Sphingomonas paucimobilis CRISPRI / dCas12a gene regulation and control system as well as construction method and application of spingomonas paucimobilis CRISPRI / dCas12a gene regulation and control system

Abstract

The invention provides a sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system as well as a construction method and application thereof, and particularly belongs to the technical field of gene engineering. The gene regulation and control system disclosed by the invention comprises a pBBR1-dCas12a-crRNA plasmid, wherein the plasmid comprises a pBBR1 replicon, a dCas12a gene, a crRNA expression cassette and a chloramphenicol resistance gene; the crRNA expression cassette comprises a Ptac promoter, two DR fragments and an rrnB T1 terminator, and is characterized in that the crRNA expression cassette comprises a Ptac promoter, two DR fragments and an rrnB T1 terminator. The system disclosed by the invention can stably express in sphingomonas paucimobilis and inhibit the transcription of genes so as to reduce the expression of specific genes without modifying the DNA (Deoxyribose Nucleic Acid) sequence of the specific genes, has lower toxicity to S.paucimobilis, is high in host growth speed and can realize the efficient expression of dcas12a.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system and a construction method and application thereof. Background Art

[0002] Gellan gum is a linear microbial polysaccharide composed of β-1,3-D glucose, β-1,4-D-glucuronic acid, β-1,4-D-glucose, and α-1,4-L-rhamnose, produced by aerobic fermentation of Sphingomonas paucimbilis. The first glucose residue of each repeating unit contains 0.5 acetyl groups and 1 glyceryl acyl groups. Since the content of acyl groups affects the properties of gellan gum, gellan gum with different properties often needs to be selected for different applications. Based on this, more and more studies have been conducted to reduce the acyl content of gellan gum and change its gel properties to meet production needs and further expand the application range of gellan gum. The traditional method of reducing the acyl content is to heat and hydrolyze it under alkaline conditions, which not only wastes a lot of energy but also makes the conditions difficult to control and may even lead to hydrolysis of the main chain. Therefore, it is of great significance to transform the fermentation strains by genetic engineering and directly produce gellan gum with different acyl contents from the source. In the biosynthetic pathway of gellan gum in S. paucimobilis, it has been confirmed that the acetyltransferase encoded by the oafA gene is responsible for catalyzing the addition of acetyl groups to the polysaccharide backbone. Therefore, using metabolic engineering to regulate the expression level of acetyltransferase is the best choice.

[0003] The CRISPRi technology that has emerged in recent years can reduce the expression of target genes at the mRNA level, and because it does not cause double-strand breaks in the target DNA, it is very suitable for use in non-model strains of S. paucimobilis with unknown genetic backgrounds. However, the existing CRISPRi / dCas9 system reported for the expression of target genes in S. paucimobilis still has the problem of low conversion efficiency. Summary of the invention

[0004] The object of the present invention is to provide a CRISPRi / dCas12a gene regulation system for Sphingomonas paucimobilis and its construction method and application. The system described in the present invention can stably express in Sphingomonas paucimobilis, inhibit gene transcription, reduce the expression of specific genes without modifying their DNA sequences, has less toxicity to S. paucimobilis, has a fast host growth rate, and can achieve efficient expression of dcas12a.

[0005] The present invention provides a CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis, comprising a pBBR1-dCas12a-crRNA plasmid, wherein the pBBR1-dCas12a-crRNA plasmid comprises a pBBR1 replicon, a dCas12a gene, a crRNA expression cassette and a chloramphenicol resistance gene; the crRNA expression cassette comprises a Ptac promoter, two DR fragments and an rrnB T1 terminator, and the nucleotide sequence of the crRNA expression cassette is shown in SEQ ID NO.1.

[0006] Preferably, the nucleotide sequence of the pBBR1 replicon is shown in SEQ ID NO.2; the nucleotide sequence of the dCas12a gene is shown in SEQ ID NO.3; and the nucleotide sequence of the chloramphenicol resistance gene is shown in SEQ ID NO.4.

[0007] Preferably, the Sphingomonas paucimobilis comprises Sphingomonas paucimobilis strain ATCC 31461.

[0008] The present invention also provides a method for constructing the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical solution, comprising the following steps:

[0009] The pBBR1 replicon, dCas12a gene, crRNA expression cassette and chloramphenicol resistance gene were amplified respectively, and connected using a seamless cloning method to obtain the pBBR1-dCas12a-crRNA plasmid, which is the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis.

[0010] The present invention also provides a Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene. The Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene is based on the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical scheme, and further contains sgRNA for knocking down the expression of the oafA gene.

[0011] Preferably, the sgRNA is inserted between the two DR segments of the crRNA expression cassette.

[0012] Preferably, the sgRNA includes a gRNA targeting the oafA gene and a gRNA targeting the predicted promoter of oafA; the gRNA targeting the oafA gene includes oafA1', oafA2', oafA3', oafA4', oafA5' and oafA6', and the gRNA targeting the predicted promoter of oafA includes P1, P2, P3, P4, and P5;

[0013] Primers for amplifying oafA1' include dCas12a-oafA1'-F with a nucleotide sequence as shown in SEQ ID NO.5 and dCas12a-oafA1'-R with a nucleotide sequence as shown in SEQ ID NO.6;

[0014] Primers for amplifying oafA2' include dCas12a-oafA2'-F with a nucleotide sequence as shown in SEQ ID NO.7 and dCas12a-oafA2'-R with a nucleotide sequence as shown in SEQ ID NO.8;

[0015] Primers for amplifying oafA3' include dCas12a-oafA3'-F with a nucleotide sequence as shown in SEQ ID NO.9 and dCas12a-oafA3'-R with a nucleotide sequence as shown in SEQ ID NO.10;

[0016] Primers for amplifying oafA4' include dCas12a-oafA4'-F with a nucleotide sequence as shown in SEQ ID NO.11 and dCas12a-oafA4'-R with a nucleotide sequence as shown in SEQ ID NO.12;

[0017] Primers for amplifying oafA5' include dCas12a-oafA5'-F with a nucleotide sequence as shown in SEQ ID NO.13 and dCas12a-oafA5'-R with a nucleotide sequence as shown in SEQ ID NO.14;

[0018] Primers for amplifying oafA6' include dCas12a-oafA6'-F with a nucleotide sequence as shown in SEQ ID NO.15 and dCas12a-oafA6'-R with a nucleotide sequence as shown in SEQ ID NO.16;

[0019] The primers for amplifying P1 include dCas12a-P1-F with a nucleotide sequence as shown in SEQ ID NO.17 and dCas12a-P1-R with a nucleotide sequence as shown in SEQ ID NO.18;

[0020] The primers for amplifying P2 include dCas12a-P2-F having a nucleotide sequence as shown in SEQ ID NO.19 and dCas12a-P2-R having a nucleotide sequence as shown in SEQ ID NO.20;

[0021] The primers for amplifying P3 include dCas12a-P3-F having a nucleotide sequence as shown in SEQ ID NO.21 and dCas12a-P3-R having a nucleotide sequence as shown in SEQ ID NO.22;

[0022] The primers for amplifying P4 include dCas12a-P4-F having a nucleotide sequence as shown in SEQ ID NO.23 and dCas12a-P4-R having a nucleotide sequence as shown in SEQ ID NO.24;

[0023] The primers for amplifying P5 include dCas12a-P5-F having a nucleotide sequence as shown in SEQ ID NO.25 and dCas12a-P5-R having a nucleotide sequence as shown in SEQ ID NO.26.

[0024] The present invention also provides a method for constructing a CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis for knocking down the expression of the oafA gene as described in the above technical solution, comprising the following steps:

[0025] On the basis of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical scheme, sgRNA that knocks down the expression of the oafA gene is inserted to obtain the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis that knocks down the expression of the oafA gene.

[0026] The present invention also provides the use of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical scheme in gene interference with Sphingomonas paucimobilis.

[0027] The present invention also provides the use of the Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene as described in the above technical scheme in the production of gellan gum with acylation differences.

[0028] The present invention provides a CRISPRi / dCas12a gene regulation system for Sphingomonas paucimobilis. The CRISPRi / dCas12a system of the present invention can be used to transform Sphingomonas paucimobilis by genetic engineering means, and produce gellan gum with acylation differences directly from the source. The advantages of the CRISPRi / dCas12a system of the present invention are: 1) it is expected to change the gel properties of gellan gum and further broaden the application range of gellan gum; 2) it can also explore a CRISPRi system that is more suitable for S. paucimobilis, which provides new ideas for subsequent transformation of other metabolic pathways of S. paucimobilis, such as reducing the synthesis of by-products and increasing the yield of gellan gum. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0030] Figure 1 A flow chart for constructing a recombinant plasmid for the CRISPRi / dCas12a system provided by the present invention;

[0031] Figure 2 A diagram showing the sequencing results of the recombinant plasmid pBBR1-dCas12a-crRNA provided by the present invention;

[0032] Figure 3 The electrophoresis diagram of the plasmid pBBR1-dCas12a-crRNA provided by the present invention transformed into Sphingomonas paucimobilis;

[0033] Figure 4 A result diagram showing the number of transformants of different CRISPRi systems provided by the present invention;

[0034] Figure 5 A growth curve diagram of S. paucimobilis containing different CRISPRi systems provided by the present invention;

[0035] Figure 6 The expression result graph of dcas9 or dcas12a of different CRISPRi systems provided by the present invention;

[0036] Figure 7 The crRNA provided by the present invention is located in the oafA coding region and the oafA predicted promoter region. A is a crRNA location map in the oafA coding region; B is a crRNA location map in the oafA predicted promoter region;

[0037] Figure 8 The sequencing result diagram of the recombinant plasmid pBBR1-dCas12a-oafAn' provided by the present invention; wherein A is a comparison result diagram of the sequencing of plasmid pBBR1-dCas12a-oafA1' and oafA1'-F; B is a comparison result diagram of the sequencing of plasmid pBBR1-dCas12a-oafA2' and oafA2'-F; C is a comparison result diagram of the sequencing of plasmid pBBR1-dCas12a-oafA3' and oafA3'-F; D is a comparison result diagram of the sequencing of plasmid pBBR1-dCas12a-oafA4' and oafA4'-F; E is a comparison result diagram of the sequencing of plasmid pBBR1-dCas12a-oafA5' and oafA5'-F; F is a comparison result diagram of the sequencing of plasmid pBBR1-dCas12a-oafA6' and oafA6'-F;

[0038] Fig. 9 A graph showing the sequencing results of the recombinant plasmid pBBR1-dCas12a-Pn provided by the present invention; wherein A is a graph showing the comparison of the sequencing results of plasmid pBBR1-dCas12a-P1 with P1-F; B is a graph showing the comparison of the sequencing results of plasmid pBBR1-dCas12a-P2 with P2-F; C is a graph showing the comparison of the sequencing results of plasmid pBBR1-dCas12a-P3 with P3-F; D is a graph showing the comparison of the sequencing results of plasmid pBBR1-dCas12a-P4 with P4-F; E is a graph showing the comparison of the sequencing results of plasmid pBBR1-dCas12a-P5 with P5-F;

[0039] Fig.10 The electrophoresis diagram of the recombinant plasmid pBBR1-dCas12a-oafAn' provided by the present invention transformed into Sphingomonas paucimobilis; wherein, M, 2kMarker; lane 1, ddH2O of the correctly sequenced pBBR1-dCas12a-oafAn' plasmid; lane 2, ddH2O; lanes 3-5 in A, plasmids mentioned in pBBR1-dCas12a-oafA1' electrotransformed into S. paucimobilis; lanes 3-5 in B, plasmids mentioned in pBBR1-dCas12a-oafA2' electrotransformed into S. paucimobilis Plasmid extraction; Lanes 3-5 in C, pBBR1-dCas12a-oafA3' electroporated plasmid extracted from S. paucimobilis; Lanes 3-5 in D, pBBR1-dCas12a-oafA4' electroporated plasmid extracted from S. paucimobilis; Lanes 3-5 in E, pBBR1-dCas12a-oafA5' electroporated plasmid extracted from S. paucimobilis; Lanes 3-5 in F, pBBR1-dCas12a-oafA6' electroporated plasmid extracted from S. paucimobilis; Fig.11 The electrophoresis diagram of the recombinant plasmid pBBR1-dCas12a-Pn provided by the present invention transformed into Sphingomonas paucimobilis; wherein, M, 2kMarker; lane 1, ddH2O; lane 2, correctly sequenced pBBR1-dCas12a-Pn plasmid; lanes 3-5 in A, dCas12a-P1 electrotransformed into a plasmid extracted from S. paucimobilis; lanes 3-5 in B, dCas12a-P2 electrotransformed into a plasmid extracted from S. paucimobilis; lanes 3-5 in C, dCas12a-P3 electrotransformed into a plasmid extracted from S. paucimobilis; lanes 3-5 in D, dCas12a-P4 electrotransformed into a plasmid extracted from S. paucimobilis; lanes 3-5 in E, dCas12a-P5 electrotransformed into a plasmid extracted from S. paucimobilis;

[0040] Fig.12 It is the relative expression level of the oafA gene provided by the present invention. DETAILED DESCRIPTION

[0041] The present invention provides a CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis, comprising a pBBR1-dCas12a-crRNA plasmid, wherein the pBBR1-dCas12a-crRNA plasmid comprises a pBBR1 replicon, a dCas12a gene, a crRNA expression cassette and a chloramphenicol resistance gene; the crRNA expression cassette comprises a Ptac promoter, two DR fragments and an rrnB T1 terminator, and the nucleotide sequence of the crRNA expression cassette is shown in SEQ ID NO.1: GTTGACAATTAATCATCGGCTCGTATAATGAATTTCTACTCTTGTAGATTGAGACCGTGAAGTTAATAAGGTCTCAAATTTCTACTCTTGTAGATTTTTTTT CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTCGTTTTA

[0042] The present invention also provides a method for constructing the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical solution, comprising the following steps:

[0043] The pBBR1 replicon, dCas12a gene, crRNA expression cassette and chloramphenicol resistance gene were amplified respectively, and connected using a seamless cloning method to obtain the pBBR1-dCas12a-crRNA plasmid, which is the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis.

[0044] In the present invention, pBBR1 replicon and chloramphenicol resistance gene can be amplified from pBBR1-dCas12a plasmid. In the present invention, the construction method of pBBR1-dCas12a is: using plasmid pBBR1-Ptac-dCas9-sgRNA as a template, designing primers PBBR1-CmR-F / R (see Table 3), amplifying replicon and chloramphenicol resistance gene fragments; using plasmid pBbS8c-ddCpf1 as a template, designing primers Ptac-dCas12a-F / R (see Table 3), amplifying dCas12a gene fragments, and cutting replicon and chloramphenicol resistance gene and dCas12a gene two fragments, and the restriction site is XbaI\SalI, which is connected to form plasmid PBBR1-Ptac-dCpf1. The plasmid PBBR1-Ptac-dCpf1 was then digested with XmaI and SalI to obtain a vector fragment; the plasmid pUC57-crRNA was digested with XmaI and SalI to obtain a crRNA fragment, and the vector fragment and crRNA fragment were connected to construct the plasmid pBBR1-dCas12a. tac-dCas9-sgRNA" plasmid was prepared with reference to the patent "A CRISPRi / dCas9 gene inhibition system of Sphingomonas paucimobilis and its construction method and application". In the present invention, the pUC57-crRNA plasmid was constructed by entrusting a company to obtain crRNA by inserting it into the basic plasmid pUC57. The nucleotide sequence of the crRNA is CCCGGGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCAATTTCTACTCTTGTAGATtGAGACCgtgaagttaataaGGTCTCAATTTCTACTCTTGTAGATTTTTTTTCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGCCTAGGGTCGAC (SEQ ID NO.27). In the present invention, the dCas12a gene comes from the pBbS8c-ddCpf1 plasmid. In the present invention, the pBbS8c-ddCpf1 is a conventional commercially available pBbS8c-ddCpf1-△, purchased from Addgene, with a catalog number of 153039.

[0045] Specifically, after obtaining pBBR1-dCas12a, the present invention uses plasmid pBBR1-dCas12a as a template, designs primers IF-pBBR1-F / R (see Table 3) to amplify replicon and resistance gene fragments; uses plasmid pBbS8c-ddCpf1 as a template, designs primers IF-dCas12a-F / R (see Table 3) to amplify dcas12a fragments; uses plasmid pUC57-crRNA as a template (crRNA sequence is shown in SEQID NO.1, and Shanghai Shenggong Biological Company is commissioned to construct), designs primers IF-crRNA-F / R (see Table 3) to amplify crRNA array fragments, and connects replicon (pBBR1) and resistance gene (cmr) fragments, dcas12a fragments and crRNA array fragments using seamless cloning enzymes to construct plasmid pBBR1-dCas12a-crRNA. The construction process of the plasmid is as shown in Figure 1 As shown in Figure 2, the crRNA sequence of dCas12a (42 nt in length) is shorter than the sgRNA sequence of dCas9 (62 nt in length), which also makes it easier to assemble the target site of the CRISPRi / dCas12a system when inhibiting multiple genes at the same time.

[0046] In a specific embodiment, the present invention transforms the plasmid into E.coli DH5α after seamless cloning and connection, and then uses chloramphenicol (25μg / ml) to screen the recombinants. The present invention extracts the plasmid from the screened recombinants and verifies them by sequencing. After the sequencing result is verified to be correct, the present invention electrotransforms the recombinant plasmid into Sphingomonas paucimobilis for verification: a. According to the electrotransformation method, the recombinant plasmid is electrotransferred into Sphingomonas paucimobilis, spread on a YM plate with 15μg / ml CH, and cultured at 30°C for 24 to 72h; b. Pick a single colony, design primers crRNA-VF / R, and verify whether the recombinant plasmid is successfully transformed into Sphingomonas paucimobilis by colony PCR.

[0047] The present invention also provides a CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene. The CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene is based on the CRISPRi / dCas12a gene regulation system of the Sphingomonas paucimobilis described in the above technical scheme, and further contains an sgRNA for knocking down the expression of the oafA gene. The present invention designs sgRNA according to the selected target gene, and the principles are as follows: (1) the PAM sequence recognizable by the dCas12a protein is 3'-TTTV-5', and the target position of the gRNA should be immediately downstream thereof, (2) sgRNA can be designed in the target gene coding chain and its non-coding chain, (3) it does not have any special secondary structure, and its sequence specificity is retrieved in NCBI. In the present invention, the oafA gene is the target gene. The oafA gene is a gene encoding an acetyltransferase, which is a key enzyme responsible for catalyzing the addition of acetyl groups on the polysaccharide backbone. The results of the embodiment show that the present invention successfully constructs a CRISPRi / dCas12a system targeting the oafA gene (with the oafA gene as the target gene, sgRNA is designed, and the recombinant plasmid pBBR1-dCas12a-oafAn' / Pn is constructed), and is transformed into S. paucimobilis, obtaining a strain of the CRISPRi / dCas12a system containing the target oafA gene and a strain targeting the predicted promoter region of oafA. The present invention verifies the inhibition efficiency of the CRISPRi / dCas12a system by RT-qPCR. The results show that the CRISPRi / dCas12a system can achieve knockdown of oafA gene expression, thereby regulating the metabolic process of Sphingomonas paucimobilis, which is beneficial to inhibiting the addition of acetyl groups of gellan gum, and is of great significance for obtaining gellan gum with acylation differences. In the biosynthetic pathway of gellan gum in S. paucimobilis, the acetyltransferase encoded by the oafA gene is responsible for catalyzing the addition of acetyl groups on the main chain of the polysaccharide. The expression of the oafA gene can be fine-tuned by using the CRISPRi / dCas12a system, which can reduce the addition of acetyl groups to varying degrees from the source and directly produce gellan gum with acylation differences. In a specific embodiment, the sgRNA is inserted between the two DR fragments of the crRNA expression cassette. In a specific embodiment, the sgRNA includes a gRNA targeting the oafA gene and a gRNA targeting the predicted promoter of oafA; the gRNA targeting the oafA gene includes oafA1', oafA2', oafA3', oafA4', oafA5' and oafA6', and the gRNA targeting the predicted promoter of oafA includes P1, P2, P3, P4, and P5; the primer for amplifying oafA1' includes a nucleotide sequence such as SEQ ID NO.5 and dCas12a-oafA1'-F as shown in SEQ ID NO.6; the primers for amplifying oafA2' include dCas12a-oafA2'-F as shown in SEQ ID NO.7 and dCas12a-oafA2'-R as shown in SEQ ID NO.8; the primers for amplifying oafA3' include dCas12a-oafA3'-F as shown in SEQ ID NO.9 and dCas12a-oafA3'-R as shown in SEQ ID NO.10; the primers for amplifying oafA4' include dCas12a-oafA4'-F as shown in SEQ ID NO.11 and dCas12a-oafA4'-R as shown in SEQ ID NO.12; the primers for amplifying oafA5' include nucleotide sequences as shown in SEQ ID NO. ID NO.13 as shown in dCas12a-oafA5'-F and the nucleotide sequence as shown in SEQ ID NO.14 as dCas12a-oafA5'-R; the primer for amplifying oafA6' includes the nucleotide sequence as shown in SEQ ID NO.15 as dCas12a-oafA6'-F and the nucleotide sequence as shown in SEQ ID NO.16 as dCas12a-oafA6'-R; the primer for amplifying P1 includes the nucleotide sequence as shown in SEQ ID NO.17 as dCas12a-P1-F and the nucleotide sequence as shown in SEQ ID NO.18 as dCas12a-P1-R; the primer for amplifying P2 includes the nucleotide sequence as shown in SEQ ID NO.19 as dCas12a-P2-F and the nucleotide sequence as shown in SEQ ID NO.20 as dCas12a-P2-R; the primer for amplifying P3 includes the nucleotide sequence as shown in SEQ ID NO.21 as dCas12a-P3-F and the nucleotide sequence as shown in SEQ ID NO. NO.22; the primers for amplifying P4 include dCas12a-P4-F with a nucleotide sequence as shown in SEQ ID NO.23 and dCas12a-P4-R with a nucleotide sequence as shown in SEQ ID NO.24; the primers for amplifying P5 include dCas12a-P5-F with a nucleotide sequence as shown in SEQ ID NO.25 and dCas12a-P5-F with a nucleotide sequence as shown in SEQ ID NO.dCas12a-P5-R shown in 26. In a specific embodiment, the present invention inserts 11 synthesized gRNAs into the "spacer" position (between two DR fragments) in the recombinant plasmid pBBR1-dCas12a-crRNA to construct the recombinant plasmid pBBR1-dCas12a-oafAn' / Pn. In a specific embodiment, the present invention electroporates the recombinant plasmid pBBR1-dCas12a-oafAn' / Pn into Sphingomonas paucimobilis, and determines the transcription level of the target gene by RT-qPCR, thereby verifying the verification efficiency of the CRISPRi / dCas12a system. .

[0048] The present invention also provides a method for constructing a CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis for knocking down the expression of the oafA gene as described in the above technical solution, comprising the following steps:

[0049] On the basis of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical scheme, sgRNA that knocks down the expression of the oafA gene is inserted to obtain the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis that knocks down the expression of the oafA gene.

[0050] The present invention also provides the use of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in the above technical solution in gene interference with Sphingomonas paucimobilis. The CRISPRi / dCas12a system of the present invention is used to study the functions of essential genes of Sphingomonas paucimobilis, and to regulate or inhibit the metabolic process of Sphingomonas paucimobilis.

[0051] The present invention also provides the use of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis for knocking down the expression of the oafA gene described in the above technical solution in the production of acylated differentially gellan gum. The CRISPRi / dCas12a system for knocking down the expression of the oafA gene of the present invention can inhibit the transcription level of oafA, a key gene in the acetyl addition pathway in Sphingomonas paucimobilis.

[0052] To further illustrate the present invention, a Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system, a construction method and an application thereof provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0053] In the examples of the present invention, unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

[0054] The plasmids are shown in Table 1:

[0055] Table 1 Plasmids

[0056]

[0057]

[0058] The experimental strains are shown in Table 2:

[0059] Table 2 Strains

[0060]

[0061] The primers are shown in Table 3:

[0062] Table 3 Primers

[0063]

[0064]

[0065] F: upstream primer R: downstream primer.

[0066] 4. The main reagents are shown in Table 4.

[0067] Table 4 Main reagents

[0068] Experimental reagents Production Company HiScript Ш RT SuperMix for qPCR(+gDNA wiper) Vazyme EasyPure Plasmid MiniPrep Kit Vazyme Gel Extraction Kit Omega 2k DNA Marker Beijing Quanshijin 5k DNA Marker Beijing Quanshijin Agarose Shanghai Beijing Biotechnology Co., Ltd. Chloramphenicol Solarbio Ampicillin Solarbio SYBR Fluorescence Quantitation Kit Beijing Bomed RNAiso Plus TaKaRa Restriction enzymes NEB Sterile enzyme-free water Bomed T4 DNA Ligase NEB Premix Taq TakaRa 2×Seamless Cloning Mix Biomed Tween 80 Maclean

[0069] 5. The culture medium involved in the following examples is as follows:

[0070] LB medium: tryptone, yeast powder, sodium chloride;

[0071] LB solid medium: tryptone, yeast powder, sodium chloride, agarose;

[0072] YM medium: yeast extract powder, malt extract powder, tryptone, glucose;

[0073] YM solid medium: yeast extract powder, malt extract powder, tryptone, glucose, agarose;

[0074] Seed culture medium: sucrose, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate

[0075] Example 1

[0076] Construction of CRISPRi / dCas12a system in Sphingomonas paucimobilis

[0077] 1. Construction of CRISPRi / dCas12a plasmid pBBR1-dCas12a-crRNA

[0078] 1. Acquisition of dCas12a fragment

[0079] To obtain a fragment that can be used for seamless cloning, the plasmid pBbS8c-ddCpf1-△ (Addgene

[0080] ) plasmid as a template, design primers IF-dCas12a-F / R to amplify the dcas12a fragment, and add the 5' end sequence (15-20 bp) of pBBR1-CmR to the 5' end of the upstream primer when designing the primers. The 50 μL reaction system is as follows: pBbS8c-ddCpf 12 μL, IF-dCas12a-F / R 1 μL each, PrimeSTAR 25 μL, ddH2O 21 μL.

[0081] The reaction procedure was as follows: ① pre-denaturation at 98°C for 3 min; ② denaturation at 98°C for 10 s, annealing at 56°C for 15 s, extension at 72°C for 4 min, and repeat the above cycle 35 times; ③ extension at 72°C for 10 min.

[0082] After the PCR product was verified by agarose gel electrophoresis, the correct band was excised and recovered. The gel recovery steps are shown in the Gel Extraction Kit.

[0083] 2. Obtaining pBBR1-CmR fragment

[0084] The replicon and resistance gene were amplified using the plasmid pBBR1-dCas12a (dcas12a and its promoter are far apart in this plasmid, so it is not used and is only used for the construction of plasmid pBBR1-dCas12a-crRNA) as templates, and the primers IF-pBBR1-F / R were designed. The 50μL reaction system is as follows: pBBR1-dCas12a 2μL, IF-pBBR1-F / R 1μL each, PrimeSTAR 25μL, ddH2O 21μL.

[0085] The reaction procedure was as follows: ① pre-denaturation at 98°C for 3 min; ② denaturation at 98°C for 10 s, annealing at 57°C for 15 s, extension at 72°C for 2 min 30 s, and repeat the above cycle 35 times; ③ extension at 72°C for 10 min.

[0086] After the PCR product was verified by agarose gel electrophoresis, the correct band was excised and recovered. The gel recovery steps are shown in the Gel Extraction Kit.

[0087] The construction method of pBBR1-dCas12a is as follows: using plasmid pBBR1-Ptac-dCas9-sgRNA (prepared according to the patent "A CRISPRi / dCas9 gene inhibition system of Sphingomonas paucimobilis and its construction method and application") as a template, designing primers PBBR1-CmR-F / R (see Table 3), amplifying the replicon and chloramphenicol resistance gene fragments; using plasmid pBbS8c-ddCpf1-△ as a template, designing primers Ptac-dCas12a-F / R (see Table 3), amplifying the dCas12a gene fragment, and digesting the replicon and chloramphenicol resistance gene and dCas12a gene fragments with restriction sites of XbaI\SalI, and connecting them into plasmid PBBR1-Ptac-dCpf1. The plasmid PBBR1-Ptac-dCpf1 was then digested with XmaI and SalI to obtain a vector fragment; the plasmid pUC57-crRNA was digested with XmaI and SalI to obtain a crRNA fragment, and the vector fragment and the crRNA fragment were connected to construct the plasmid pBBR1-dCas12a. The pUC57-crRNA plasmid was commissioned to Shanghai Shenggong Biological Company to construct, and crRNA (SEQ ID NO.27) was inserted into the basic plasmid pUC57.

[0088] 3. Acquisition of crRNA array fragments

[0089] The crRNA fragment was synthesized by Sangon Biotechnology (Shanghai) and contained a promoter fragment P tac , two DR fragments and a rrnB T1 terminator fragment (SEQ ID NO.1). At the same time, the fragment was integrated into the vector pUC57-crRNA by Shanghai Shenggong Biological Company. In order to obtain a crRNA array that can be used for seamless cloning, this experiment designed IF-crRNA-F / R primers, in which IF-crRNA-F and IF-dCas12a-R have homologous fragments, and IF-crRNA-R and IF-pBBR1-F have homologous fragments. The 50μL reaction system is as follows: pUC57-crRNA 2μL, IF-crRNA-F / R each 1μL, PrimeSTAR 25μL, ddH2O 21μL.

[0090] The reaction procedure is as follows: ① 98℃ pre-denaturation for 3min; ② 98℃ denaturation for 10s, 56℃ annealing for 15s, 72℃ extension for 25s, repeat the above cycle 35 times; ③ 72℃ extension for 10min. After the PCR product is verified by agarose gel electrophoresis, the correct band is cut and recovered. The gel recovery steps are shown in the Gel Extraction Kit.

[0091] 4. Construction of plasmid pBBR1-dCas12a-crRNA

[0092] To obtain the pBBR1-dCas12a-crRNA plasmid, the three fragments were connected using seamless cloning enzymes and 10 μL of the system was added to a 0.2 mL PCR tube: dcas12a 1 μL (SEQ ID NO.2), pBBR1-CmR (SEQ ID NO.50) 1.5 μL, crRNA (SEQ ID NO.51) 2 μL and 2×Seamless Cloning Mix 5 μL; gently mix, centrifuge for a few seconds, and incubate at 50 ° C for 15 min on a PCR instrument. After the reaction, the centrifuge tube was placed on ice for transformation experiments.

[0093] pBBR1-CmR (SEQ ID NO.50):

[0094]

[0095] crRNA (SEQ ID NO.51):

[0096] atgtctacacctaaatgagctgGCATCTAGATATCGGATCCCGGGTTGACAATTAATCATCGGCTCGTATAATGAATTTCTACTCTTGTAGATTGAGACCGTGAAGTTAATAAGGTCTCAAATTTCTACTCTTGTAGATTTTTTTTCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTACCTAGGGTCGACTGCAGAGGATAGTGCGCAACCCAAGTGC.

[0097] 5. Chemical transformation of ligation product into E.coli DH5α

[0098] (1) Thaw the E. coli DH5α competent cells stored at -80°C on ice, gently stir the bottom of the centrifuge tube to mix, and add the ligation product to the centrifuge tube;

[0099] (2) Gently tap the bottom of the centrifuge tube to mix well and place on ice for 30 min.

[0100] (3) Heat shock at 42°C for 1 min 30 s;

[0101] (4) Quickly remove the centrifuge tube and place it in an ice bath for 2 minutes;

[0102] (5) Add 700 μL of preheated LB medium to the centrifuge tube and incubate at 37°C, 160-225 rpm for 1 h.

[0103] (6) After recovery, centrifuge at 4000 rpm for 1 min, retain about 100 μL of supernatant, blow and mix, and then apply 50 μL on LB solid plate containing 25 μg / mL chloramphenicol (CHL);

[0104] (7) Incubate the tube upside down at 37°C overnight.

[0105] 6. Connection result verification

[0106] (1) Colony PCR: Pick a single colony growing on the surface of the LB / CHL plate and prepare a bacterial suspension. The 20 μL reaction system is as follows: 1 μL bacterial suspension, 1 μL crRNA-VF / R, 10 μL 2×Taq PCR Master Mix, and 8 μL ddH2O.

[0107] The reaction procedure is as follows:

[0108] ① Pre-denaturation at 94℃ for 3min, ② Denaturation at 94℃ for 30s; Annealing at 58℃ for 30s; Extension at 72℃ at 1kb / min. Repeat the above cycle 32 times, ③ Extension at 72℃ for 10min. If the PCR product is verified to be correct by agarose gel electrophoresis, take the corresponding bacterial suspension and culture it at 37℃ overnight.

[0109] (2) Plasmid PCR: Inoculate the bacterial suspension of a single colony with the correct band into LB medium containing 25 μg / mL CHL and culture overnight at 37°C in a shaking incubator. The next day, use the Novozymes FastPure Plasmid Mini Kit to extract the plasmid and perform PCR reaction for further verification.

[0110] (3) Sequencing verification: select three plasmids with correct bands and perform unidirectional sequencing using dCas12a-V-R1 and dCas12a-V-R2 as sequencing primers. The sequencing results are compared with DNAMAN software. Figure 2 As shown, the recombinant plasmid pBBR1-dCas12a-crRNA plasmid was successfully constructed. The plasmid was then sent to the company for full plasmid sequencing, and the sequencing results were correct.

[0111] 2. Construction of experimental strain S. paucimobilis (pBBR1-dCas12a-crRNA)

[0112] 1. Preparation of S. paucimobilis ATCC 31461 competent cells

[0113] (1) Pick a single colony of wild-type S. paucimobilis and inoculate it into YM liquid culture medium. Incubate overnight at 30°C and 180 rpm.

[0114] (2) The next day, 300 μL of bacterial solution was added to 30 mL of seed culture medium to expand the culture to the logarithmic phase. 600 The value is around 0.55.

[0115] (3) Collect the bacterial solution into a 1.5 mL centrifuge tube, centrifuge at 8000 rpm, 4°C for 10 min, discard the supernatant, collect the precipitate, and repeat twice;

[0116] (4) Resuspend the cells three times with pre-cooled electroporation buffer, centrifuge at 8000 rpm and 4°C for 10 min each time. Finally, add 100 μL of electroporation buffer, pipette to mix, and store at -80°C.

[0117] The above steps must be performed aseptically throughout.

[0118] 2. Recombinant plasmid pBBR1-dCas12a-crRNA was electroporated into S. paucimobilis

[0119] (1) Take 100 ng of recombinant plasmid pBBR1-dCas12a-crRNA and add it to S. paucimobilis competent cells, and gently tap the bottom to mix.

[0120] (2) Transfer the system from the above step into an electroporation cup, pre-cool on ice for 10 min, and perform the electroporation experiment at a voltage of 2.5 kV and a time of 4 ms.

[0121] (3) After completing the above steps, immediately add 1 mL of seed culture medium to the electroporation cup and mix thoroughly by pipetting. Transfer the bacterial solution in the electroporation cup to a centrifuge tube and resuscitate at 30°C and 180 rpm for 2 h.

[0122] (4) After recovery, centrifuge at 5000 rpm for 2 min, retain about 100 μL of supernatant, resuspend the bacteria, take 50 μL of bacterial solution and spread it on YM solid culture medium plate containing 15 μg / mL CHL, and culture inverted at 30°C for 72 h.

[0123] 3. Verification of positive strain S. paucimobilis (pBBR1-dCas12a-crRNA)

[0124] The plasmid was used as a template and crRNA-VF / R as primers to amplify a specific fragment containing part of dcas12a, the entire crRNA array and part of pBBR1-CmR. The product was verified by 1% agarose gel electrophoresis. Figure 3 As shown in the figure (the band amplified in the 5th column is weak and not obvious; M: 2kDNAMarker; negative control: sterile water; 1-11: extracted plasmid), the extracted plasmids all amplified fragments of the expected size of the target band, which are correct positive single clones. The recombinant strain S. paucimobilis (pBBR1-dCas12a-crRNA) was successfully constructed.

[0125] Example 2

[0126] Determining the toxicity of the CRISPRi / dCas12a system to cells

[0127] 1. Determine the number of transformants of the CRISPRi / dCas12a system

[0128] To determine the performance of the CRISPRi / dCas12a system in S. paucimobilis, the experiment determined the toxicity of the CRISPRi system to S. paucimobilis by measuring the number of transformants. The strain S. paucimobilis (pBBR1MCS-2) was used as the control group, and the number of transformants of the CRISPRi / dCas9 and dCas12a systems was determined under the same electroporation conditions. The results are shown in Figure 4 As shown, the number of transformants that can grow on the plate transformed with pBBR1-dCas12a-crRNA plasmid is approximately tac -dCas9-sgRNA plasmid was 2.81 times that of CRISPRi / dCas12a, indicating that CRISPRi / dCas12a has less toxicity to S. paucimobilis.

[0129] 2. Determination of strain growth curve

[0130] The successfully constructed recombinant bacteria S. paucimobilis (pBBR1-dCas12a-crRNA) and recombinant bacteria S. paucimobilis (pBBR1-P tac -dCas9-sgRNA) and the control group S. paucimobilis (pBBR1MCS-2) were inoculated into YM liquid medium containing 15μg / mL CHL and revived at 30°C overnight. The above bacterial solution was inoculated into YM medium containing 15μg / mL CHL at a 1% inoculum, with a final volume of 100mL, and cultured at 30°C with shaking at 180rpm / min until the stable period. During this period, samples were taken every 2h and the bacterial solution OD was measured using an ELISA reader 600 The results are shown in Figure 2. Figure 5 As shown, the growth rate of strain S. paucimobilis (pBBR1-dCas12a-crRNA) was slightly faster than that of strain S. paucimobilis (pBBR1-P tac -dCas9-sgRNA).

[0131] Example 3

[0132] RT-qPCR determination of dcas12a expression in the CRISPRi / dCas12a system

[0133] 1. The successfully constructed experimental strain S. paucimobilis (pBBR1-dCas12a-crRNA) was used as the experimental group, and the recombinant bacteria S. paucimobilis (pBBR1-0-dCas12a) was used as the control and inoculated into YM liquid medium containing 15 μg / mL CHL for culture. The above bacterial liquid was cultured at 30°C under shaking conditions until the stable period, and was used to extract bacterial total RNA. The recombinant plasmid pBBR1-0-dCas12a contained in the control strain is characterized by containing a dcas12a gene without a promoter.

[0134] 2. Reverse Transcription

[0135] Reverse transcription reactions were performed using Novozymes’ HiScript III RT SuperMix for qPCR (+gDNAwiper).

[0136] 3. Real-time fluorescence quantitative PCR

[0137] The relative expression of dcas12a gene in recombinant bacteria S. paucimobilis (pBBR1-dCas12a-crRNA) was determined by RT-qPCR. 16sRNA was used as the internal reference gene, the internal reference gene was primered with RT-16S-F / R, the dcas12a gene was primered with RT-dCas12a-F / R, and S. paucimobilis (pBBR1-0-dcas12a) was used as the control bacteria. There is no promoter of dcas12a in the pBBR1-0-dcas12a plasmid. The relative expression of dcas12a in the control bacteria was defined as 1, and 2 was calculated based on the obtained Ct value. （-ΔΔCt） The relative expression of dcas12a gene was obtained. The results are expressed as mean ± SEM of three parallel samples. The differences between the groups were analyzed by t-test. * indicates P < 0.05, and ** indicates P < 0.01. Figure 6 As shown, for the CRISPRi / dCas12a system, the expression level of dcas12a was approximately 29.67 times that of the control group.

[0138] Example 4

[0139] Using the CRISPRi / dCas12a system to inhibit the expression of the oafA gene in Sphingomonas paucimobilis

[0140] 1. Construction of the CRISPRi / dCas12a system targeting the oafA gene and the oafA promoter region

[0141] 1. Design and synthesis of sgRNA

[0142] For the CRISPRi / dCas12a system, the PAM sequence that the dCas12a protein can recognize is 3'-TTTV-5', so the target position of the gRNA should be immediately downstream of it and should not have any special secondary structure, and its sequence specificity should be retrieved from NCBI. Based on this, a total of 6 gRNAs were designed for the oafA gene: oafA1', oafA2', oafA3', oafA4', oafA5' and oafA6' ( Figure 7 The first three primers target the coding strand, and the last three primers target the non-coding strand. Finally, the primers dCas12a-oafAn'-F / R (n'=1', 2', 3', 4', 5', 6') were sent to the company for synthesis and purified by PAGE. In addition, the experiment also designed five sites P1, P2, P3, P4, and P5 targeting the predicted promoter of oafA ( Figure 7 In B), the primer dCas12a-Pn-F / R was sent to the company for synthesis and purified by PAGE (n=1, 2, 3, 4, 5).

[0143] 2. gRNA annealing to form sticky ends

[0144] Add primers to double distilled water to a final concentration of 100 pmol / μL, and anneal gRNA to form a double strand: add the following components to a sterile PCR tube: dCas12a-oafAn' / oafAPn-F (n'=1-6, n=1-5) 1μL, dCas12a-oafAn' / oafAPn-R (n'=1-6, n=1-5) 1μL, T4 Polynucleotide Kinase 0.5μL, T4 Ligease Buffer 2.5μL and ddH2O 6.5μL.

[0145] The annealing reaction procedure is as follows: ① 37℃ for 30min; ② 95℃ for 5min; 5℃ / min to 25℃.

[0146] 3. Linearization of pBBR1-dCas12a-crRNA

[0147] The CRISPRi / dCas12a system vector was linearized with the restriction endonuclease BspQ I. 50 μL of enzyme digestion system: pBBR1-dCas12a-crRNA 1 μg, BspQ I 1 μL, rCutsmart Buffer 5 μL, and the balance ddH2O.

[0148] The reaction procedure is as follows: 50°C for 5 hours, and the correct bands are excised and recovered after verification by 1% agarose gel electrophoresis. The gel recovery uses the OMEGA Gel Extraction Kit, and the specific process is referred to the kit manual.

[0149] 4. Connect gRNA annealing product to linearized vector

[0150] The dCas9 linearized vector and gRNA annealing product were ligated using T4 DNA Ligase.

[0151] The reaction procedure is as follows: 16°C overnight. The reaction product can be stored at -20°C.

[0152] 5. Chemical transformation of ligation product into E.coli DH5α

[0153] 6. Connection result verification

[0154] (1) Colony PCR: single colonies growing on the surface of LB / CHL plates were picked and made into bacterial suspensions. For the plasmid extracted from pBBR1-dCas12a-oafAn' (n'=1-6), dCas12a-oafAn'-F was used as the upper primer and pBBR1-VR was used as the lower primer to perform PCR verification and screening of positive clones. For the plasmid extracted from pBBR1-dCas12a-Pn (n=1-5), crRNA-VF was used as the upper primer and dCas12a-Pn-R was used as the lower primer to perform PCR verification and screening of positive clones. The reaction procedure is as follows:

[0155] ① Pre-denaturation at 94℃ for 3min, ② Denaturation at 94℃ for 30s; annealing at 58℃ for 30s; extension at 72℃ at 1kb / min, repeat the above cycle 32 times, ③ Extension at 72℃ for 10min. After the PCR product was verified by agarose gel electrophoresis, it was cultured at 37℃ overnight.

[0156] (2) Plasmid PCR: Inoculate the bacterial suspension of a single colony with the correct band into LB medium containing 25 μg / mL CHL and culture overnight at 37°C in a shaking incubator. The next day, use the Novozymes FastPure Plasmid Mini Kit to extract the plasmid.

[0157] (3) Sequencing verification: the extracted plasmid is used as a template and crRNA-F is used as a primer to be sent to the company for sequencing. The sequencing results are compared with the designed crRNA sequence, such as Figure 8 and Fig. 9 The crRNA part of the sequencing results shown is completely consistent with the designed crRNA sequence, that is, the CRISPRi / dCas12a system of the target oafA gene and its promoter was successfully constructed.

[0158] 2. Construction of experimental strain S. paucimobilis (pBBR1-dCas12a-oafAn' / Pn)

[0159] 1. Preparation of S. paucimobilis ATCC 31461 competent cells

[0160] 2. Recombinant plasmid pBBR1-dCas12a-oafAn' / Pn was electroporated into S. paucimobilis

[0161] 3. Verification of positive strains in experimental strains

[0162] In order to obtain the experimental strain of CRISPRi / dCas12a containing the target oafA and oafA promoter region, the CRISPRi / dCas12a plasmids pBBR1-dCas12a-oafAn' and pBBR1-dCas12a-Pn were electroporated into S. paucimobilis competent cells, and single colonies on the plates were picked to recover and extract plasmids. For the plasmid extracted from pBBR1-dCas12a-oafAn' (n'=1-6) as a template, dCas12a-oafAn'-F as the upper primer and pBBR1-VR as the lower primer were used to perform PCR verification and screening of positive clones. For the plasmid extracted from pBBR1-dCas12a-Pn (n=1-5) as a template, crRNA-VF as the upper primer and dCas12a-Pn-R as the lower primer were used to perform PCR verification and screening of positive clones, as shown in Figure 2. Fig.10 and Fig.11 As shown: At least one sample of the three transformation products amplified the target band of the correct size. The recombinant plasmids pBBR1-dCas12a-oafAn' and pBBR1-dCas12a-Pn were successfully transformed into S. paucimobilis, and the strains containing the target oafA and oafA promoter regions of the CRISPRi / dCas12a system were successfully constructed.

[0163] 3. RT-qPCR determination of oafA expression

[0164] The successfully constructed CRISPRi / dCas12a strains S. paucimobilis (pBBR1-dCas12a-oafAn') and S. paucimobilis (pBBR1-dCas12a-Pn) were used as the experimental group, and S. paucimobilis (pBBR1-dCas12a-crRNA) was used as the control. They were inoculated into YM liquid culture medium containing 15 μg / mL CHL for culture. The above bacterial liquid was cultured at 30°C with shaking until the stable phase, and then used to extract bacterial total RNA.

[0165] 1. Extraction of Total Bacterial RNA

[0166] 2. Reverse Transcription Reaction

[0167] 3. Real-time fluorescence quantitative PCR

[0168] In order to detect the transcriptional inhibition effect of the CRISPRi / dCas12a system on the oafA gene, this experiment used the RT-qPCR method. The experimental strains S. paucimobilis (pBBR1-dCas12a-oafAn') and S. paucimobilis (pBBR1-dCas12a-Pn) and the control strain S. paucimobilis (pBBR1-dCas12a-crRNA) were cultured to the stable period and then the total RNA was extracted. The 16S rRNA of S. paucimobilis ATCC 31461 was used as the internal reference gene, the internal reference gene was RT-16S-F / R as primers, and the oafA gene was RT-oafA-F / R as primers. The expression level of oafA was measured, and the relative expression level of the oafA gene in the control strain was defined as 1. Fig.12 As shown, the expression of oafA in the experimental strains ranged from 9.34 to 100%, among which oafA3' performed best among the crRNA targeting gene sites, reaching a knockdown efficiency of 85.23%. For sites targeting the promoter region, the P3 site had a strong inhibitory effect, with an inhibition efficiency of up to 90.66%.

[0169] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A CRISPRi / dCas12a gene regulation system for Sphingomonas paucimobilis, characterized in that: It includes a pBBR1-dCas12a-crRNA plasmid, wherein the pBBR1-dCas12a-crRNA plasmid includes a pBBR1 replicon, a dCas12a gene, a crRNA expression cassette and a chloramphenicol resistance gene; the crRNA expression cassette includes a Ptac promoter, two DR fragments and an rrnB T1 terminator, and the nucleotide sequence of the crRNA expression cassette is shown in SEQ ID NO.

1.

2. The CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis according to claim 1, characterized in that The nucleotide sequence of the pBBR1 replicon is shown in SEQ ID NO.2; the nucleotide sequence of the dCas12a gene is shown in SEQ ID NO.3; and the nucleotide sequence of the chloramphenicol resistance gene is shown in SEQ ID NO.

4.

3. The CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis according to claim 1, characterized in that The Sphingomonas paucimobilis includes the Sphingomonas paucimobilis strain ATCC 31461.

4. A method for constructing a CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis according to any one of claims 1 to 3, comprising the following steps: The pBBR1 replicon, dCas12a gene, crRNA expression cassette and chloramphenicol resistance gene were amplified respectively, and connected using a seamless cloning method to obtain the pBBR1-dCas12a-crRNA plasmid, which is the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis.

5. A CRISPRi / dCas12a gene regulation system for knocking down oafA gene expression in Sphingomonas paucimobilis, characterized in that: The Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene is based on the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis described in any one of claims 1 to 3, and further contains an sgRNA for knocking down the expression of the oafA gene.

6. The Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down oafA gene expression according to claim 5, characterized in that The sgRNA is inserted between the two DR segments of the crRNA expression cassette.

7. The Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down oafA gene expression according to claim 5, characterized in that The sgRNA includes a gRNA targeting the oafA gene and a gRNA targeting the predicted promoter of oafA; the gRNA targeting the oafA gene includes oafA1', oafA2', oafA3', oafA4', oafA5' and oafA6', and the gRNA targeting the predicted promoter of oafA includes P1, P2, P3, P4, and P5; Primers for amplifying oafA1' include dCas12a-oafA1'-F with a nucleotide sequence as shown in SEQ ID NO.5 and dCas12a-oafA1'-R with a nucleotide sequence as shown in SEQ ID NO.6; Primers for amplifying oafA2' include dCas12a-oafA2'-F with a nucleotide sequence as shown in SEQ ID NO.7 and dCas12a-oafA2'-R with a nucleotide sequence as shown in SEQ ID NO.8; Primers for amplifying oafA3' include dCas12a-oafA3'-F with a nucleotide sequence as shown in SEQ ID NO.9 and dCas12a-oafA3'-R with a nucleotide sequence as shown in SEQ ID NO.10; Primers for amplifying oafA4' include dCas12a-oafA4'-F with a nucleotide sequence as shown in SEQ ID NO.11 and dCas12a-oafA4'-R with a nucleotide sequence as shown in SEQ ID NO.12; Primers for amplifying oafA5' include dCas12a-oafA5'-F with a nucleotide sequence as shown in SEQ ID NO.13 and dCas12a-oafA5'-R with a nucleotide sequence as shown in SEQ ID NO.14; Primers for amplifying oafA6' include dCas12a-oafA6'-F with a nucleotide sequence as shown in SEQ ID NO.15 and dCas12a-oafA6'-R with a nucleotide sequence as shown in SEQ ID NO.16; The primers for amplifying P1 include dCas12a-P1-F with a nucleotide sequence as shown in SEQ ID NO.17 and dCas12a-P1-R with a nucleotide sequence as shown in SEQ ID NO.18; The primers for amplifying P2 include dCas12a-P2-F having a nucleotide sequence as shown in SEQ ID NO.19 and dCas12a-P2-R having a nucleotide sequence as shown in SEQ ID NO.20; The primers for amplifying P3 include dCas12a-P3-F having a nucleotide sequence as shown in SEQ ID NO.21 and dCas12a-P3-R having a nucleotide sequence as shown in SEQ ID NO.22; The primers for amplifying P4 include dCas12a-P4-F having a nucleotide sequence as shown in SEQ ID NO.23 and dCas12a-P4-R having a nucleotide sequence as shown in SEQ ID NO.24; The primers for amplifying P5 include dCas12a-P5-F having a nucleotide sequence as shown in SEQ ID NO.25 and dCas12a-P5-R having a nucleotide sequence as shown in SEQ ID NO.

26.

8. A method for constructing a CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene of any one of claims 5 to 7, comprising the following steps: On the basis of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis according to any one of claims 1 to 3, an sgRNA that knocks down the expression of the oafA gene is inserted to obtain the Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system that knocks down the expression of the oafA gene.

9. Use of the CRISPRi / dCas12a gene regulation system of Sphingomonas paucimobilis according to any one of claims 1 to 3 in gene interference in Sphingomonas paucimobilis.

10. Use of the Sphingomonas paucimobilis CRISPRi / dCas12a gene regulation system for knocking down the expression of the oafA gene according to any one of claims 5 to 7 in the production of acylated gellan gum.

Images