcus lactis ) and Bifidobacterium ( Bifidobacterium ) at least one of the following.

[0012] Preferably, the synthase is at least one selected from bile salt hydrolase (BSH), 7α-steroid dehydrogenase (7α-HSDH), 7β-steroid dehydrogenase (7β-HSDH) and 7α-dehydroxylase.

[0013] Preferably, the engineered bacteria are prepared by the following steps: (1) Construction of overexpression plasmids of BSH, 7α-HSDH, 7β-HSDH, and 7α-dehydroxylase; (2) Construction of engineered strains: Introducing the recombinant plasmid into the vector strain Escherichia coli and / or yeast and / or lactic acid bacteria and / or Bifidobacterium, and screening for transgenic engineered strains that stably and highly express BSH, 7α-HSDH, 7β-HSDH, and 7α-dehydroxylase; (3) Expand and culture the engineered strain.

[0014] Preferably, the bionic bezoar is prepared by fermentation bioengineering technology, and the specific process is as follows: The bezoar-forming bacteria isolated from the synthetic enzyme high-expression engineered bacteria and / or natural bezoar are taken, natural ox bile is used as a substrate, ox blood and nutrient medium are added or not, placed in a fermentation tank, fermented for 7-30 days, dried at low temperature, and formed to obtain bionic bezoar.

[0015] Preferably, the bionic bezoar is prepared by enzyme engineering and bioengineering technology, and the specific process is as follows: The natural cow bile is used as a substrate, cow blood and nutrient medium are added or not, at least one synthetic enzyme selected from bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase and 7α-dehydroxylase is added, the mixture is placed in a bioreactor, reaction conditions are controlled, the mixture is reacted for 10-36 hours, low-temperature dried and formed, and thus bionic bezoar is obtained.

[0016] The second aspect of the present invention relates to a bionic bezoar, which is prepared by the above-mentioned preparation method.

[0017] The third aspect of the present invention relates to the use of the bionic bezoar prepared by the above-mentioned preparation method in the preparation of a natural bezoar substitute product for adjusting body metabolism, clearing away heat and detoxifying, upper respiratory tract infection, protecting nerves, stroke, protecting the liver and promoting bile secretion, or lowering blood lipids.

[0018] Preferably, the natural bezoar substitute product is a medicine, a health product or a cosmetic.

[0019] Compared with the prior art, the present invention has the following beneficial effects: (1) Based on the principle of enzymatic synthetic biology, the present invention realizes the conversion and generation of bionic bezoar active bile acid, wherein the bile acid content is 8.5%-20.0%, the deoxycholic acid content is 2.0%-6.5%, and the liquid fingerprint spectrum similarity is ≥88.0%; (2) The bionic bezoar prepared by the present invention has excellent quality and can replace the shortage of natural bezoar resources. The bionic bezoar obtained by the preparation method of the present invention has a high content of active related substances, has the characteristics of protecting animals, being easy to obtain, and achieving the same therapeutic effect as natural bezoar. The bionic bezoar prepared by the present invention is used to adjust the body's metabolism, clear away heat and detoxify, treat upper respiratory tract infections, protect nerves, treat stroke, protect the liver and promote bile secretion, and lower blood lipids, and the effect is better than that of each comparative example. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : UPLC-MS detection of bile acid components in natural bezoar and bionic bezoar, where a is natural bezoar and b is bionic bezoar; numbers 1-9 in the figure represent different chemical components, where 1: sodium taurocholate, 2: sodium glycocholate, 3: sodium taurochenodeoxycholate, 4: taurochenodeoxycholic acid, 5: cholic acid, 6: sodium glycochenodeoxycholate, 7: glycochenodeoxycholic acid, 8: chenodeoxycholic acid, 9: deoxycholic acid; Figure 2 : Infrared spectra of ten batches of natural bezoar; Figure 3 : Infrared spectra of ten batches of bionic bezoar; Figure 4 : HPLC chromatograms of ten batches of natural bezoar (left) and biomimetic bezoar (right), where 1 is cholic acid (CA) and 2 is deoxycholic acid (DCA); Figure 5 : Similarity spectrum of natural bezoar, ox bile and bionic bezoar, wherein S1 is natural bezoar, S2 is ox bile, and S3-S5 are bionic bezoars prepared by the method of embodiment 1 of the present invention; Figure 6 : Effects on the convulsive behavior of rats, where: a is the effect on the convulsion latency, b is the effect on the convulsion duration, and c is the effect on the convulsion attack grade; Figure 7 : Effects on the levels of inflammatory factors in rat hippocampal tissue, where: a is the effect on TNF-α content, b is the effect on IL-6 content, and c is the effect on IL-1β content. DETAILED DESCRIPTION

[0021] Experimental Example 1: The bezoar-forming bacteria were isolated from natural bezoar metagene sequencing and plate streaking. The metagene sequencing results are shown in Table 1. The top five dominant bacteria in terms of the abundance of natural bezoar metagene sequencing are: Lactobacillus salviae Lactobacillus sakei )、St.Georgia Georgenia satyanarayanai )、Rompercoccus( Vagococcus fessus ) Lactobacillus curvus ( Lactobacillus curvatus ), Weissella cephalosporin Weissella ceti ).

[0022] Table 1: Metagenetic detection of natural bezoar-forming bacteria

[0023] The natural bezoar was isolated by plate streaking method. Six strains were obtained through morphological, microscopic and sequencing identification, including five bacterial strains and one fungal strain, namely Bacillus siamense ( Bacillus siamensis ) and Citrobacter freundii ( Citrobacter Freundii ), Escherichia coli ( Escherichia Coli ), Klebsiella pneumoniae ( Klebsiella pneumoniae )、Raoultia ornithinei Raoultella ornithino-lytica ) or Candida albicans ( Candida zeylanoides The fungal ITS and bacterial 16S universal primers were used to amplify the genomic DNA of the isolated bacterial species, and the target gene fragments obtained by PCR were subjected to Sanger sequencing. The sequencing results are shown in Table 2.

[0024] Table 2: Sanger sequencing of bacterial isolates from plates

[0025] Experimental Example 2: Construction of engineered bacteria The construction of the engineered bacteria is to introduce bile salt hydrolase (BSH) (nucleotide sequence see SEQ NO.1), 7α-steroid dehydrogenase (7α-HSDH) (nucleotide sequence see SEQ NO.2), 7β-steroid dehydrogenase (7β-HSDH) (nucleotide sequence see SEQ NO.3), 7α-dehydroxylase (7α-dehydroxylase) (nucleotide sequence see SEQ NO.4) synthase into the engineered bacteria to obtain Escherichia coli (E.coli / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), yeast ( Saccharomyces / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), lactic acid bacteria ( Lactococcus lactis / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), and Bifidobacterium ( Bifidobacterium / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase) transgenic (genetically modified) engineered bacteria.

[0026] SEQ ID NO.1: Bile salt hydrolase (EF536029.1) ATGTGTACTGGTTTAAGATTCACAGATGATCAAGGAAATTTATACTTTGGCCGTAATCTAGATGTTGGACAGGATTATGGCGAAGGCGTTATTATTACGCCGGGTAATTATCCTCTTCCATATAAGTTCTTAGATAACACCACTACTAAAAAGGCTGTTATTGGAATGGGAATTGTGGTTGATGGCTATCCATCATACTTTGACTGCTATAACGAAGATGGATTAGGCATTGCAGGTTTAAACTTCCCACATTTTGCTAAATTTAGTGATGGTCCTATTGACGGTAAAATCAACTTAGCTTCTTACGAAATTATGCTCTGGGTTACTCAAAACTTTACTCATGTTAGTGAAGTAAAGGAAGCGTTAAAGAATGTTAACTTAGTGAATGAAGCTATTAACACATCATTTGCGGTTGCCCCTCTTCACTGGATCATTAGTGATAGTGACGAAGCCATTATTGTTGAAGTTTCAAAACAATATGGAATGAAAGTCTTTGATGATAAAGTTGGCGTTTTAACTAATAGCCCTGACTTTAACTGGCACCTTACTAACCTTGGTAACTATACTGGTTTAAATCCACATGACGCTACAGCCCAAAGCTGGAACGGTCAAAAAGTTGCTCCTTGGGGTGTAGGAACTGGTAGTTTAGGTCTGCCTGGTGACAGCATTCCAGCCGACCGTTTTGTTAAAGCTGCTTACTTAAACGTAAACTATCCAACTGCTAAAGGTGAAAAAGCAAACGTCGCTAAATTCTTTAACATCTTAAAGTCTGTTGCCATGATCAAAGGCAGTGTAGTCAACGATCAAGGCAAGGACGAATATACTGTTTATACTGCATGCTACTCTTCTGGAAGCAAGACTTACTACTGTAATTTTGAAGATGATTTTGAATTAAAGACTTATAAACTAGATGATCACACGATGAATTCAACCAGTCTTGTGACTTACTAG SEQ ID NO.2: 7α-Hydroxysteroid dehydrogenase (JN191345.1) ATGAAAAGATTAGAAGGAAAAGTCGCAATAGTAACATCATCTACTAGAGGAATAGGACGTGCATCTGCAGAAGCATTAGCAAAAGAAGGTGCTTTAGTATATCTAGCAGCACGTTCAGAGGAATTAGCTAATGAAGTTATAGCAGATATAAAAAAGCAAGGTGGAGTAGCTAAGTTTGTTTACTTTAATGCTAGAGAAGAAGAAACTTACACTTCAATGGTAGAAAAAGTTGCTGAAGCTGAAGGCAGGATAGATATATTAGTTAATAACTACGGTGGAACAAATGTTAATTTAGATAAGAACTTAACTGCTGGAGATACAGATGAATTCTTTAGAATATTAAAAGATAACGTTCAAAGTGTATACTTACCAGCAAAAGCTGCTATACCACATATGGAAAAAGTAGGCGGTGGAAGCATAGTTAATATCTCAACTATAGGATCAGTTGTTCCAGATATATCAAGAATAGCTTACTGTGTATCAAAATCCGCTATAAACTCTTTAACTCAAAACATAGCATTACAATATGCAAGAAAGAATATCAGATGTAATGCAGTATTACCTGGTTTAATAGGAACTAGAGCAGCACTCGAAAATATGACTGATGAATTTAGAGACTCATTCTTAGGACATGTTCCTTTAAATAGAGTAGGAAGACCAGAAGATATAGCAAATGCAGTTTTATACTATGCCTCTGATGATTCAGGTTATGTAACAGGAATGATTCATGAAGTTGCAGGAGGTTTTGCATTAGGAACTCCTCAATATTCAGAATACTGTCCAAGATAA SEQ ID NO.3: 7β - Hydroxysteroid Dehydrogenase (KF052988.1) ATGACATTGAGAGAAAAATATGGAGAATGGGGAATTATTTTAGGCGCTACTGAAGGTGTCGGAAAAGCATTTTGTGAAAGGCTTGCCAAAGAAGGTATGAATGTCGTAATGGTCGGACGCCGTGAAGAAAAATTAAAAGAGCTCGGTGAGGAACTAAAAAACACTTATGAGATTGATTATAAAGTCGTAAAAGCAGACTTTTCGCTGCCAGATGCTACTGACAAAATTTTTGCTGCAACAGAAAATCTGGATATGGGATTTATGGCCTATGTAGCCTGCTTACACTCTTTTGGCAAAATCCAGGATACACCTTGGGAAAAGCATGAGGCAATGATCAACGTAAACGTTGTTACATTTATGAAATGCTTCTATCACTATATGAAAATCTTTGCTGCACAGGATCGCGGTGCTGTCATCAACGTATCTTCTATGACTGGAATTTCCAGTTCACCATGGAATGGCCAATATGGTGCAGGAAAGGCATTCATTTTAAAAATGACAGAGGCTGTTGCCTGTGAAACGGAAAAGACCAATGTTGATGTGGAAGTCATCACTTTGGGAACTACTCTGACACCAAGTCTTTTAAGCAACCTGCCTGGCGGACCACAGGGGGAAGCTGTTATGAAGACTGCTCAAACACCGGAAGAAGTTGTGGACGAAGCTTTTGAAAAATTAGGAAAAGAACTGTCTGTCATTTCCGGAGAGCGTAATAAAGCCAGCGTCCATGACTGGAAAGCGAATCATACAGAAGATGACTATATCCGCTATATGGGATCTTTCTATCAAGAATAA SEQ ID NO.4: 7α - dehydroxylase (M15813.1) TCGATACGATACTTTGGCAGATATGATAAGCCAAAGGAAAAGAAAGGAAGGAAAAGTTCATGAAACTTGTACAGGACAAAATTACAATTATCACAGGCGGAACCTGGAATCGGATTCGCAGCAAAACTCTTTATTGAGAATGGAGCAAAAGTCTCCATATTTGGCGAGACCCAGGAAGAGGTAGACACAGCGCTGGCTCAGTTAAAGGAACTCTATCCG Example 1: Preparation of bionic bezoar by fermentation of natural bezoar-forming bacteria Take fresh cow bile, sterilize it at 121℃, 15psi high pressure steam for 20min, cool it to 37℃, add 20% anticoagulant cow blood, add 5% of the mass of fresh cow bile, and add Lactobacillus salkei ( Lactobacillus_sakei )、St.Georgia Georgenia_satyanarayanai )、Rompercoccus( Vagococcus_fessus ), Lactobacillus curvatus, Weissella cephalus Weissella ceti ) (the mass ratio of the five bacteria is 1:1:1:1:1), the mixed strains are fermented at 37°C, pH 7.0-8.0, and the fermentation is carried out for 25 days. The fermentation product is freeze-dried to obtain bionic bezoar. The HPLC-ELSD method determines that the content of bile acid (CA) is 13.252%, and the content of deoxycholic acid (DCA) is 3.076%, which meets the standard of natural bezoar.

[0027] Example 2: Preparation of bionic bezoar by fermentation of Escherichia coli (E.coli / BSH, 7α-HSDH), lactic acid bacteria (Lactococcus lactis / 7β-HSDH) and Bifidobacterium (Bifidobacterium / 7α-dehydroxylase) transgenic (genetically modified) engineering bacteria Fresh bovine bile was sterilized at 121℃, 15psi high pressure steam for 20min, cooled to 37℃, added with 20% anticoagulant bovine blood, and added with 5% of fresh bovine bile mass of mixed bacteria (mass ratio 3:1:1) consisting of Escherichia coli (E.coli / BSH, 7α-HSDH), lactic acid bacteria (Lactococcuslactis / 7β-HSDH) and Bifidobacterium (Bifidobacterium / 7α-dehydroxylase), fermented at 37℃, pH 7.0-8.0 for 15 days, and then freeze-dried to obtain bionic bezoar. The CA content was 17.635% and the DCA content was 4.501% determined by HPLC-ELSD method, reaching the standard of natural bezoar.

[0028] Example 3: Preparation of bionic bezoar by enzyme engineering method Fresh bovine bile was sterilized at 121°C, 15 psi high pressure steam for 20 min, and then a mixed enzyme extract consisting of bile salt hydrolase (BSH), 7α-steroid dehydrogenase (7α-HSDH), 7β-steroid dehydrogenase (7β-HSDH), and 7α-dehydroxylase (7α-dehydroxylase) was added (mass ratio 2:1:1:1), with an enzyme dosage of 0.1 mg / mL and 0.25 mM nicotinamide adenine dinucleotide phosphate (NADP) + ), under the conditions of reaction temperature of 37 ℃ and pH value of 7.0-8.0, fully stirred at 300 rpm, and freeze-dried after 24 hours to obtain bionic bezoar. The CA content was 16.334% and the DCA content was 4.027% measured by HPLC-ELSD method, reaching the standard of natural bezoar.

[0029] Example 4: Preparation of bionic bezoar by mixed fermentation of bile salt hydrolase (BSH) and natural bezoar isolate Fresh bovine bile was sterilized at 121℃, 15psi high pressure steam for 20min, cooled to 37℃, and anticoagulated bovine blood was added at 20% for standby use. Bacillus siamensis, Citrobacter Freundii, Escherichia Coli, Klebsiella pneumoniae, Raoultella ornithinolytica and Candida zeylanoides (1:1:1:1:1:1) were taken, and the amount of bacteria added was 6% of the mass of fresh bovine bile; bile salt hydrolase (BSH) was added, and the enzyme dosage was 0.1 mg / mL. Fermentation was carried out at a fermentation temperature of 37℃ and a pH value of 7.0-8.0 for 7 days, and the fermentation product was freeze-dried to obtain bionic bezoar. The CA content was 17.0465% and the DCA content was 4.922% determined by HPLC-ELSD method.

[0030] Comparative Example 1: The difference from Example 1 is that the bacterial species Lactobacillus sharkii, St. Georgina and Randlococcus in Example 1 are replaced by Cryptococcus carinii, Pseudomonas syringae and Enterococcus flavus.

[0031] Fresh bovine bile was sterilized at 121°C, 15psi high pressure steam for 20min, cooled to 37°C, added with 20% anticoagulant bovine blood, and added with 5% of the mass of fresh bovine bile, a mixed bacteria consisting of Vagococcus carniphilus, Pseudomonas syringae, Enterococcus pallens, Lactobacillus curvatus, and Weissella ceti (the mass ratio of the five bacteria was 1:1:1:1:1), and the mixed bacteria were fermented at 37°C, pH 7.0-8.0, and fermented for 25 days, and the fermented product was freeze-dried. The cholic acid (CA) content was 3.557% and the deoxycholic acid (DCA) content was 1.133% as determined by HPLC-ELSD.

[0032] Comparative Example 2: Preparation of bionic bezoar by fermentation of Bacillus subtilis (BSH, 7α-HSDH), Lactococcus lactis (7β-HSDH) and Bifidobacterium (7α-dehydroxylase) transgenic (genetically modified) engineering bacteria The difference from Example 2 is that the Escherichia coli engineered strain in Example 2 is replaced by the Bacillus subtilis engineered strain.

[0033] Fresh bovine bile was sterilized at 121°C, 15psi high pressure steam for 20min, cooled to 37°C, added with 20% anticoagulant bovine blood, and added with 5% of the mass of fresh bovine bile, Bacillus subtilis (Pichia pastoris / BSH, 7α-HSDH), lactic acid bacteria (Lactococcus lactis / 7β-HSDH) and Bifidobacterium (Bifidobacterium / 7α-dehydroxylase) (mass ratio of 3:1:1), fermented at 37°C, pH 7.0-8.0 for 15 days, and then freeze-dried. The CA content was 5.265% and the DCA content was 1.192% as determined by HPLC-ELSD.

[0034] Comparative Example 3: Preparation of bionic bezoar by enzyme engineering method The difference from Example 3 is that the bile salt hydrolase and 7α-dehydroxylase in Example 3 are replaced by β-galactosidase and lactate dehydrogenase.

[0035] Fresh bovine bile was sterilized by high-pressure steam sterilization at 121°C and 15 psi for 20 min, and crude extracts of β-galactosidase, 7α-steroid dehydrogenase (7α-HSDH), 7β-steroid dehydrogenase (7β-HSDH), and lactate dehydrogenase (Lactate dehydrogenase) (2:1:1:1) were added, with an enzyme dosage of 0.1 mg / mL and 0.25 mM NADP + The reaction temperature was 37 °C, the pH value was 7.0-8.0, and the mixture was stirred at 300 rpm. After 24 h, the product was freeze-dried. The CA content was 4.621% and the DCA content was 1.033% as measured by HPLC-ELSD.

[0036] Test Example 1: The similarity between natural bezoar and bionic bezoar in Example 1 was detected by using 9 bile acid components as indicators. The natural bezoar and bionic bezoar were crushed, passed through a 50-mesh sieve, 3 g was dissolved in 10 mL of 80% methanol, ultrasonically extracted for 30 min, and filtered. UPLC-MS detected the bile acid components of natural bezoar and bionic bezoar. The results showed that the main components of bionic bezoar and natural bezoar were basically the same, and the bile acid, chenodeoxycholic acid, and deoxycholic acid contents of bionic bezoar were slightly higher than those of natural bezoar. Figure 1 ; Infrared spectrometer was used to test ten batches of natural bezoar and bionic bezoar. The results showed that there was almost no difference in the infrared spectra of natural bezoar and bionic bezoar, except for the range of 1000-1500 cm -1 The number of peaks in the absorption peak range of bionic bezoar is slightly more than that of natural bezoar, as shown in Figure 2 and Figure 3 HPLC-ELSD method was used to evaluate the similarity of natural bezoar, bionic bezoar and fresh bile. The chromatograms of bionic bezoar and natural bezoar showed obvious CA and DCA peaks, while the chromatogram of ox bile showed almost no CA and DCA peaks. The similarity between natural bezoar and fresh ox bile was 60.4%, and the similarity between natural bezoar and bionic bezoar was 91.3%. Figure 4 and Figure 5 .

[0037] The results of UPLC-MS, infrared spectrum and HPLC-ELSD showed that the composition of bionic bezoar was basically the same as that of natural bezoar and it could be used as a substitute for natural bezoar.

[0038] Drug efficacy experiment 1: The lipid-lowering effect of bionic bezoar C57BL / 6 male mice, weighing 18-22 g, were purchased from Guangdong Medical Experimental Animal Center, license number SCXK (Guangdong) 2022-0002. After 7 days of adaptive feeding, they were randomly divided into a blank group, a model group, and a treatment group (natural bezoar high and low dose groups, bionic bezoar high and low dose groups prepared in Example 1-4, and bionic bezoar high and low dose groups prepared in Comparative Example 1-3), 8 mice in each group, and entered the experimental period. Among them, except for the blank group, the mice in the other groups were fed with high-fat and high-cholesterol feed for 5 consecutive weeks to induce a hyperlipidemia model. The mice in the treatment group were gavaged with high and low doses of natural bezoar, bionic bezoar prepared in Example 1-4, and Comparative Example 1-3 for 28 consecutive days, with dosages of 75 mg / kg and 300 mg / kg, respectively. The blank group and the model group were gavaged with the same dose of normal saline. The experimental results are shown in Table 3.

[0039] Table 3: Serum biochemical analysis results of mice in each group (x± s; n=8)

[0040] Note: Compared with the blank group, # P<0.05, ## P<0.01; compared with the model group, the treatment groups * P<0.05, ** P<0.01; Compared with Example 1-low, each treatment group & P<0.05, && P<0.01.

[0041] Compared with the model group, both the natural bezoar and the bionic bezoar prepared in Examples 1-4 can significantly reduce the levels of total cholesterol (TC), triglycerides (TG), and low-density lipoprotein cholesterol (LDC-C) in mice, and increase the level of high-density lipoprotein cholesterol (HDL-C), with significant differences, indicating that both the bionic bezoar prepared in Examples 1-4 and the natural bezoar can improve blood lipid levels, and the pharmacological effects of the two are basically the same. The effect of the bionic bezoar prepared in Comparative Examples 1-3 is significantly lower than that of the bionic bezoar prepared in Examples 1-4.

[0042] Drug efficacy experiment 2: The liver-protective effect of bionic bezoar Kunming mice, male, weighing 22-25 g, were purchased from Guangdong Medical Experimental Animal Center, license number SCXK (Guangdong) 2022-0002. After 7 days of adaptive feeding, they were randomly divided into a blank group, a model group, and a treatment group (natural bezoar high and low dose groups, bionic bezoar high and low dose groups prepared in Example 1-4, and bionic bezoar high and low dose groups prepared in Comparative Example 1-3), with 8 mice in each group, and entered the experimental period. Among them, the treatment group was gavaged with low and high doses of natural bezoar, bionic bezoar prepared in Example 1-4, and bionic bezoar prepared in Comparative Example 1-3 for 7 consecutive days, with doses of 75 mg / kg and 300 mg / kg, respectively, and the blank group and the model group were gavaged with the same dose of normal saline. 2 hours after the last administration, except for the blank group, the mice in the other groups were intraperitoneally injected with 0.2% CCl4-olive oil solution to induce acute liver injury, with a dose of 2 mg / kg. The blank group was given an equal amount of olive oil, and blood was taken for biochemical analysis 24 hours later. The experimental results are shown in Table 4.

[0043] Table 4: Serum biochemical analysis results of mice in each group (x± s; n=8) Group AST(U / L) ALT(U / L) MDA (nmol / mg) SOD(U / mg) Blank Group 39.66±44.32 95.62±13.41 0.36±0.12 119.82±7.07 Model Group <![CDATA[462.81±62.83 ## ]]> <![CDATA[1487.77±133.42 ## ]]> <![CDATA[2.66±0.25 ### ]]> <![CDATA[87.61±7.41 ### ]]> natural-high <![CDATA[209.91±40.09 ** ]]> <![CDATA[772.79±76.71 ** ]]> <![CDATA[1.05±0.32 ** ]]> <![CDATA[112.18±10.99 ** ]]> Natural-Low <![CDATA[221.17±65.72 ** ]]> <![CDATA[821.73±77.45 ** ]]> <![CDATA[1.09±0.34 ** ]]> <![CDATA[109.25±8.29 ** ]]> Example 1 - High <![CDATA[207.47±47.90 ** ]]> <![CDATA[781.91±82.93 ** ]]> <![CDATA[1.07±0.38 ** ]]> <![CDATA[110.64±13.31 ** ]]> Example 1 - Low <![CDATA[234.65±40.69 ** ]]> <![CDATA[852.72±78.42 ** ]]> <![CDATA[1.15±0.34 ** ]]> <![CDATA[107.43±9.97 ** ]]> Example 2 - High <![CDATA[210.91±50.14 ** ]]> <![CDATA[823.70±86.61 ** ]]> <![CDATA[1.08±0.29 ** ]]> <![CDATA[115.25±13.76 ** ]]> Example 2 - Low <![CDATA[239.17±40.62 ** ]]> <![CDATA[971.79±84.31 ** ]]> <![CDATA[1.18±0.40 ** ]]> <![CDATA[106.10±11.28 ** ]]> Example 3 - High <![CDATA[202.41±49.78 ** ]]> <![CDATA[870.34±90.71 ** ]]> <![CDATA[1.05±0.35 ** ]]> <![CDATA[113.15±12.49 ** ]]> Example 3 - Low <![CDATA[249.87±40.73 ** ]]> <![CDATA[972.75±79.26 ** ]]> <![CDATA[1.25±0.31 ** ]]> <![CDATA[98.56±10.33 * ]]> Example 4 - High <![CDATA[189.97±49.62 ** ]]> <![CDATA[780.49±80.16 ** ]]> <![CDATA[1.04±0.33 ** ]]> <![CDATA[116.78±13.85 ** ]]> Example 4 - Low <![CDATA[204.93±36.41 ** ]]> <![CDATA[882.55±66.61 ** ]]> <![CDATA[1.12±0.36 ** ]]> <![CDATA[101.34±14.09 ** ]]> Comparative Example 1-High <![CDATA[362.81±61.82 *& ]]> <![CDATA[1030.77±156.41 *& ]]> <![CDATA[1.81±0.20 *& ]]> <![CDATA[94.31±10.21 *& ]]> Comparative Example 1 - Low <![CDATA[387.76±66.27 *& ]]> <![CDATA[1087.41±130.45 *& ]]> <![CDATA[2.36±0.31 && ]]> <![CDATA[90.78±8.39 && ]]> Comparative Example 2-High <![CDATA[343.09±57.12 *& ]]> <![CDATA[1022.07±158.02 *& ]]> <![CDATA[2.01±0.25 *& ]]> <![CDATA[89.68±7.88 && ]]> Comparative Example 2 - Low <![CDATA[365.19±63.62 *& ]]> <![CDATA[1153.60±144.21 && ]]> <![CDATA[2.27±0.28 && ]]> <![CDATA[90.40±12.07 && ]]> Comparative Example 3-High <![CDATA[347.65±68.33 *& ]]> <![CDATA[1058.49±130.90 *& ]]> <![CDATA[2.06±0.35 *& ]]> <![CDATA[95.94±10.06 *& ]]> Comparative Example 3 - Low <![CDATA[365.77±59.46 *& ]]> <![CDATA[1207.56±129.48 && ]]> <![CDATA[2.24±0.39 && ]]> <![CDATA[92.76±12.16 && ]]> Note: Compared with the blank group, # P<0.05, ## P<0.01; compared with the model group, the treatment groups * P<0.05, ** P<0.01; compared with Example 1-low group, each treatment group & P<0.05, && P<0.01.

[0044] Compared with the model group, the natural bezoar and the bionic bezoar prepared in Examples 1-4 can significantly reduce the levels of liver function indicators AST and ALT, reduce the level of oxidative stress indicator MDA, and increase the level of superoxide dismutase SOD in liver tissue, indicating that the bionic bezoar and natural bezoar prepared in Examples 1-4 have antioxidant and liver protection effects, and the two have basically the same efficacy. The high dose of Comparative Examples 1-3 has a certain positive regulatory effect on the AST, ALT, MDA and SOD content of the acute liver injury model, but the overall effect is significantly weaker than that of Example 1. The regulatory effect of the AST, ALT, MDA and SOD content of the acute liver injury model, the antioxidant and liver protection efficacy of the bionic bezoar and natural bezoar obtained in Examples 1-4 are basically the same, better than Comparative Examples 1-3.

[0045] Pharmacological Experiment 3: Anti-hyperpyretic convulsion effect of bionic bezoar SD rats, male, weighing 40-60 g, were purchased from Guangdong Medical Experimental Animal Center, license number: SCXK (Yue) 2022-0002. After 5 days of adaptive feeding, they were randomly divided into a blank group, a model group, and a treatment group (natural bezoar high and low dose groups, bionic bezoar high and low dose groups prepared in Example 1-4, and bionic bezoar high and low dose groups prepared in Comparative Example 1-3), 8 rats in each group, and entered the experimental period. Except the blank group, rats in other groups were stimulated with 45 ± 0.5 ℃ hot water on the morning of the 1st, 3rd, 5th, 7th, 9th, 11th, 13th and 15th days of the experiment to construct a febrile convulsion rat model. On the second day of the experiment, except for the blank group and the model group, the other groups began to be gavaged every afternoon until the 15th day of the experiment. Specifically, the positive drug group (positive) was gavaged with 50 mg / kg•bw of sodium valproate every day, the natural bezoar, Example 1-4 and Comparative Example 1-3 groups were gavaged with low and high doses of natural bezoar, and the bionic bezoar prepared in Example 1-4 and Comparative Example 1-3 every day, with the low and high doses being 300 mg / kg•bw and 900 mg / kg•bw, respectively. The blank group and the model group were gavaged with an equal amount of normal saline. On the second day after the experiment, the rats' convulsive behavior, including convulsion latency, convulsion duration, and convulsion attack level, was tested. After the test, the rats in each group were anesthetized with isoflurane inhalation, and the hippocampal tissue was taken. Elisa kits were used to detect the levels of TNF-α, IL-6, and IL-1β in the hippocampal tissue. The experimental results are shown in Figure 6 and Figure 7 (Note: Compared with the Model group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 in each drug-treated group; the symbols of the groups are explained as follows: Control represents the blank group, Model represents the convulsion model group, Positive represents the positive drug group, DL represents the natural bezoar low-dose group, DH represents the natural bezoar high-dose group, FD1-L represents the bionic bezoar low-dose group in Example 1, FD1-H represents the bionic bezoar high-dose group in Example 1, FD2-L represents the bionic bezoar low-dose group in Example 2, FD2-H represents the bionic bezoar high-dose group in Example 1, -H represents the high-dose group of bionic bezoar in Example 2, FD3-L represents the low-dose group of bionic bezoar in Example 3, FD3-H represents the high-dose group of bionic bezoar in Example 3, FD4-L represents the low-dose group of bionic bezoar in Example 4, FD4-H represents the high-dose group of bionic bezoar in Example 4, VFD1-L represents the low-dose group of Comparative Example 1, VFD1-H represents the high-dose group of Comparative Example 1; VFD2-L represents the low-dose group of Comparative Example 2, VFD2-H represents the high-dose group of Comparative Example 2; VFD3-L represents the low-dose group of Comparative Example 3, VFD3-H represents the high-dose group of Comparative Example 3; n=8) Compared with the high fever convulsion model group, the bionic bezoar and natural bezoar treatment of Example 1-4 groups significantly shortened the duration of convulsions in rats, reduced the severity of convulsions in rats, and reduced the expression levels of TNF-α, IL-6, and IL-1β in hippocampal tissue, indicating that the bionic bezoar and natural bezoar of Example 1-4 groups both have the effects of inhibiting inflammation and resisting high fever convulsions, and the pharmacodynamic effects of the two are basically the same. At the same time, the effect of Example 1-4 groups is significantly better than that of Comparative Examples 1-3.

[0046] Through the above research, a method for preparing bionic bezoar by in vitro fermentation and enzyme engineering and bioengineering technology was constructed. According to the conversion rules of cattle bile components and components contained in natural bezoar, synthetic enzyme plasmids were constructed, and (or) engineered bacteria with high expression of synthetic enzymes were screened, and (or) bezoar-forming bacteria isolated from natural bezoar were used as fermentation strains for direct in vitro fermentation. Any combination of enzymes, engineered bacteria, and bezoar-forming bacteria can form the bionic bezoar with the highest degree of bionics.

[0047] The prepared bionic bezoar has basically the same medicinal effects as natural bezoar in adjusting body metabolism, clearing away heat and detoxifying, treating upper respiratory tract infection, protecting nerves, treating stroke, protecting the liver and promoting bile secretion, or treating diseases related to lowering blood lipids, and can be used as a substitute for natural bezoar.

Claims

1. A method for preparing a bionic bezoar, characterized in that: The preparation method uses natural cow bile as a fermentation substrate and utilizes a fermentation and / or enzymatic reaction system to prepare bionic bezoar, wherein The fermentation and / or enzymatic reaction system is selected from at least one of a synthetase plasmid, a synthetase high-expression engineering bacterium and a bezoar-forming bacterium as a fermentation strain for direct in vitro fermentation; The species of the bezoar-forming bacteria include: at least one of Lactobacillus sharkii, St. Georgina, Rover, Lactobacillus curvatus, Weissella cereus, Bacillus siamensis, Citrobacter freundii, Escherichia coli, Klebsiella pneumoniae, Raoultella ornithinesotheci and Candida albicans; The vector of the synthetic enzyme high-expression engineering bacteria is selected from at least one of Escherichia coli, yeast, lactic acid bacteria and Bifidobacterium; The synthetase plasmid is selected from at least one of bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase and 7α-dehydroxylase.

2. The method for preparing bionic bezoar according to claim 1, wherein: The engineered bacteria are prepared by the following steps: (1) Construction of plasmids overexpressing bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase, and 7α-dehydroxylase; (2) Construction of engineered strains: Introducing the recombinant plasmid into the vector strain Escherichia coli and / or yeast and / or lactic acid bacteria and / or Bifidobacterium to screen for transgenic engineered strains that stably and highly express bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase and 7α-dehydroxylase; (3) Expand and culture the engineered strain.

3. The method for preparing bionic bezoar according to claim 1, wherein: The bionic bezoar is prepared by fermentation bioengineering technology, and the specific process is as follows: The bezoar-forming bacteria isolated from the synthetic enzyme high-expression engineering bacteria and / or natural bezoar are taken, natural cattle bile is used as a substrate, cattle blood and nutrient medium are added or not, fermented for 7-30 days, freeze-dried, and formed to obtain bionic bezoar.

4. The method for preparing bionic bezoar according to claim 1, wherein: The bionic bezoar is prepared by enzyme engineering and bioengineering technology, and the specific process is as follows: The bionic bezoar is obtained by using natural bovine bile as a substrate, adding or not adding bovine blood and nutrient medium, adding at least one synthase of bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase and 7α-dehydroxylase, reacting for 10-36 hours, freeze-drying and forming.

5. A bionic bezoar, characterized in that The bionic bezoar is prepared by the preparation method according to any one of claims 1 to 4.

6. Use of the bionic bezoar prepared by the preparation method according to any one of claims 1 to 4 or the bionic bezoar according to claim 5 in preparing a natural bezoar substitute product for adjusting body metabolism, clearing away heat and detoxifying, upper respiratory tract infection, protecting nerves, stroke, protecting the liver and promoting bile secretion, or lowering blood lipids.

7. The use according to claim 6, wherein the natural bezoar substitute product is a medicine, a health product or a cosmetic.

Images