Application of LMP1 expression inhibitor in regulation and control of MCM3 protein

Abstract

The invention belongs to the field of medicines, and discloses application of an LMP1 expression inhibitor in regulation and control of MCM3 protein. The inventor finds that the LMP1 protein is related to drug resistance of NKTCL cells to drugs synthesized by targeted DNA through research. The LMP1 interacts with a key protein MCM3 synthesized by DNA of a host, other signal channels, related to cell cycle regulation and DNA repair, of the host are influenced through the LMP1-MCM3 type, and overexpression of the LMP1 promotes survival of tumor cells and inhibits cell apoptosis, so that the effect of a chemotherapeutic drug is reduced; knockdown of the LMP1 can significantly enhance the sensitivity of cells to drugs. The function of MCM3 can be reduced by inhibiting the expression or function of LMP1. The interaction between EBV and host cells can be broken, and the curative effect of chemotherapeutic drugs such as cytarabine which are widely used clinically is improved. In addition, the strategy can also be used for preventing reactivation of EBV and reducing the occurrence risk of virus-related tumors.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and particularly relates to the application of an LMP1 expression inhibitor in regulating MCM3 protein. Background Art

[0002] NK / T cell lymphoma is a malignant tumor that is common in East Asia and Latin American indigenous peoples. 1 Most of the related types of peripheral T cell lymphoma (NKTLC) occur in China, including 47%-56% of peripheral T cell lymphoma and 10%-15% of non-Hodgkin lymphoma. 2,3 As the most common NK / T cell lymphoma in Asian countries, nasal NK / T cell lymphoma is highly associated with EBV (Epstein–Barr virus) infection and shows a very poor prognosis in advanced patients. 4–6 .

[0003] EBV infection is closely associated with NKTCL EBV infection is associated with a variety of lymphomas and epithelial cell tumors, especially in immunocompromised individuals, where latent EBV infection may lead to the development of malignancies. 7 In NKTCL, EBV infection is particularly important, and the latent state of the virus is closely related to the survival and proliferation of tumor cells. 8 EBV encodes a variety of proteins, especially latent membrane protein 1 (LMP1), which plays a key role in regulating the signal transduction pathways of host cells. 9,10 Although a deeper understanding of the interaction between EBV and NK / T-cell lymphoma has been gained in recent years, effective treatments for this disease remain limited.

[0004] There is no very effective targeted therapy for NKTCL. Anthracycline-based chemotherapy is a common treatment for nasal NK / T cell lymphoma. However, due to the high expression of P-glycoprotein in some nasal NK / T cell lymphomas, they become resistant to anthracyclines, and the actual treatment effect is very poor. 8 Therefore, in the early stage of ENKTCL, multiple treatment regimens including radiotherapy and non-anthracycline chemotherapy drugs are often used for treatment. Since NK cells lack asparagine synthetase, nasal NK / T cell lymphoma is highly sensitive to L-asparaginase. 11Currently, there are also immunotherapy options for ENKTCL in clinical trials, such as Daratumumab (anti-CD38 antibody) and Brentuximab vedotin (anti-CD30 antibody coupled to Auristatin E). 12 Other studies have shown that high expression of EBV latent membrane proteins LMP1 and LMP2 activates the NF-κB / MAPK signaling pathway, leading to high expression of PD-L1 in ENKTL. Treatment targeting PD-1 has also shown a certain effect. 8 Therefore, the development of new therapeutic drugs and strategies is crucial to improve treatment efficacy.

[0005] LMP1 (Epstein-Barr virus membrane protein 1, Latent Membrane Protein 1) is an important tumor virus protein that promotes cell survival, proliferation and transformation mainly by affecting cell signaling pathways. In studies related to drug resistance, the expression and function of LMP1 are associated with a variety of mechanisms that can lead to resistance to cancer treatment. Possible mechanisms of LMP1-mediated drug resistance include: 1. Signal transduction activation: LMP1 promotes cell survival and anti-apoptosis by activating multiple downstream signal transduction pathways, such as NF-κB, PI3K / Akt, and MAPK. This signal transduction activation may lead to resistance to chemotherapy and radiotherapy, as these treatments often rely on inducing cancer cell death.

[0006] 2. Changing the cell microenvironment: LMP1 can also change the microenvironment of tumor cells, increase changes in the extracellular matrix and promote tumor angiogenesis, which may affect the effective delivery of drugs and the response of cells to treatment.

[0007] 3. Cell cycle regulation: By regulating the expression of cell cycle proteins and tumor suppressor proteins, LMP1 can affect the progression of the cell cycle, which may lead to resistance to certain anticancer drugs targeting the cell cycle (such as certain chemotherapy drugs).

[0008] 4. Regulation of gene expression: LMP1 can affect the expression of multiple genes including drug transporters and metabolic enzymes. Changes in these genes may directly affect drug metabolism and elimination, thereby affecting the therapeutic effect.

[0009] 5. Synergistic effect with other resistance mechanisms: The action of LMP1 may interact with other resistance mechanisms in cancer cells (such as overexpression of P-gp pump, enhancement of DNA repair mechanism, etc.), and jointly promote resistance to anticancer treatment.

[0010] LMP1 can enhance autophagy by upregulating the expression of BCL2 / adenovirus E1B 19kDa protein-interacting protein 3 (BNIP3). LMP1 promotes the binding of BNIP3 to Beclin1 through the ERK / HIF1α signaling axis and competitively reduces the binding of Bcl-2 to Beclin1, thereby upregulating autophagy. In addition, knockout of BNIP3 can reduce radioresistance mediated by protective autophagy in LMP1-positive nasopharyngeal carcinoma cells (Xu, S., Zhou, Z., Peng, X. et al. EBV-LMP1 promotes radioresistance by inducing protective autophagy through BNIP3 innasopharyngeal carcinoma. Cell Death Dis 12, 344 (2021). https: / / doi.org / 10.1038 / s41419-021-03639-2).

[0011] Studies have shown that EBV-encoded LMP1 promotes mitochondrial fission by activating Drp1, which is associated with a poor prognosis in nasopharyngeal carcinoma (NPC). In addition, EBV-LMP1 regulates Drp1 through two tumorigenic signaling axes—AMPK and cyclin B1 / Cdk1—that promote NPC cell survival and resistance to cisplatin. Targeting Drp1 in LMP1-positive NPC cells can disrupt mitochondrial function and induce cell death (Xie, L., Shi, F., Li, Y. et al. Drp1-dependent remodeling ofmitochondrial morphology triggered by EBV-LMP1increases cisplatin resistance. Sig Transduct Target Ther 5, 56 (2020). https: / / doi.org / 10.1038 / s41392-020-0151-9).

[0012] The study found that oncogenic Pim-1 was translocated to the cytoplasm by LMP1. Pim-1 enhanced the survival of cells overexpressing LMP1 under doxorubicin treatment; secondly, the nuclear export of Pim-1 was sufficient to improve the survival rate; thirdly, the knockout of Pim-1 effectively inhibited the LMP1-induced cancer cell survival. Pim-1 may be a downstream target of LMP1, and it contributes to the chemotherapy resistance of cancer cells (https: / / doi.org / 10.1016 / j.cellsig.2010.07.013).

[0013] LMP1 enhances the stability of PGC-1α protein by promoting the interaction between arginine methyltransferase 1 (PRMT1) and peroxisome proliferator-activated receptor coactivator-1α (PGC-1α), thereby increasing the methylation modification of PGC-1α and conferring anti-apoptotic (anoikis) ability to nasopharyngeal carcinoma (NPC) cells. At the same time, PGC-1α co-activates STAT3, transcriptionally upregulates PD-L1 expression, and mediates immune escape triggered by LMP1 (https: / / doi.org / 10.1186 / s13046-023-02835-6).

[0014] Cells that highly express LMP1 are associated with drug resistance in EBV-positive diffuse large B-cell lymphoma (DLBCL). These cells have enhanced survival after receiving CHOP combination chemotherapy, especially in the presence of exogenous IL4, which further enhances treatment resistance by upregulating anti-apoptotic genes. At the same time, the death of these high-expressing LMP1 cells can be effectively induced by inhibiting the NF-κB and STAT3 signaling pathways and combining them with CHOP treatment (https: / / doi.org / 10.18632 / oncotarget.15600).

[0015] In nasopharyngeal carcinoma (NPC) cells, LMP1 upregulates tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) resistance by enhancing the expression of X-linked inhibitor of apoptosis protein (XIAP). LMP1-positive NPC cells are more sensitive to TRAIL than LMP1-negative cells, but the sensitivity to TRAIL is reduced in the CNE-1 NPC cell line transfected with pGL6-LMP1. In addition, embelin, an inhibitor of XIAP, effectively prevents LMP1-induced TRAIL resistance but does not enhance TRAIL-induced apoptosis in the benign nasopharyngeal epithelial cell line NP-69 (https: / / doi.org / 10.3892 / ol.2016.4522).

[0016] LMP1 is localized to the inner membrane of mitochondria and inhibits the opening of the mitochondrial membrane permeability transition pore (mPTP) by binding to adenosine diphosphate / triphosphate transporter 1 (ANT1), thereby promoting tumor cell survival and drug resistance. In addition, the inventors identified a new mechanism by which EBV-LMP1 induces conformational changes in ANT1, which is associated with cisplatin resistance in nasopharyngeal carcinoma. The ANT1 conformational inhibitor carboplatin combined with cisplatin can improve the chemosensitivity of EBV-LMP1-positive cells (https: / / doi.org / 10.15252 / emmm.202114072).

[0017] LMP1 induces the expression of human microRNA-21 (miR-21) by activating the PI3K / Akt / FOXO3a signaling pathway, which further reduces the expression of programmed cell death 4 (PDCD4) and Fas ligament (Fas-L) and leads to chemoresistance of nasopharyngeal carcinoma (NPC) cells. The inventors observed that stably transformed LMP1 NPC cells were less sensitive to cisplatin treatment, which was associated with their proliferation, colony formation, half inhibitory concentration (IC50) of cisplatin, and apoptotic index. In addition, knockdown of miR-21 significantly reversed the resistance of NPC cells to cisplatin treatment (https: / / doi.org / 10.1371 / journal.pone.0078355).

[0018] LMP1 enhances the proliferation capacity of NKTCL cells, inhibits apoptosis, and reduces sensitivity to gemcitabine, thereby increasing aerobic glycolysis, which is manifested as an increase in glucose uptake, lactate production, and extracellular acidification rate. In addition, LMP1 competitively binds to TRAF3 and regulates the non-classical NF-κB pathway, thereby promoting cell proliferation and aerobic glycolysis. The expression of LMP1 is closely related to the patient's risk stratification, treatment response, and prognosis. Higher LMP1 expression indicates a higher maximum standardized uptake value (SUVmax) in NKTCL patients (https: / / doi.org / 10.1038 / s41419-024-06999-7).

[0019] LMP1 activates the MAPK / NF-κB pathway in natural killer T-cell lymphoma (NKTCL) cells, thereby upregulating the expression of soluble IL-2 receptor α (IL-2Rα). Overexpression of IL-2Rα in SNK-6 cells promotes cell proliferation by altering cell cycle distribution and inducing resistance to gemcitabine, doxorubicin, and asparagine. These effects can be reversed by anti-IL-2Rα antibodies, making this interleukin receptor a potential therapeutic target (https: / / doi.org / 10.1186 / s40880-018-0334-8).

[0020] References: 1.Fiore, D. et al. Peripheral T cell lymphomas: from the bench to the clinic. Nat. Rev. Cancer 20, 323–342 (2020). 2.Kimura, H.&Cohen, JI Chronic active Epstein-Barr virusdisease. Front. Immunol. 8, 1–6 (2017). 3. Kim, WY, Montes-Mojarro, IA, Fend, F. & Quintanilla-Martinez, L. Epstein-barr virus-associated T and NK-cell lymphoproliferativediseases. Front. Pediatr. 7, 1–18 (2019). 4. Tabibzadeh, A. et al. Molecular epidemiology of epstein-barr virus(ebv) in patients with hematologicmalignancies. Asian Pacific J. Cancer Prev. 21, 693–698 (2020). 5.Wang, H., Fu, B. bo, Gale, RP&Liang, Y. NK- / T-celllymphomas. Leukemia 35, 2460–2468 (2021). 6.Bauer, M., Jasinski-Bergner, S., Mandelboim, O.,Wickenhauser, C.&Seliger, B. Epstein–barr virus—associated malignancies and immune escape:The role of the tumormicroenvironment and tumor cell evasionstrategies. Cancers (Basel). 13, 1–34 (2021). 7.Shannon-Lowe, C.&Rickinson, A. The Global Landscape of EBV-Associated Tumors. Front. Oncol. 9, 1–23 (2019). 8.Montes-Mojarro, I. A., Fend, F.&Quintanilla-Martinez, L. Ebv andthe pathogenesis of nk / t cell lymphoma. Cancers (Basel). 13, 1–19 (2021). 9.Lavorgna, A.&Harhaj, E. W. EBV LMP1: New and shared pathways to NF-κB activation. Proc. Natl. Acad. Sci. 109, 2188–2189 (2012). 10.SUN, L., ZHAO, Y., SHI, H., MA, C.&WEI, L. LMP1 promotes nasal NK / T-cell lymphoma cell function by eIF4E via NF-κB pathway. Oncol. Rep. 34, 3264–3271 (2015). 11.Tian, X.-P. et al. Novel target and treatment agents for naturalkiller / T-cell lymphoma. J. Hematol. Oncol. 16, 78 (2023). 12.Van Doesum, J. A. et al.Extranodal Natural Killer / T-cell Lymphoma,Nasal Type: Diagnosis and Treatment. HemaSphere 1, 1–9 (2021). Summary of the invention

[0021] The purpose of the present invention is to overcome at least one deficiency of the prior art and provide the use of an LMP1 expression inhibitor in regulating MCM3 protein.

[0022] The technical solution adopted by the present invention is: The first aspect of the present invention provides: The use of LMP1 expression regulator in preparing MCM protein activity regulator for experiment is not used for treating diseases.

[0023] In some application examples, the MCM protein is MCM3.

[0024] In some application examples, the LMP1 expression regulator is selected from siRNA against LMP1 gene and antibody against LMP1 protein.

[0025] In some application examples, the MCM protein is MCM3, and the LMP1 expression regulator is selected from siRNA against LMP1 gene and antibody against LMP1 protein.

[0026] In some application examples, the nucleotide sequence of the siRNA is si1: GCTGTACATCGTTATGAGTGA or si2: GAGCCCTCCTTGTCCTCTATT.

[0027] In some application examples, the MCM protein is MCM3, the LMP1 expression regulator is selected from siRNA against LMP1 gene and antibody against LMP1 protein, and the nucleotide sequence of the siRNA is si1: GCTGTACATCGTTATGAGTGA or si2: GAGCCCTCCTTGTCCTCTATT.

[0028] The second aspect of the present invention provides: Application of LMP1 expression inhibitor, LMP1 protein activity inhibitor or LMP1 protein adsorbent in the preparation of DNA targeted chemotherapy drug enhancer.

[0029] In some application examples, the DNA targeted chemotherapy drug is selected from at least one of cytarabine, 6-mercaptopurine and cyclocytidine.

[0030] In some application examples, the LMP1 expression inhibitor is siRNA targeting the LMP1 gene; the LMP1 protein activity inhibitor is an antibody against the LMP1 protein, and the LMP1 protein adsorbent is coupled with the antibody against the LMP1 protein.

[0031] In some examples of applications, it is used for adjuvant therapy of NK / T cell lymphoma.

[0032] In some application examples, it is used for adjuvant therapy of NK / T cell lymphoma, which highly expresses LMP1.

[0033] In some application examples, the nucleotide sequence of the siRNA is si1: GCTGTACATCGTTATGAGTGA or si2: GAGCCCTCCTTGTCCTCTATT.

[0034] The third aspect of the present invention provides: use of an LMP1 expression inhibitor or an LMP1 protein activity inhibitor in the preparation of an experimental cell cycle regulator and / or DNA repair inhibitor.

[0035] In some application examples, the LMP1 expression inhibitor is siRNA targeting the LMP1 gene; the LMP1 protein activity inhibitor is an antibody against the LMP1 protein.

[0036] In some application examples, the nucleotide sequence of the siRNA is si1: GCTGTACATCGTTATGAGTGA or si2: GAGCCCTCCTTGTCCTCTATT.

[0037] The beneficial effects of the present invention are: The inventors' latest research found that the expression of LMP1 protein is related to the resistance of NKTCL cells to drugs targeting DNA synthesis, such as cytarabine. The inventors found that overexpression of LMP1 promotes the survival of tumor cells and inhibits apoptosis, thereby reducing the effect of chemotherapy drugs, and knocking down LMP1 can significantly enhance the sensitivity to drugs such as cytarabine. Mechanistically, the inventors found that LMP1 interacts with MCM3, a key protein in the host's DNA synthesis, through mass spectrometry analysis of interacting proteins. It is possible that LMP1-MCM3 can affect other signaling pathways related to cell cycle regulation and DNA repair in the host, further enhancing the drug resistance of tumor cells. By downregulating LMP1 or inactivating LMP1, the function of MCM3 can be reduced. Conversely, overexpression of LMP1 can promote or assist the function of MCM3.

[0038] Considering the role of LMP1 in NKTCL, the inventors proposed a new treatment strategy, namely, to enhance the sensitivity of tumor cells to DNA-targeted drugs by targeting LMP1. By inhibiting the expression or function of LMP1, the interaction between EBV and host cells can be broken, and the anti-DNA damage mechanism of tumor cells can be weakened, thereby improving the efficacy of widely used clinical chemotherapy drugs such as cytarabine. In addition, this strategy may also be used to prevent the reactivation of EBV and reduce the risk of virus-related tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 : Schematic diagram of LMP1 overexpression plasmid and immunoblot verification of overexpression cell line; A. Schematic diagram of LMP1 overexpression plasmid; B. WB verification of LMP1 overexpression in NKYS cells.

[0040] Figure 2 : LMP1 knockdown siRNA targeting sequence, immunoblotting verification of LMP1 knockdown cells: WB verification of LMP1 knockdown in NKYS cells.

[0041] Figure 3 to Figure 8 :RNA-seq analysis of the effect of LMP1 overexpression on host gene expression levels; Among them: Figure 3 , Perason correlation analysis of RNA-seq results of LMP1 overexpression and control cells; Figure 4 , GSEA correlation analysis of RNA-seq results of LMP1 overexpression and control cells; Figure 5 , Volcano plot of up- and down-regulated genes in RNA-seq of LMP1 overexpressing and control cells; Figure 6 to Figure 8 , GSEA correlation analysis of RNA-seq results of LMP1 overexpression and control cells, Figure 6 , GSEA cell cycle related genes; Figure 7 , GSEA DNA damage checkpoint; Figure 8 , GSEA DNA damage.

[0042] Fig. 9 :Mass spectrometry analysis of the interaction between LMP1 and host proteins; A. Enrichment analysis of LMP1-interacting protein pathways; B. List of potential binding proteins in the mass spectrometry results of LMP1-overexpressing cells.

[0043] Fig.10 :Verification of the interaction between LMP1 and host DNA replication protein MCM3; A. IP verification of the interaction between LMP1 and MCM; B. WB verification of overexpression of MCM3 in NKYS cells; C. IP verification of the interaction between MCM3 and LMP1; D. Immunofluorescence detection of the localization of LMP1 and MCM3 in cells.

[0044] Fig.11 :LMP1 overexpression enhances the resistance of tumor cells to DNA-targeted drugs such as cytarabine; A. IC50 curve of cytarabine in LMP1 overexpressing and control cells; B. Cell survival rate curve of LMP1 overexpressing and control cells treated with 0.5μM cytarabine; C. Flow cytometry detection of apoptosis ratio of LMP1 overexpressing and control cells treated with 0.5μM cytarabine.

[0045] Fig.12 :Targeting LMP1 makes tumor cells sensitive to DNA-targeted drugs such as cytarabine. A. IC50 curve of hexamercaptopurine in LMP1 overexpression and control cells; B. IC50 curve of cyclocytidine in LMP1 overexpression and control cells; C. Flow cytometry detection of the apoptosis ratio of LMP1 overexpression and control cells treated with 0.5μM hexamercaptopurine; D. Flow cytometry detection of the apoptosis ratio of LMP1 overexpression and control cells treated with 0.5μM cyclocytidine.

[0046] Fig.13 :Targeting LMP1 enhances the sensitivity of NKTCL to DNA-targeted drugs: A. IC50 curve of cytarabine in LMP1 knockdown and control cells; B. Flow cytometry detection of the apoptosis ratio of LMP1 knockdown and control cells treated with 0.5 μM cytarabine. DETAILED DESCRIPTION

[0047] The technical solution of the present invention is further explained below in conjunction with experiments.

[0048] Construction of LMP1 overexpressing plasmid and cell line: In order to explore the effect of EBV protein LMP1 on targeted therapy of NKTLC (nasopharyngeal NK / T cell lymphoma), the inventors designed and constructed a lentiviral vector that can express LMP1 fusion protein with Flag-tag in target cells. Figure 1 First, the inventors used gene cloning technology to insert the LMP1 gene fragment with a Flag-tag into a lentiviral transfer vector, and verified the correctness of the construction by Sanger sequencing.

[0049] Subsequently, the inventors transfected the constructed lentiviral vector into 293T cells to produce recombinant lentiviral particles, and then used these viral particles to infect NKYS cells, a cell line derived from NKTLC patients and widely used in NKTLC research.

[0050] In order to verify the overexpression level of LMP1 protein, the inventors used Western blot (WB) technology and used antibodies against Flag-tag and LMP1 for detection. The results of Western blot showed that compared with the control group, the expression of LMP1-Flag fusion protein in transfected cells increased significantly, proving that the inventors successfully constructed a cell line that stably overexpressed LMP1 ( Figure 1 B).

[0051] Construction of LMP1 knockdown cell line model: In contrast, to further investigate the role of LMP1 protein in NKTLC cell function, the inventors used transient knockdown technology to construct a cell model of LMP1 knockdown. The inventors designed several siRNA sequences targeting LMP1 mRNA to selectively reduce the expression of LMP1 in NKYS cells. The siRNA sequences were: si1: GCTGTACATCGTTATGAGTGA (SEQ ID NO. 1) and si2: GAGCCCTCCTTGTCCTCTATT (SEQ ID NO. 2).

[0052] The inventors synthesized siRNA sequences and transfected them into NKYS cells using liposome (Lipofectamine 2000, Thermo Fisher)-mediated transfection. 72 hours after transfection, proteins of NKYS cells were collected and analyzed by Western blot. By comparing with the non-knockdown control group, the inventors observed that the protein expression of LMP1 in cells treated with siRNA was significantly decreased. This result was Figure 1 Shown in B.

[0053] RNA-seq sequencing analysis of gene expression in LMP1 overexpressing cells: In further studying the biological effects of LMP1, the inventors performed whole-genome RNA sequencing (RNA-seq) analysis on LMP1 overexpressing cells and control cells. First, the reliability and reproducibility of RNA-seq data were verified by Pearson correlation analysis. The analysis results showed a high degree of consistency between samples, ensuring the credibility of data analysis ( Figure 3 ).

[0054] Subsequently, the inventors used bioinformatics tools to perform differentially expressed genes (DEGs) analysis and compared the gene expression differences between LMP1 overexpressing cells and control cells. The analysis results showed that 1,293 genes were upregulated in LMP1 overexpressing cells, while 527 genes were downregulated ( Figure 4 This dramatic change in gene expression reveals a broad impact of LMP1 on the cellular transcriptome.

[0055] Through gene set enrichment analysis (GSEA) and signal pathway analysis, the inventors found that the NK-kB signaling pathway and the cell apoptosis signaling pathway were significantly activated in LMP1 overexpressing cells ( Figure 5 ), which is consistent with previous studies.

[0056] Further transcriptomic analysis also revealed that LMP1 overexpression inhibited multiple key biological pathways in host cells, including cell cycle checkpoints, DNA damage checkpoints, and activation of DNA replication and DNA damage response pathways ( Figure 6 to Figure 8 This suggests that the expression of LMP1 may be associated with the resistance of NKTLC to anthracyclines and other targeted drugs for DNA synthesis / replication, and targeting LMP1 may provide a new treatment option for patients with NKT cell lymphoma.

[0057] Mass spectrometry analysis of LMP1 interaction with host proteins: In order to further explore the mechanism of the effect of high expression of LMP1 on the sensitivity of nucleotide metabolic drugs, the inventors conducted intracellular proteomic analysis on NKYS cells with high expression of LMP1. Through mass spectrometry technology, the inventors not only confirmed the interaction between LMP1 and its known interacting proteins TRAF1 and TRAF3, but also unexpectedly discovered the potential interaction between LMP1 and MCM3 (Mini-Chromosome Maintenance Complex Component 3) ( Fig. 9 MCM3 is a member of the MCM protein family. MCM proteins function as helicases by forming a ring-shaped hexameric complex, which is essential for the formation and maintenance of DNA replication forks. The activity of the MCM complex directly affects the progression of the cell cycle, especially the DNA synthesis stage during the S phase.

[0058] MCM3 is a key protein in the process of cell DNA replication. The discovery of this new interacting protein suggests that the inventors LMP1 may regulate the drug sensitivity of cells by affecting the DNA replication process.

[0059] Verification of the interaction between LMP1 and MCM3: In order to verify the LMP1-MCM3 interaction found in mass spectrometry, the inventors used FLAG-tagged LMP1 high-expressing cells and performed immunoprecipitation experiments using FLAG agarose beads. The experimental results confirmed that MCM3 can interact with exogenously expressed LMP1 protein in cells ( Fig.10A). To further explore the biological significance of this interaction, the inventors constructed an MCM3 overexpression cell line with an mCherry tag in NKYS cells and verified the overexpression of MCM3 protein by Western blot ( Fig.10 B). Next, the inventors used mCherry magnetic beads to perform immunoprecipitation in NKYS cells overexpressing MCM3 to detect the interaction between LMP1 and overexpressed MCM3. The results of immunoprecipitation showed that LMP1 was able to interact with overexpressed MCM3 ( Fig.10 C). In addition, the inventors also performed co-localization analysis of LMP1 and MCM3 in NKYS cells by immunofluorescence staining. The results of immunofluorescence revealed that LMP1 and MCM3 had obvious co-localization in cells ( Fig.10 D).

[0060] These experimental results indicate that MCM3 is a new potential interacting protein of LMP1. Given the key role of MCM3 in regulating the cell cycle and DNA replication, the inventors speculate that LMP1 may affect the cell cycle progression and DNA replication mechanism of host cells through interaction with MCM3, thereby regulating the sensitivity of cells to nucleotide metabolic drugs. This discovery provides a new perspective on the mechanism of LMP1-mediated drug sensitivity of tumor cells and may guide the development of future treatment strategies for LMP1-positive tumors.

[0061] Effect of LMP1 expression level on resistance to DNA damaging drugs: In order to explore the effect of LMP1 expression level on the resistance of NKYS cells to DNA-targeted drugs, the inventors conducted drug sensitivity tests on LMP1 overexpression and control cells. The inventors first determined the half inhibitory concentration (IC50) of cytarabine. The experimental results showed that compared with the control group, the IC50 of cytarabine in LMP1 overexpression cells was significantly increased, indicating that the high expression of LMP1 significantly reduced the sensitivity of NKYS cells to cytarabine ( Fig.11 A). After further treating these two groups of cells with 0.5 μM cytarabine, the inventors found that the inhibitory effect of cytarabine on LMP1 overexpressing cells was significantly weaker than that of the control group ( Fig.11 B).

[0062] Through Annexin-V and PI double staining and flow cytometry, the inventors found that after 48 hours of treatment with 0.5 μM cytarabine, the apoptosis rate of LMP1 overexpressing cells was significantly lower than that of the control group ( Fig.11 C).

[0063] The inventors then expanded the scope of their study to include two other DNA-targeted drugs: 6-mercaptopurine and cyclocytidine. Similar IC50 test results showed that LMP1 overexpression also significantly increased the IC50 of these two drugs and reduced the sensitivity of NKYS cells ( Fig.12 ).

[0064] Targeting LMP1 enhances the sensitivity of NKTCL to DNA-targeted drugs: To further explore the potential of targeting LMP1 to enhance the sensitivity of NKTCL (nasopharyngeal NK / T cell lymphoma) to DNA damaging drugs, the inventors conducted a series of cell experiments, including flow cytometry to detect apoptosis and determination of the half inhibitory concentration (IC50) of the drug. At the same time, the IC50 determination results also showed that the sensitivity of cells treated with LMP1 knockdown to cytarabine, cyclocytidine, and 6-mercaptopurine drugs was significantly increased, and the IC50 value was reduced ( Fig.13 A and B), indicating that the effective concentration of the drug is lower. These data consistently indicate that the responsiveness of NKTCL cells to DNA damaging drugs can be effectively enhanced by inhibiting the expression of LMP1.

[0065] Based on the above results, the inventors can conclude that the expression of LMP1 significantly inhibits the sensitivity of NKYS cells to a variety of DNA-targeted drugs including cytarabine, 6-mercaptopurine and cyclocytidine, and targeting LMP1 can effectively relieve drug resistance. These findings provide an important experimental basis for further exploring the role of LMP1 in the mechanism of tumor chemotherapy resistance, and may provide new targets for the development of therapeutic strategies for LMP1-positive tumors.

[0066] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. Application of LMP1 expression inhibitors, LMP1 protein activity inhibitors or LMP1 protein adsorbents in the preparation of DNA-targeted chemotherapy drug enhancers.

2. The use according to claim 1, characterized in that: The DNA targeted chemotherapy drug is selected from at least one of cytarabine, 6-mercaptopurine and cyclocytidine.

3. The use according to claim 1 or 2, characterized in that: The LMP1 expression inhibitor is siRNA targeting the LMP1 gene; the LMP1 protein activity inhibitor is an antibody against the LMP1 protein, and the LMP1 protein adsorbent is coupled with the antibody against the LMP1 protein.

4. The use according to claim 3, characterized in that: It is used for adjuvant therapy of NK / T cell lymphoma.

5. The use according to claim 3, characterized in that: The nucleotide sequence of the siRNA is si1: GCTGTACATCGTTATGAGTGA or si2: GAGCCCTCCTTGTCCTCTATT.

6. Use of LMP1 expression regulator in the preparation of MCM protein activity regulator for experimental use, which is not used for the treatment of diseases.

7. The use according to claim 6, characterized in that: The MCM protein is MCM3.

8. The use according to claim 6, characterized in that: The LMP1 expression regulator is selected from siRNA targeting LMP1 gene and antibody targeting LMP1 protein.

9. The use according to claim 8, characterized in that: The nucleotide sequence of the siRNA is si1: GCTGTACATCGTTATGAGTGA or si2: GAGCCCTCCTTGTCCTCTATT.

10. Use of LMP1 expression inhibitors or LMP1 protein activity inhibitors in the preparation of experimental cell cycle regulators and / or DNA repair inhibitors.

Images