Pesticide residue detection device and detection method and application thereof

Abstract

The invention provides a pesticide residue detection device and a detection method and application thereof.The device comprises a cleaning mechanism, a filtering mechanism, an elution mechanism and a detection module, multiple nucleic acid aptamers are fixed to a filter element, the sequences of the nucleic acid aptamers are optimized, the pesticide fixing and specific capturing capacity is improved, proper cleaning liquid and eluent are screened, and the pesticide residue detection efficiency is improved. And the cleaning and eluting effects of residual pesticides in agricultural products are improved. When the device is used for enriching and detecting pesticide residues, the pesticide residues in the agricultural products can be accurately detected through the detection module only by carrying out nondestructive cleaning, filtering and elution on the agricultural products to obtain a sample solution to be detected, and a test strip or an electrochemical detection part containing a nucleic acid aptamer probe in the detection module can be used for accurately detecting the pesticide residues in the agricultural products. Moreover, qualitative and quantitative detection of residual pesticide can be realized respectively, the structure is simple, the detection is convenient and efficient, and the accuracy of a detection result can be ensured.

Description

Technical Field

[0001] The present invention relates to the technical field of pesticide residue detection, and in particular to a pesticide residue detection device and a detection method and application thereof. Background Art

[0002] Pesticides have the function of killing harmful organisms that harm agricultural production and regulating plant growth. After applying pesticides, after a period of natural elimination, the pesticide residue can generally reach the permitted level. However, in the actual agricultural production process, growers often use pesticides based on their own experience, with many types of pesticides, unreasonable dosages, and frequent applications, which easily leads to excessive pesticide residues in agricultural products.

[0003] Existing pesticide residue detection devices usually require agricultural products, such as vegetable leaves, to be crushed to extract juice and sample processing before pesticide detection. This is because vegetable leaves are delicate and easily damaged, and the amount of pesticide obtained by non-destructive elution methods is too low to be detected. However, due to the uneven distribution of pesticide residues on the surface of vegetable leaves, destructive local sampling is difficult to be representative. In order to obtain accurate results, it is necessary to achieve non-destructive and comprehensive testing.

[0004] However, most of the existing pesticide residue detection equipment requires cutting, crushing and other pre-treatment of agricultural products to improve the efficiency of pesticide extraction. For example, CN117074397A provides a leek pesticide residue detection device, which requires a cutter to cut leeks, and also requires a grinding wheel to grind the cutter to ensure the sharpness of the cutter, which significantly increases the costs of blade wear, maintenance and repair. The food surface pesticide residue detection device provided by CN220019554 also requires crushing and extruding the food, and it also requires multiple crushing. The roller shaft needs to be rotated to drive the crushing wheel to rotate and crush to improve the reliability of the pesticide residue detection results. In addition, in order to improve the efficiency of pesticide extraction in agricultural products, some detection equipment also needs to use blade cutting, crushing and then combined with organic reagent soaking, making the process more cumbersome and more costly. Therefore, how to achieve non-destructive detection of pesticide residues in agricultural products is an important problem currently faced.

[0005] CN107870242A provides a kit for detecting pesticide residues based on nucleic acid aptamers, but it can only detect liquid samples and cannot directly enrich samples from agricultural products. Its nucleic acid aptamers can only be used for detection, not enrichment, and can only be used for the detection of one type of pesticide.

[0006] In summary, there is an urgent need to find a method and equipment that can quickly and efficiently enrich and detect pesticide residues in agricultural products, without cutting or destroying the agricultural products, and can also shorten the detection time, reduce the detection cost and improve the detection accuracy. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a pesticide residue detection device and its detection method and application. The device includes a cleaning mechanism, a filtering mechanism, an elution mechanism and a detection module. By fixing a plurality of nucleic acid aptamers on a filter element, optimizing the sequence of nucleic acid aptamers, improving the ability to fix and specifically capture pesticides, and screening suitable cleaning liquids and elution liquids, the cleaning and elution effects of residual pesticides in agricultural products are improved. The device is used to enrich and detect pesticide residues, and it is possible to achieve non-destructive cleaning of agricultural products, filtering and eluting to obtain the sample liquid to be tested, and then the residual pesticides in the agricultural products can be accurately detected through the detection module. The test strips in the detection module or the electrochemical detection components containing nucleic acid aptamer probes can also respectively realize the qualitative and quantitative detection of residual pesticides. The structure is simple, the detection is convenient and efficient, and the accuracy of the detection results can be guaranteed.

[0008] On the one hand, the present invention provides a pesticide residue detection device, characterized in that it includes a pre-treatment module and a detection module, wherein the pre-treatment module is provided with a filtering mechanism, wherein a first nucleic acid aptamer that adsorbs a target analyte is fixed in the filtering mechanism, and is used to pre-treat a sample and enrich the target analyte to obtain a sample liquid to be tested;

[0009] The detection module is used to detect the target analyte in the sample liquid.

[0010] Existing pesticide residue detection devices usually have to use cutting, breaking, crushing and other processing methods to extract more pesticide residues from agricultural products as much as possible due to the unsatisfactory effect of pesticide residue extraction and enrichment, hoping to improve extraction efficiency and detection accuracy. The present invention cleverly utilizes the characteristics of nucleic acid aptamers that can bind to target substances with high specificity and selectivity, fixes the target analyte nucleic acid aptamers on the filter element, thereby significantly improving the ability of the filter element to intercept and adsorb the target analyte, so that it can specifically capture pesticides through nucleic acid aptamers, retain them on the surface of the filter element, and adsorb the target substance to be tested from the liquid sample as much as possible, so as to achieve a more efficient separation of the target substance and the remaining impurities in the liquid sample, and achieve the enrichment effect of residual pesticides, and obtain a sample liquid to be tested containing a high concentration of pesticides after elution.

[0011] Furthermore, the target analyte includes any one or more of malathion, ethyl carbamate, acetamiprid, clothianidin, and thiamethoxam.

[0012] It is understandable that the method provided by the present invention can be applied to any residual pesticide. It only needs to screen a suitable nucleic acid aptamer for the pesticide and fix it on a filter element to enrich and detect the pesticide.

[0013] Furthermore, the filtering mechanism comprises a filter core, the first nucleic acid aptamer is fixed in the filter core, and the nucleic acid aptamer has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence at the 5' end.

[0014] The first nucleic acid aptamer for fixing in the filter element provided by the present invention is significantly different from the existing nucleic acid aptamers. A sequence needs to be added to the 5' end of each nucleic acid aptamer. First, a repeated T sequence is added to achieve chemical adsorption with the filter element surface by using the functional groups such as hydroxyl groups carried by thymine. Then a repeated C sequence is added to create a distance between the nucleic acid aptamer and the filter element to avoid the filter element and the nucleic acid aptamer being too close to each other, resulting in a decrease in binding efficiency.

[0015] Furthermore, the first nucleic acid aptamer includes a first nucleic acid aptamer of malathion, a first nucleic acid aptamer of ethyl carbamate, a first nucleic acid aptamer of acetamiprid, a first nucleic acid aptamer of clothianidin and a first nucleic acid aptamer of thiamethoxam, each having a nucleotide sequence as shown in Seq ID NO.1 to 5 in the sequence table.

[0016] The first nucleic acid aptamer sequence of malathion: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-CGATTC GTA CTA TGG TAT CCG AGA GGC CTA CGG-3'(Seq ID NO.1); the first nucleic acid aptamer sequence of ethyl formate: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-TGG GGG CAT GGG AGG TTG CCTAGA GCG GTG-3'(Seq ID NO.2); the first nucleic acid aptamer sequence of acetamiprid: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-TGA TCG CTG ACA CCA TAT TAT GAA GA-3'(Seq ID NO.3); the first nucleic acid aptamer sequence of clothianidin: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCCC)-GCC GCC TCT GGG ACTCTC GTT CCC TG-3' (Seq ID NO.4); the first nucleic acid aptamer sequence of the thiamethoxam: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GAA TTC GTC GAC GGA TCC ACC GAC CAT GCA AAG ATG CAC AA-3' (Seq ID NO.5).

[0017] The invention improves the nucleic acid aptamer sequences of five pesticides so that the aptamer sequences can ensure the binding effect on the filter element surface and improve the ability of specifically adsorbing specific pesticide components.

[0018] In addition to the additional sequence added to the 5' end of the nucleic acid aptamer, other sequences of the nucleic acid aptamer provided by the present invention have also been modified with individual bases. Experiments have confirmed that the modified nucleic acid aptamer sequence has a better binding efficiency with pesticides on the filter element than the free state.

[0019] Furthermore, the filter element is tilted at an angle of 5 to 15 degrees to the horizontal plane, and a flow chamber is provided at the lower end; the material of the filter element includes any one or more of polyacrylonitrile, polystyrene plastic, polyvinylidene fluoride, polyvinyl chloride, and polypropylene.

[0020] The filter element needs to be fixed in the detection device with plastic materials such as glue, silica gel, and resin to make the filter element sealed. The crude sample liquid obtained by washing agricultural products can only flow into the waste liquid bin after being filtered by the filter element. However, since the diameter of the pesticide trapped in the filter element is larger than the pore size of the filter element, the eluted pesticide can only flow down from one end of the filter element surface during the elution process. Therefore, the filter element needs to be placed at an angle and equipped with a flow bin to allow the residual pesticide to be smoothly eluted and collected.

[0021] The flow chamber is set in the concave part of the inner wall of the detection device, so the end of the filter element that is tilted downward is not completely sealed, but this does not affect the filtration and adsorption of the crude sample liquid. Since the filter element is tilted at a small angle and the flow chamber is located below the tilt of the filter element, that is, there is only a small sealing gap at the lower end of the filter element, the crude sample liquid can basically be filtered by the filter element, which will not affect the accuracy of the test results.

[0022] In some embodiments, the nucleic acid aptamer is fixed on the upper surface of the filter element so that it can more fully contact the liquid sample and improve the extraction and enrichment effect of the target analyte.

[0023] In some embodiments, the flow chamber is a square chamber, which opens at a lower side of the filter element.

[0024] When the eluent flows through the filter element from the elution chamber, the eluent can dissociate the hydrogen bonds between the target analyte and the nucleic acid aptamer, but it is difficult to dissociate the chemical bonds that fix the nucleic acid aptamer to the filter element. Therefore, the eluent can elute and carry the retained residual pesticides away from the filter element, and the nucleic acid aptamer continues to be fixed on the filter element.

[0025] During the sample cleaning process, the pesticide is captured by the nucleic acid aptamer when passing through the filter element, so it does not pass through the filter element aperture, and the flow chamber is closed, and the remaining cleaning liquid goes down through the filter element aperture; when eluting with the elution liquid, the pesticide is washed down, because the side flow chamber is open, so the liquid passes through the side first, and a very small amount of the filter element goes down but all enters the same position (collection chamber), and the speed of passing through the flow chamber can be much faster. The outlet of the flow chamber is controlled by an L-type valve.

[0026] In some embodiments, the filter element is a circular cake-shaped filter element made of a microporous filter membrane material with a gap of 0.22 microns and fixed with multiple pesticide nucleic acid aptamers, so as to achieve a second filtration of the liquid containing residual pesticides (the first filtration is a filter mesh filtration). When the liquid flows through the filter element, the nucleic acid aptamers on the filter element specifically bind to the residual pesticides, and the remaining substances flow into the waste liquid tank from the waste liquid port along with the filtrate.

[0027] In some embodiments, the filter element material is preferably polyvinylidene fluoride. The filter element material provided by the present invention can more firmly bind to the nucleic acid aptamer, and the nucleic acid aptamer will not be eluted when eluted with an eluent, so that the filter element with the nucleic acid aptamer can be reused.

[0028] Furthermore, the filtering mechanism also includes a filter screen, a waste liquid bin and a collection bin, the filter screen is located above the filter element, the waste liquid bin and the collection bin are located below the filter element, and a valve is provided between the waste liquid bin and the collection bin to control whether the liquid flows into the waste liquid bin or the collection bin.

[0029] The filter screen is fixed by glue, silica gel, resin or other plastic materials, and the filter screen is fixed between the filter port and the filter element to ensure that the liquid can only enter the filter element through the filter screen, and the filter element has sealing performance.

[0030] In some embodiments, the filter is made of a mesh material of 80-100 meshes, which achieves the first filtration of the liquid containing residual pesticides and intercepts larger impurities such as dust, insect eggs, and soil in the liquid.

[0031] In some embodiments, the valve is an L-shaped valve, which is used to control the flow direction of the liquid after filtration or elution. In the initial state (the stage where the crude sample liquid obtained by washing is filtered through the filter element), the valve closes the entrance of the collection chamber, and the filtered liquid flows into the waste liquid chamber; in the start-up state (the stage where the eluent elutes the sample liquid to be tested from the filter element), the valve closes the outlet of the waste liquid chamber, and the eluted liquid flows into the collection chamber.

[0032] The waste liquid bin is used to collect the waste liquid after filtration and is located below the filter element. After the process is completed, the waste liquid bin can be drawn out and the waste liquid can be poured out. The collection bin is used to collect the sample liquid to be tested containing pesticide residues after elution and is located below the filter element and parallel to the waste liquid bin. A detection port is provided at the bottom of the collection bin, and the sample liquid to be tested flows into the detection module through the detection port at the bottom.

[0033] Furthermore, the pre-treatment module also includes a cleaning mechanism, which uses a cleaning solution to clean the sample to obtain a crude sample solution, which enters a filtering mechanism; the cleaning solution includes sodium lauryl sulfate, cocoyl diethanolamine and citric acid / citrate.

[0034] In the prior art, when agricultural products are tested for pesticide residues, 10% or 20% methanol is usually used as an organic solvent for extracting pesticides. Methanol is flammable and can cause combustion and explosion in an open flame or high-temperature environment, posing a safety hazard. At the same time, the recovery rate of methanol for alkaline pesticides is low and cannot meet the requirements for pesticide residue testing. There are also reports that the immersion method is needed for pesticide testing, which requires a long waiting time, or the stirring method is used to accelerate elution, which will cause damage to the agricultural products. At the same time, the obtained juice contains a large amount of plant tissue and impurities, and the subsequent processing is cumbersome.

[0035] The cleaning liquid formula provided by the invention can thoroughly clean residual pesticides in agricultural products, the cleaning liquid has no large impurities, the extraction time is short, and the elution efficiency is high.

[0036] Furthermore, the mass concentration of the sodium lauryl sulfate is 0.1-0.5%, the mass concentration of cocoyl diethanolamine is 0.1-0.5%, and the volume fraction of the citric acid / citrate is 1-2%; the cleaning solution also contains a surfactant and a builder.

[0037] The cleaning liquid provided by the invention is a mixed liquid added with sodium lauryl sulfate, cocoyl diethanolamine and citric acid / citrate, wherein the concentrations of sodium lauryl sulfate and cocoyl diethanolamine are between 0.1% and 0.5%, and the volume fraction of the mixed liquid of citric acid / citrate is between 1% and 2%.

[0038] The cleaning liquid also contains a surfactant and a detergent, which can not only provide an effective pesticide elution effect, but also utilize the foaming effect of the surfactant to reduce the total volume of the cleaning liquid while ensuring full contact between the cleaning liquid and the agricultural products (such as vegetable leaves), thereby increasing the concentration of pesticides in the liquid after elution.

[0039] In some embodiments, the surfactant is a fatty acid salt, and the builder is propylene glycol.

[0040] Furthermore, the pre-treatment module also includes an elution mechanism, which elutes the sample to be tested from the filter element by releasing an eluent to obtain a sample liquid to be tested; the eluent includes ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and Tris buffer containing Tween20.

[0041] In some embodiments, the eluent is a Tris buffer added with ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, ultrapure water, 0.85% NaCl, and 3% Tween 20. Ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, and ultrapure water are used to elute the residual pesticides adsorbed on the filter element; 0.85% NaCl and 3% Tween 20 are used to promote the operation of the residual pesticide sample solution on the detection chip.

[0042] The eluent can significantly improve the effect of eluting pesticides from the filter element, destroying the hydrogen bonds between the pesticides and the nucleic acid aptamers fixed in the filter element, but will not destroy the chemical bonds connecting the nucleic acid aptamers and the filter element, and will not elute the nucleic acid aptamers from the filter element. After elution is completed, the filter element can be reused.

[0043] Furthermore, the cleaning mechanism comprises a cleaning barrel, in which a cleaning liquid tank is provided for loading and releasing cleaning liquid; a rotating disc is provided under the cleaning barrel; the elution mechanism is located on one side of the cleaning mechanism and is connected to the filtering mechanism through a valve.

[0044] In some embodiments, the cleaning barrel is a hard plastic barrel used for storing and cleaning samples; the top is fitted with a barrel cover sealing ring; and a rotating disc is fixed at the bottom.

[0045] The barrel cover seals the cleaning barrel and the cleaning liquid tank to prevent liquid from splashing out. A rubber ring and a buckle are fixed inside the hard and airtight barrel cover to ensure the integrity and airtightness of the sample to be tested and the liquid reagent during rotation.

[0046] In some embodiments, the cleaning liquid tank is a hollow cylinder with a circle of small circular holes on the top, and the bottom is a telescopic rod with a silicone head that can fit closely. The upward push of the telescopic rod enables the cleaning liquid to be evenly sprayed from the small holes on the top until the telescopic rod is fully extended and the liquid is completely sprayed.

[0047] In some embodiments, the bottom of the cleaning barrel is provided with filter ports, which are opened outside the rotating disc and are distributed at equal distances.

[0048] In some embodiments, the filter port includes a filter hole and a one-way valve, which allows the liquid containing residual pesticides obtained from the cleaning bucket to enter the filter mechanism. The one-way valve is installed in the filter hole to allow the liquid to flow into the filter mechanism in one direction while preventing the liquid from splashing out of the filter mechanism.

[0049] In some embodiments, the filter holes are located below the cleaning bucket of the cleaning module, open to the outside of the rotating disc, and are distributed at equal distances.

[0050] In some embodiments, the elution mechanism includes an elution liquid tank and an elution liquid tank valve; the eluent is located in the eluent tank, and the eluent tank is made of opaque material and is used to store a quantitative amount of eluent to prevent the surfactant from being decomposed by light. At the same time, there is an eluent tank valve below the eluent tank, and the flow of the eluent is controlled by a control module to complete the elution of residual pesticides adsorbed on the filter element of the filtering mechanism to obtain a pesticide residue sample liquid.

[0051] Furthermore, the detection module includes a detection chip, the detection chip includes an electrochemical detection component, the electrochemical detection component includes a working electrode and a probe, and the probe includes a second nucleic acid aptamer that captures the target analyte.

[0052] In some embodiments, the detection module includes a detection port, a camera, a detection chip, and an electrochemical socket.

[0053] The detection port is tightly connected to the collection chamber of the filter mechanism and the detection chip of the detection module, and its diameter is consistent with the sample addition port of the detection chip, so that the pesticide residue sample liquid is completely transferred to the detection chip to complete the detection process.

[0054] The camera is used to scan the color changes of the test line (T line) and the quality control line (C line) on the test strip in the detection window, and transmit the color value back to the mobile terminal through Bluetooth or wireless network for data processing and result analysis, so as to complete the qualitative and semi-quantitative judgment of the pesticide residue sample liquid and realize preliminary detection. A color value detection threshold is set for five pesticides. If the color value of a certain pesticide in the pesticide residue sample liquid exceeds the detection threshold, the electrochemical quantitative detection of the pesticide is carried out for accurate analysis. The camera is located below the motor and above the detection window of the detection chip.

[0055] Furthermore, the second nucleic acid aptamer includes any one of a second nucleic acid aptamer of malathion, a second nucleic acid aptamer of ethyl carbamate, a second nucleic acid aptamer of acetamiprid, a second nucleic acid aptamer of clothianidin, and a second nucleic acid aptamer of thiamethoxam, and each has a nucleotide sequence as shown in Seq ID NO.6 to 10 in the sequence table.

[0056] The second nucleic acid aptamer sequence of malathion is: GCG ATT CGT ACT ATG GTA TCC GAG AGGCCT ACG (Seq ID NO.6); the second nucleic acid aptamer sequence of ethyl formate is: GGG GGC ACG GGA GGTTGC ATC GAG CGG TGG (Seq ID NO.7); the second nucleic acid aptamer sequence of acetamiprid is: GAT CGC TGA CACCAT ATT ATG AAG A (Seq ID NO.8); the second nucleic acid aptamer sequence of clothianidin is: TGG CCG CCT CTGGGA CTC TCG TTC CCT GGA (Seq ID NO.9); the second nucleic acid aptamer sequence of thiamethoxam is: TAG GGA ATTCGT CGA CGG ATC CAC CGA CCA TGC AAA GAT GCA CAA (Seq ID NO.10).

[0057] The present invention optimizes the second nucleic acid aptamer used for respectively detecting five pesticides, thereby improving the accuracy and sensitivity of electrochemical detection.

[0058] Furthermore, the detection chip also includes a microfluidic channel and a test strip, wherein the microfluidic channel is used to divert the sample liquid to be detected; and the test strip is a multiple detection test strip coated with antibodies of the target object to be detected.

[0059] Existing pesticide residue detection mainly uses classic chromatography and chromatography-mass spectrometry, which requires large and expensive equipment, professional technicians, and cumbersome experimental operations, and cannot meet the needs of rapid on-site detection of pesticide residues. The present invention provides a fast, efficient, and convenient detection chip based on microfluidic technology, which has the characteristics of low cost, easy to carry, reusable, and high sensitivity, and realizes rapid detection of target pesticides.

[0060] In addition, the existing pesticide residue detection usually uses a method of multiple sample preparation for parallel testing, which is inconvenient to operate and has low detection efficiency. At the same time, differences in operating environment and operators are prone to errors. The multi-channel detection chip provided by the present invention uses the same residual pesticide sample solution to simultaneously detect five common pesticides, shortening the detection time, saving detection samples, and improving the rigor of the results.

[0061] At the same time, the detection chip provided by the present invention can detect the target object to be detected by two detection methods, one is qualitative detection by test strips, and the other is quantitative detection by electrochemical detection. When the color value of a certain pesticide exceeds the threshold range during the qualitative detection by the test strips, the electrochemical quantitative detection of the pesticide is performed to avoid blind detection.

[0062] In some embodiments, the test strip and the electrochemical detection layer in the detection chip of the present invention can be easily taken out and replaced, saving detection costs.

[0063] In some embodiments, the microchannel is an F-shaped micron-scale groove for diverting the pesticide residue sample liquid, with its straight end connected to the sample injection port and its bifurcated ends respectively connected to the corresponding test strip slot and electrochemical detection slot.

[0064] In some embodiments, the test strip slot is a groove for placing the test strip, connected to the microfluidic channel, and the test strip can be replaced through the slot after the test is completed, thereby realizing multiple uses of a single test chip.

[0065] In some embodiments, the test strip is a multiple detection test strip, which can be used to complete the preliminary detection of five pesticide residue sample solutions. The test strip consists of a sample pad, a marking pad, a chromatography membrane, and an absorbent pad. The sample pad and the marking pad are mainly made of glass fiber material, non-woven fabric or filter paper; the absorbent pad is filter paper. The chromatography membrane is an NC nitrocellulose membrane pre-embedded with five detection lines (T lines) and one quality control line (C line), five artificial antigens of pesticides to be tested are used as detection lines, and goat anti-mouse secondary antibodies are used as quality control lines. The upper end of the chromatography membrane is attached to the sample pad and the marking pad, and the lower end is attached to the absorbent pad, and the various parts are connected to complete the connection.

[0066] Furthermore, the multiple detection test strips are provided with detection lines of malathion, ethyl carbamate, acetamiprid, clothianidin and thiamethoxam in sequence.

[0067] The present invention has been proved through research that the five test lines on the test strip are arranged in a specific order. After the sample enters the test strip, they are arranged in order from front to back according to malathion antigen, ethyl carbamate antigen, acetamiprid antigen, clothianidin antigen and thiamethoxam antigen, which can significantly reduce the mutual interference between the five pesticides and improve the accuracy of detection.

[0068] In some embodiments, the detection chip includes a chip top plate, a sample injection port, a microfluidic channel, a test strip slot, a multiple test strip, an electrochemical detection slot, a screen-printed electrode, and a chip bottom plate.

[0069] The chip top plate includes a top plate and a detection window. The top plate is a hard transparent plastic plate, which is used to seal the chip to prevent aerosol contamination. The detection window is a transparent plastic sheet, which is sized to include the area of ​​the T line and C line of the test strip, and is used for camera scanning.

[0070] The sample addition port is the entrance for adding the pesticide residue sample liquid into the detection chip, and its size fits the detection hole so that the liquid can completely flow into the chip to complete the detection.

[0071] In some embodiments, the detection chip controls the flow of the pesticide residue sample solution through a solenoid valve.

[0072] In some embodiments, the microfluidic channel includes a microfluidic channel connected to a reagent strip and a microfluidic channel connected to an electrochemical detection tank.

[0073] In some embodiments, the microchannel connected to the electrochemical detection tank includes five parallel microchannels, which are respectively used to detect five kinds of pesticides. Liquid entry is controlled by electromagnetic valves to complete quantitative detection of pesticide residue sample liquid.

[0074] In some embodiments, the screen-printed electrode provides a portable, high-precision three-electrode system that can be plugged into an electrochemical socket to perform quantitative detection of residual pesticides, and is composed of a working electrode, a counter electrode, a reference electrode, and a probe.

[0075] The working electrode is a working electrode on which graphene with special electrical properties is coated on the surface by deposition, coating, etc., and the substrate material can be selected from glass fiber material, non-woven fabric or filter paper. By detecting the change in the electrical properties of the working electrode, the non-quantifiable biological reaction is converted into a quantifiable electrical signal. The counter electrode forms a loop with the working electrode through the solution, providing a channel for electron transfer during the electrochemical detection process. The substrate material is the same as the working electrode. The reference electrode is an Ag / AgCl reference electrode, which forms a loop with the working electrode through the solution, provides calibration for the electrode potential, and improves the accuracy of electrochemical detection. The probe is a nucleic acid aptamer, which captures the pesticide to be tested on the surface of the working electrode, causing the electrical properties of the working electrode to change.

[0076] In some embodiments, a specific type of pesticide can be detected by selecting an appropriate electrochemical detection cell.

[0077] The electrochemical detection tank includes a solenoid valve and a groove for placing a screen-printed electrode to complete quantitative detection. The solenoid valve controls the flow of the pesticide residue sample liquid. The five microchannels connected to the electrochemical detection tank are controlled by the solenoid valve to control the liquid to enter, thereby completing the quantitative detection of the pesticide residue sample liquid.

[0078] The chip base plate includes a base plate and an electrode interface. The base plate is a PVC base plate that supports the chip, and each part is assembled on the base plate. The electrode interface is located in the base plate area below the screen-printed electrode, and there are 15 electrode interfaces (three electrode interfaces are required for each pesticide detection, including a working electrode, a counter electrode, and a reference electrode) for connecting the electrochemical socket. The electrochemical socket completes quantitative detection through the electrode interface.

[0079] In some embodiments, the pesticide residue detection device further includes a control module, and the control module includes a power supply device, a motor device, a drive device, a control device, and a display device.

[0080] The power supply device is used to supply power, and when it is used in a fixed manner, a power plug with a ground wire is used, and when it is used in a mobile manner, a dry cell or a storage battery is used. The motor device is used to provide rotational power, and the operation of the drive device is realized by a stepper motor. The drive device provides driving force for the sample processing module by rotating a disc or a telescopic rod.

[0081] In some embodiments, the driving device controls the rotation direction, speed and time of the cleaning barrel by rotating the disc. The driving device sprays the cleaning reagent in the reagent loading chamber by controlling the upward movement of the telescopic rod.

[0082] The control device controls the electric components or mechanical components in the sample processing module, the filtering module, and the detection module through the motor control device, the connecting rod, and the valve.

[0083] In some embodiments, the control device controls the magnitude and direction of the current to the motor through the motor control device, thereby controlling the driving device. The control device controls the flow state of the eluent or pesticide residue sample liquid through a valve. The control device controls the linkage of the eluent tank valve of the elution mechanism and the L-shaped valve of the filtration mechanism through a connecting rod, and both are in an open state or a closed state at the same time.

[0084] In some embodiments, the display device is used for operators to issue instructions and obtain execution results, including cleaning procedures, elution procedures, qualitative detection procedures, and quantitative detection procedures. The working status of each part is indicated by the color of the indicator light, indicating power on, standby, working, etc.

[0085] In another aspect, the present invention provides a method for detecting pesticide residues in agricultural products, wherein the method uses the detection device as described above for detection, and comprises the following steps:

[0086] (1) placing the product into a cleaning bucket of a detection device, spraying cleaning liquid for cleaning, and obtaining a crude sample solution;

[0087] (2) The crude sample liquid flows into the filtration mechanism and is adsorbed by the filter element;

[0088] (3) the elution mechanism sprays the elution liquid to elute the object to be tested from the filter element to obtain the sample liquid to be tested;

[0089] (4) The sample liquid to be tested flows into the detection module for detection.

[0090] In yet another aspect, the present invention provides a cleaning solution for agricultural products, the cleaning solution comprising sodium lauryl sulfate, cocoyl diethanolamine and citric acid / citrate.

[0091] Furthermore, the mass concentration of the sodium lauryl sulfate is 0.1-0.5%, the mass concentration of cocoyl diethanolamine is 0.1-0.5%, and the volume fraction of the citric acid / citrate is 1-2%; the cleaning solution also contains a surfactant and a builder.

[0092] In some embodiments, the surfactant is a fatty acid salt, and the builder is propylene glycol.

[0093] On the other hand, the present invention provides a use of a cleaning liquid for preparing a reagent for improving the elution rate of pesticides in fruit and vegetable products, wherein the cleaning liquid comprises sodium lauryl sulfate, cocoyl diethanolamine and citric acid / citrate, and the pesticide comprises any one or more of malathion, ethyl carbamate, acetamiprid, clothianidin and thiamethoxam.

[0094] On the other hand, the present invention provides an eluent for preparing a reagent for improving the elution rate of pesticides in a filter element, wherein a nucleic acid aptamer is fixed in the filter element, and the pesticide is adsorbed by the filter element through the nucleic acid aptamer; the eluent comprises ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and Tris buffer containing Tween20; the pesticide comprises any one or more of malathion, ethyl carbamate, acetamiprid, clothianidin, and thiamethoxam; the nucleic acid aptamer has a nucleotide sequence as shown in any one or more of Seq ID NO.1 to 5 in the sequence table.

[0095] On the other hand, the present invention provides a method for filtering and adsorbing a target analyte based on a filter element, wherein a nucleic acid aptamer of the target analyte is fixed on a filter element and then used for filtering and adsorbing the target analyte, wherein the nucleic acid aptamer has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence at the 5' end.

[0096] On the other hand, the present invention provides a use of a nucleic acid aptamer for preparing a reagent for improving the adsorption effect of pesticides on a filter element, wherein the pesticide includes any one or more of malathion, ethyl carbamate, acetamiprid, clothianidin, and thiamethoxam; the nucleic acid aptamer has a nucleotide sequence as shown in any one or more of Seq ID NO.1 to 5 in the sequence table.

[0097] On the other hand, the present invention provides a use of a nucleic acid aptamer for preparing a reagent for improving the detection sensitivity of electrochemical detection of pesticides, wherein the pesticides include any one or more of malathion, ethyl carbamate, acetamiprid, clothianidin, and thiamethoxam; the nucleic acid aptamer has a nucleotide sequence as shown in any one or more of sequence table Seq ID NO.6 to 10.

[0098] The present invention has the following beneficial effects:

[0099] 1. Provides a device that can detect pesticide residues by only non-destructively cleaning agricultural products, with a simple structure, convenient and efficient;

[0100] 2. By fixing a variety of nucleic acid aptamers on the filter element, the function of specifically adsorbing a variety of pesticide molecules is achieved, ensuring that the pesticides in the liquid sample can be fully extracted during filtration, thereby improving the reliability of subsequent detection;

[0101] 3. It can simultaneously detect five kinds of residual pesticides in agricultural products, including malathion, ethyl carbamate, acetamiprid, clothianidin and thiamethoxam;

[0102] 4. A sequence -(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)- was added to the 5' end of the five aptamers. The sequence does not recognize any target pesticide and does not produce a self-folding secondary structure. Among them, -(TTTTTTTTTT)- physically adsorbs and fixes the aptamer in the filter element and can be eluted by the eluent; -(CCCCCCCCCCCCCCC)- forms a distance with the filter element surface to avoid the destruction of the effective sequence;

[0103] 5. The sequence of the nucleic acid aptamer fixed on the filter element is optimized to enable it to more efficiently and specifically adsorb and enrich the pesticides in the sample solution;

[0104] 6. The most suitable cleaning solution formula has been screened to shorten the extraction time and improve the elution efficiency;

[0105] 7. The most suitable eluent formula was screened, which can significantly improve the effect of eluting pesticides from the filter element and destroy the hydrogen bond between the pesticide and the nucleic acid aptamer fixed in the filter element, but will not destroy the chemical bond between the nucleic acid aptamer and the filter element, and will not elute the nucleic acid aptamer from the filter element. After elution, the filter element can be reused;

[0106] 8. Optimized the nucleic acid aptamer sequence for electrochemical detection of pesticides to improve the accuracy and sensitivity of detection;

[0107] 9. Multi-channel detection chip, using the same residual pesticide sample solution to simultaneously detect five common pesticides, shortening the detection time, saving test samples, and improving the rigor of the results;

[0108] 10. By combining test strips and electrochemical technology, the samples are first tested qualitatively and semi-quantitatively, and then a decision is made based on the test results whether to use high-precision and high-cost instruments such as mass spectrometry for quantitative testing to avoid blind testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0109] Figure 1 This is a schematic diagram of the appearance of the pesticide residue detection device in Example 1;

[0110] Figure 2 Schematic diagram of the internal structure of the pesticide residue detection device in Example 1;

[0111] Figure 3 is a top view of the pesticide residue detection device in Example 1;

[0112] Figure 4 Schematic diagram of the liquid flow direction in the pesticide residue detection device in Example 1;

[0113] Figure 5 This is a schematic diagram of the process of intercepting residual pesticides by the filter element in Example 1;

[0114] Figure 6 This is a schematic diagram of the detection module in Example 1;

[0115] Figure 7 This is a schematic diagram of the structure of the detection chip in Example 1;

[0116] Figure 8 This is a schematic diagram of the structure of the multiple detection test strip in Example 1;

[0117] Fig. 9 Schematic diagram of the structure of the electrochemical detection component in Example 1. DETAILED DESCRIPTION

[0118] The preferred embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on it. The raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

[0119] In the description of the present invention, it should be understood that the terms "upper", "lower", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inside", "outside" and the like indicate positions or positional relationships based on the positions or positional relationships shown in the accompanying drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as limiting the present invention. In addition, the terms "first", "second", etc. are only used for descriptive purposes, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, features defined as "first", "second", etc. may explicitly or implicitly include one or more of the features. In the description of the present invention, unless otherwise specified, "multiple" means two or more.

[0120] In the description of the present invention, it should be noted that, unless otherwise clearly specified and limited, the terms "connected" and "connection" should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be indirectly connected through an intermediate medium, or it can be the internal communication of two components. For ordinary technicians in this field, the specific meanings of the above terms in the present invention can be understood by specific circumstances.

[0121] Embodiment 1: Pesticide residue detection device provided by the present invention

[0122] The pesticide residue detection device 10 provided in this embodiment is as follows Figure 1 and Figure 2 As shown, Figure 1 This is a schematic diagram of the appearance of the pesticide residue detection device. Figure 2 The figure is a schematic diagram of the internal structure of the pesticide residue detection device. The pesticide residue detection device includes a pre-treatment module 1 and a detection module 2. The pre-treatment module 1 is provided with a cleaning mechanism 3, a filtering mechanism 4 and an elution mechanism 5. The cleaning mechanism 3 uses a cleaning liquid to clean the agricultural products to obtain a crude sample liquid, which enters the filtering mechanism 4. The filtering mechanism 4 includes a filter element 6, in which a first nucleic acid aptamer 61 for adsorbing the target analyte is fixed, which is used to pre-treat the sample and enrich the target analyte. The elution mechanism 5 elutes the sample to be tested from the filter element 6 by releasing the elution liquid to obtain the sample liquid to be tested. The target analyte can be any residual pesticide. It only needs to screen a suitable nucleic acid aptamer for the pesticide and fix it on the filter element 6, so that it can be used to enrich and detect the pesticide.

[0123] Preferably, the target analytes in this embodiment include five pesticides, namely malathion, ethyl carbamate, acetamiprid, clothianidin and thiamethoxam, and the first nucleic acid aptamers 61 of the five pesticides are fixed in the filter element 6, and the fixed amount is 100 microliters of 20 micromoles per liter of the first nucleic acid aptamer 61 per square millimeter of the filter element 6 (the ratio of the five first nucleic acid aptamers is 1:1:1:1:1). Each first nucleic acid aptamer 61 has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence at the 5' end, wherein the first nucleic acid aptamer sequence of malathion is: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-CGA TTC GTA CTA TGG TATCCG AGA GGC CTA CGG-3'(Seq ID NO.1); the first nucleic acid aptamer sequence of ethyl formate is: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-TGG GGG CAT GGG AGG TTG CCT AGA GCG GTG-3'(Seq ID NO.2); the first nucleic acid aptamer sequence of acetamiprid is: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCCC)-TGA TCGCTG ACA CCA TAT TAT GAA GA-3'(Seq ID NO.3); the first nucleic acid aptamer sequence of clothianidin: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GCC GCC TCT GGG ACT CTC GTT CCC TG-3'(Seq ID NO.4); the first nucleic acid aptamer sequence of thiamethoxam: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GAA TTC GTCGAC GGA TCC ACC GAC CAT GCA AAG ATG CAC AA-3'(Seq ID NO.5).

[0124] like Figure 2, the filter element 6 is tilted at an angle of 5 to 15 degrees to the horizontal plane, and a flow chamber 8 is provided at the lower end 7; the filter element 6 needs to be fixed in the detection device 10 with plastic materials such as glue, silica gel, resin, etc., so that the filter element 6 has sealing properties around it, and the crude sample liquid obtained by washing agricultural products can only flow into the waste liquid chamber 9 after being filtered by the filter element 6. However, since the diameter of the pesticide trapped in the filter element 6 is larger than the pore size of the filter element 6, the eluted pesticide can only flow down from one end 7 of the surface of the filter element 6 during the elution process. Therefore, the filter element 6 needs to be tilted and provided with a flow chamber 8, so that the residual pesticide can be smoothly eluted and collected. The flow chamber 8 is a square chamber, which is set in the inner wall depression of the detection device 10, so the end of the filter element 6 tilted downward is not completely sealed, but this does not affect the filtration and adsorption of the crude sample liquid. Since the inclination angle of the filter element 6 is small and the flow chamber 8 is located below the inclination of the filter element 6, that is, there is only a small sealing gap at the lower end 7 of the filter element 6, the coarse sample liquid can basically be filtered through the filter element 6 without affecting the accuracy of the test results.

[0125] When the eluent flows through the filter element 6 from the eluent bin 25, the eluent can dissociate the hydrogen bond between the target analyte and the first nucleic acid aptamer 61, but it is difficult to dissociate the chemical bond between the first nucleic acid aptamer 61 and the filter element 6, so the eluent can elute and carry the retained residual pesticides away from the filter element 6, while the first nucleic acid aptamer 61 continues to be fixed on the filter element 6. Since the diameter of the residual pesticide is larger than the pore size of the filter element 6, it cannot flow out through the filter element 6, and will first enter the flow bin 8 from top to bottom along the inclined filter element 6 and then flow into the collection bin 12. The filter element 6 is a round cake-shaped filter element 6 made of a microporous filter membrane material with a gap of 0.22 microns and fixed with multiple pesticide nucleic acid aptamers, which realizes the filtration of the liquid containing residual pesticides. When the liquid flows through the filter element 6, the nucleic acid aptamer on the filter element 6 specifically binds to the residual pesticide, and the remaining substances flow into the waste liquid bin 9 from the waste liquid port along with the filtrate.

[0126] Therefore, the liquid flow pattern in the pesticide residue detection device 10 is as follows: Figure 4 As shown, the cleaning liquid is sprayed from the top, and the obtained crude sample liquid is filtered from the filter element 6 from top to bottom, and the waste liquid enters the waste liquid chamber 9. The sample liquid to be tested obtained by eluting the filter element 6 with the eluent flows from the flow chamber 8 next to the lower end 7 of the filter element 6 into the collection chamber 12 for detection. Among them, the filter element 6 binds the pesticide through the first nucleic acid aptamer 61, and the process of the pesticide being eluted is as follows Figure 5 shown.

[0127] The material of the filter element 6 includes any one or more of polyacrylonitrile, polystyrene plastic, polyvinylidene fluoride, polyvinyl chloride, and polypropylene. In this embodiment, the material of the filter element 6 is preferably polyvinylidene fluoride, which can more firmly bind to the first nucleic acid aptamer 61. When eluted with an eluent, the first nucleic acid aptamer 61 will not be eluted, so that the filter element 6 with the first nucleic acid aptamer 61 can be reused.

[0128] like Figure 2 and Figure 3 The filter mechanism 4 further includes a filter screen 13, a waste liquid bin 9 and a collection bin 12. The filter screen 13 is located above the filter element 6, and the waste liquid bin 9 and the collection bin 12 are located below the filter element 6. A valve 14 is provided between the waste liquid bin 9 and the collection bin 12, and the valve 14 controls whether the liquid flows into the waste liquid bin 9 or the collection bin 12. The filter screen 13 is fixed with plastic materials such as glue, silica gel, and resin, and the filter screen 13 is fixed between the filter port 23 and the filter element 6 to ensure that the liquid can only enter the filter element 6 through the filter screen 13, and has sealing performance.

[0129] Preferably, the filter screen 13 is made of a mesh material of 80-100 meshes, which can achieve the first filtration of the liquid containing residual pesticides and intercept larger impurities such as dust, insect eggs, and soil in the liquid.

[0130] The valve 14 is an L-shaped valve, which is used to control the flow direction of the liquid after filtration or elution. In the initial state (the stage in which the coarse sample liquid obtained by cleaning is filtered through the filter element 6), the valve 14 closes the entrance of the collection chamber 12, and the filtered liquid flows into the waste liquid chamber 9; in the startup state (the stage in which the eluent elutes the sample liquid to be tested from the filter element 6), the valve 14 closes the outlet of the waste liquid chamber 9, and the eluted liquid flows into the collection chamber 12. The waste liquid chamber 9 is used to collect the waste liquid after filtration, and is located below the filter element 6. After the process is completed, the waste liquid chamber 9 can be drawn out and the waste liquid can be poured out. The collection chamber 12 is used to collect the sample liquid to be tested containing pesticide residues after elution. It is located below the filter element 6 and is parallel to the waste liquid chamber 9. A detection port 16 is provided at the bottom of the collection chamber 12, and the sample liquid to be tested flows into the detection module 2 through the detection port 16 at the bottom.

[0131] Preferably, the cleaning solution provided in this embodiment comprises sodium lauryl sulfate, cocoyl diethanolamine and citric acid / citrate, wherein the mass concentration of sodium lauryl sulfate is 0.1-0.5%, the mass concentration of cocoyl diethanolamine is 0.1-0.5%, and the volume fraction of citric acid / citrate is 1-2%; the cleaning solution also comprises a surfactant and a builder.

[0132] Preferably, the cleaning solution used in this embodiment is: 0.2% sodium lauryl sulfate, 0.2% cocoyl diethanolamine, 1% sodium citrate, 0.3% remibond A, and 1% propylene glycol, prepared with ultrapure water.

[0133] Preferably, the eluent provided in this embodiment is a Tris buffer added with ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, ultrapure water, 0.85% NaCl, and 3% Tween 20. More preferably, the eluent used in this embodiment is a Tris buffer containing 0.5% ethylene glycol monomethyl ether, 0.1M sodium dihydrogen phosphate dihydrate, 0.85% NaCl, and 3% Tween 20 (3%), prepared with ultrapure water.

[0134] Preferably, the cleaning mechanism 3 includes a cleaning barrel 17, in which a cleaning liquid tank 18 is provided for loading and releasing cleaning liquid; the cleaning barrel 17 is a hard plastic barrel for storing and cleaning samples; the top is fitted with a sealing ring of a barrel cover 21; a rotating disc 19 is fixed at the bottom; the elution mechanism 5 is located on one side of the cleaning mechanism 3, and is connected to the filtering mechanism 4 through an elution liquid tank valve 26. The barrel cover 21 seals the cleaning barrel 17 and the cleaning liquid tank 18 to prevent liquid from splashing out, and a rubber ring and a buckle are fixed in the hard barrel cover 21 with good air tightness to ensure the integrity and airtightness of the sample to be tested and the liquid reagent during rotation. The cleaning liquid tank 18 is a hollow cylinder with a circle of circular small holes distributed on the top, and the bottom is a telescopic rod 22 with a silicone head that can fit closely. The upward pushing force of the telescopic rod 22 realizes the uniform spraying of the cleaning liquid from the small holes on the top until the telescopic rod 22 is fully straightened and the liquid is completely sprayed. The bottom of the cleaning barrel 17 is provided with a filter port 23, which opens to the outside of the rotating disc 19 and is distributed at equal distances. The filter port 23 includes a filter hole 24 and a one-way valve, and its function is to allow the liquid containing residual pesticides obtained in the cleaning barrel 17 to enter the filter mechanism 4. The one-way valve is installed in the filter hole 24, allowing the liquid to flow into the filter mechanism 4 in one direction, while prohibiting the liquid from splashing and leaving the filter mechanism 4. The filter holes 24 are located below the cleaning barrel 17, open to the outside of the rotating disc 19, and are distributed at equal distances.

[0135] The elution mechanism 5 includes an elution liquid tank 25 and an elution liquid tank valve 26; the eluent is located in the elution liquid tank 25, and the elution liquid tank 25 is made of opaque material and is used to store a quantitative amount of eluent to prevent the surfactant from being decomposed by light. At the same time, there is an elution liquid tank valve 26 below the elution liquid tank 25. The control module is used to control the flow of the eluent, complete the elution of the residual pesticide adsorbed on the filter element 6 of the filtering mechanism 4, and obtain the pesticide residue sample liquid.

[0136] The detection module 2 includes a detection chip 27, which includes a microchannel 37, an electrochemical detection component 28 and a test strip 36. The electrochemical detection component 28 includes a working electrode 29 and a probe 30. The probe 30 includes a second nucleic acid aptamer for capturing the target analyte.

[0137] like Figure 2 and Figure 6, the detection module 2 includes a detection port 16, a camera 32, a detection chip 27, and an electrochemical socket 33. The detection port 16 is closely connected to the collection bin 12 of the filter mechanism 4 and the detection chip 27 of the detection module 2, and the diameter size is consistent with the sample addition port 34 of the detection chip 27, so that the pesticide residue sample liquid is completely transferred to the detection chip 27 to complete the detection process. The camera 32 is used to scan the color changes of the detection line (T line) and the quality control line (C line) on the test strip 36 in the detection window 35, and transmit the chromaticity value back to the mobile terminal through Bluetooth or wireless network for data processing and result analysis, so as to complete the qualitative and semi-quantitative judgment of the pesticide residue sample liquid and realize preliminary detection. The chromaticity value detection threshold is set for five kinds of pesticides. If the chromaticity value of a certain pesticide in the pesticide residue sample liquid exceeds the detection threshold, the electrochemical quantitative detection of the pesticide is carried out for accurate analysis. The camera 32 is located below the motor and above the detection window 35 of the detection chip 27. The microchannel 37 is used to divert the sample liquid to be tested; the test strip 36 is a multiple detection test strip coated with antibodies of the target object to be tested.

[0138] The second nucleic acid aptamer used to prepare the probe 30 includes any one or more of a second nucleic acid aptamer of malathion, a second nucleic acid aptamer of ethyl carbamate, a second nucleic acid aptamer of acetamiprid, a second nucleic acid aptamer of clothianidin, and a second nucleic acid aptamer of thiamethoxam, and each has a nucleotide sequence as shown in Seq ID NO.6 to 10 in the sequence table. Among them, the second nucleic acid aptamer sequence of malathion is: GCG ATT CGT ACT ATG GTA TCC GAG AGG CCT ACG (Seq ID NO.6); the second nucleic acid aptamer sequence of ethyl formate is: GGG GGC ACG GGA GGT TGC ATC GAG CGG TGG (Seq ID NO.7); the second nucleic acid aptamer sequence of acetamiprid is: GAT CGC TGA CAC CAT ATT ATG AAG A (SeqID NO.8); the second nucleic acid aptamer sequence of clothianidin is: TGG CCG CCT CTG GGA CTC TCG TTC CCT GGA (SeqID NO.9); the second nucleic acid aptamer sequence of thiamethoxam is: TAG GGA ATT CGT CGA CGG ATC CAC CGA CCA TGCAAA GAT GCA CAA (Seq ID NO.10).

[0139] The detection chip 27 can detect the target object to be detected by two detection methods, one is qualitative detection through the test strip 36, and the other is quantitative detection through electrochemical detection. When the color value of a certain pesticide exceeds the threshold range during the qualitative detection process of the test strip 36, the electrochemical quantitative detection of the pesticide is performed to avoid blind detection. The test strip 36 and the electrochemical detection component 28 (each pesticide requires a corresponding electrochemical detection component 28) in the detection chip 27 can be easily taken out for replacement, saving detection costs.

[0140] The microchannel 37 is an F-shaped micron-scale groove used to divert the pesticide residue sample liquid. Its straight end is connected to the sample injection port 34, and the bifurcated ends are respectively connected to the corresponding test strip slots 39 and five electrochemical detection slots 40. The test strip slots 39 are grooves for placing test strips, which are connected to the microchannel. After the test is completed, the test strips can be replaced through the slots, so that a single detection chip 27 can be used multiple times. The test strip 36 is a multiple detection test strip that can be used to complete the preliminary detection of five pesticide residue sample liquids. Figure 8 , the test strip 36 is composed of a sample pad 41, a marking pad 42, a chromatography membrane 43, and an absorbent pad 44. The materials of the sample pad 41 and the marking pad 42 are mainly glass fiber materials, non-woven fabrics or filter paper; the absorbent pad 44 is filter paper. The chromatography membrane 43 is an NC nitrocellulose membrane pre-embedded with five detection lines (T lines) and one quality control line (C line), five artificial antigens of pesticides to be tested are used as detection lines 15, and goat anti-mouse secondary antibodies are used as quality control lines 20. The upper end of the chromatography membrane 43 is attached to the sample pad 41 and the marking pad 42, and the lower end is attached to the absorbent pad 44, and the various parts are connected to complete the connection. Malathion detection line 45, ethyl carbamate detection line 46, acetamiprid detection line 47, clothianidin detection line 48, and thiamethoxam detection line 49 are arranged on the test strip 36 in sequence. The five detection lines on the test strip 36 are arranged in a specific order. After the sample enters the test strip 36, they are arranged from front to back in order of malathion antigen, ethyl carbamate antigen, acetamiprid antigen, clothianidin antigen, and thiamethoxam antigen, which can significantly reduce the mutual interference between the five pesticides and improve the accuracy of detection.

[0141] like Figure 7 The detection chip 27 includes a chip top plate 50, a sample injection port 34, a microfluidic channel 37, a test strip slot 39, a test strip 36, an electrochemical detection slot 40, a screen-printed electrode 52 ( Figure 8) and the chip bottom plate 53. Among them, the chip top plate 50 includes a top plate 54 and a detection window 35. The top plate 54 is a hard transparent plastic plate, which is used to seal the detection chip 27 to prevent aerosol contamination. The detection window 35 is a transparent plastic sheet, the size of which is the area containing the T line and C line of the test strip 36, for camera scanning. The sample addition port 34 is the entrance for the pesticide residue sample liquid to be added to the detection chip 27, and its size fits the detection port 16 so that the liquid can completely flow into the detection chip 27 to complete the detection. The detection chip 27 controls the flow of the pesticide residue sample liquid through the electromagnetic valve 55. The microchannel 37 includes a microchannel 56 connected to the reagent strip and a microchannel 57 connected to the electrochemical detection tank. The microchannel 57 connected to the electrochemical detection tank includes five parallel microchannels, which are used to detect five kinds of pesticides respectively. The liquid is controlled to enter by the electromagnetic valve 55 to complete the quantitative detection of the pesticide residue sample liquid.

[0142] The screen-printed electrode 52 provides a portable, high-precision three-electrode system that can be plugged into an electrochemical socket 33 to perform quantitative detection of residual pesticides. The system consists of a working electrode 29, a counter electrode 59, a reference electrode 60, and a probe 30. Fig. 9 ). The working electrode 29 is a working electrode on which graphene with special electrical properties is coated by deposition, coating, etc., and the substrate material can be selected from glass fiber materials, non-woven fabrics or filter paper. By detecting the changes in the electrical properties of the working electrode 29, the non-quantifiable biological reaction is converted into a quantifiable electrical signal. The counter electrode 59 forms a loop with the working electrode 29 through the solution, providing a channel for electron transfer during the electrochemical detection process. The substrate material is the same as the working electrode 29. The reference electrode 60 is an Ag / AgCl reference electrode, which forms a loop with the working electrode 29 through the solution, provides calibration for the electrode potential, and improves the accuracy of electrochemical detection. The probe 30 is a second nucleic acid aptamer, which captures the pesticide to be tested on the surface of the working electrode 29, causing the electrical properties of the working electrode 29 to change. In some methods, a specific type of pesticide can be detected by selecting a suitable probe 30.

[0143] The electrochemical detection tank 40 includes a solenoid valve 55 and a groove 62, which are used to place the screen-printed electrode 52 to complete quantitative detection. The solenoid valve 55 controls the flow of the pesticide residue sample liquid. Five microchannels 57 connected to the electrochemical detection tank are controlled by the solenoid valve 55 to control the liquid to enter, and the quantitative detection of the pesticide residue sample liquid is completed. The chip base plate 53 includes a base plate 63 and an electrode interface 64. The base plate 63 is a PVC base plate that supports the chip, and each part is assembled on the base plate 63. The electrode interface 64 is located in the base plate area below the screen-printed electrode 52, and there are a total of 15 electrode interfaces (three electrode interfaces are required for the electrochemical detection component 28 for each pesticide detection), which is used for the connection of the electrochemical socket 33. The electrochemical socket 33 completes quantitative detection through the electrode interface 64.

[0144] The pesticide residue detection device 10 also includes a control module (not shown in the figure), which includes a power supply device 11, a motor device, a drive device, a control device, and a display device. The power supply device 11 is used for power supply, and a power plug with a ground wire is used when it is fixed, and a dry cell or storage battery is used when it is mobile. The motor device is used to provide rotational power, and the operation of the drive device is realized by a stepper motor. The drive device provides driving force for the sample processing module through a rotating disc 19 or a telescopic rod 22. The drive device controls the rotation direction, speed, and time of the cleaning barrel 17 through a rotating disc 19. The drive device controls the upward movement of the telescopic rod 22 to spray the cleaning reagent in the reagent loading bin. The control device controls the electric components or mechanical components in the cleaning mechanism 3, the filtering mechanism 4, the eluting mechanism 5, and the detection module 2 through a motor control device, a connecting rod, and a valve. The control device controls the magnitude and direction of the current to the motor through a motor control device, and then controls the drive device. The control device controls the flow state of the eluent or the pesticide residue sample liquid through a valve. The control device realizes linkage control of the elution liquid tank valve 26 of the elution mechanism 5 and the L-shaped valve 14 of the filtering mechanism 4 through the connecting rod, and the two are in an open state or a closed state at the same time. The display device 65 is used for the operator to issue instructions and obtain execution results, including cleaning procedures, elution procedures, qualitative detection procedures, and quantitative detection procedures. The working status of each part is indicated by the color of the indicator light, which indicates power on, standby, working, etc.

[0145] Embodiment 2, detection method

[0146] This embodiment uses the pesticide residue detection device provided in Example 1 to detect pesticide residues in agricultural products (such as green vegetable leaves), which specifically includes the following steps:

[0147] 1) Sample pretreatment

[0148] 1. Turn on the switch of the power supply device 11 to power on the device, and wait for the indicator light of the display device 65 to light up to indicate that the device has been turned on;

[0149] 2. Open the barrel cover 21, put 50g of green leaves to be tested into the cleaning barrel 17, add 20ml of cleaning liquid into the cleaning liquid tank 18, add 1.5ml of eluent into the eluent tank 25, and close the barrel cover 21;

[0150] 3. Start the "cleaning program" through the display device 65. The first stage, 3 minutes: the cleaning barrel 17 rotates clockwise at 300 r / min; the telescopic rod 22 in the cleaning liquid tank 18 moves upward at a constant speed until the telescopic rod 22 is straightened, and the loaded cleaning liquid is completely sprayed from the circular small hole above the cleaning liquid tank 18; the second stage, 3 minutes, the cleaning barrel 17 rotates clockwise at 600 r / min for 30 seconds and counterclockwise at 600 r / min for 30 seconds, alternately running to thoroughly clean the pesticides attached to the surface of the agricultural products to be tested;

[0151] 4. After the cleaning process is completed, the cleaning barrel 17 stops rotating. The cleaning liquid in the cleaning barrel 17 flows downward from the surface of the agricultural products and enters the filter mechanism 4 through the filter port 23 at the bottom of the cleaning barrel; the liquid first passes through the filter screen 13 for the first filtration to remove dust, soil, insect eggs and other impurities; it passes through the filter element 6 for the second filtration, and the pesticide specifically binds to the first nucleic acid aptamer 61 fixed on the filter element 6, and the remaining components flow into the waste liquid tank 9 with the liquid through the L-shaped valve 14. The two filtration times are 5-10 minutes;

[0152] 5. Start the "elution program" through the display device 65, close the entrance of the waste liquid tank 9 with the L-shaped valve 14, open the entrance of the collection tank 12, and the linkage of the connecting rod opens the valve 26 of the elution liquid tank at the same time. The eluent flows to the filter element 6 through the filter screen 13, and after eluting the pesticide attached to the filter element 6, it flows into the collection tank 12 through the flow tank 8. The elution process takes 3-5 minutes. At the end of the elution program, 1.5 ml of residual pesticide sample liquid to be tested is obtained.

[0153] 2) Sample testing

[0154] 1. Qualitative testing

[0155] 1) Place the multiple test strips 36 into the test strip slots 39 to complete the assembly of the test chip 27, fit the sample addition port 34 of the test chip 27 to the test port 16 at the bottom of the collection chamber 12, and fit the chip base plate 53 to the electrochemical socket 33;

[0156] 2) The 1.5 ml residual pesticide test sample solution obtained by the method described in Example 1 is stored in the collection chamber 12. The "qualitative test program" is started through the display device 65, the L-shaped valve 14 is opened, the pesticide residual sample solution flows into the detection chip 27, and flows evenly to the test strip slot 39 and the electrochemical slot 40 through the microchannel 37, and the multiple detection test strip 36 flows into 750 μl of the pesticide residual sample solution;

[0157] 3) The camera 32 is powered on and turned on, and the scanning function is controlled by the mobile terminal. The color development time of the test strip 36 is 3-5 minutes. The camera 32 can directly observe whether the T line and the C line have color changes to complete the qualitative test. The simultaneous appearance of the T line and the C line indicates that the pesticide residue sample liquid contains the pesticide to be tested; the appearance of only the C line indicates that the pesticide residue sample liquid does not contain the pesticide; the absence of the C line indicates that the test result of the test strip is invalid. After the T line and the C line appear in the test result, use the camera 32 to scan, and the scanned chromaticity value result is transmitted to the mobile terminal via Bluetooth or wireless network. The data is analyzed according to the chromaticity-concentration standard curve to complete the semi-quantitative detection.

[0158] 2. Quantitative detection

[0159] 1) After the qualitative detection is completed according to step 1, if the color value of a certain pesticide exceeds the threshold range, the electromagnetic valve 55 is controlled to flow into the corresponding microchannel and enter the electrochemical detection component 28 of the pesticide to perform electrochemical quantitative detection of the pesticide;

[0160] 2) Start the "quantitative detection program" through the display device 65, open the electromagnetic valve 55 corresponding to the pesticide, and 150 μl of residual pesticide detection liquid flows into the electrochemical detection tank 40 for electrochemical analysis to complete the quantitative detection of the pesticide residue sample liquid.

[0161] Example 3: Effects of different enrichment methods on detection results

[0162] Different enrichment methods will directly affect the extraction and detection effects of pesticide residues in agricultural products. In this embodiment, 50g of green vegetables were tested using the detection equipment provided in Example 1, and the filter element was treated in the following three ways: 1. The untreated filter element was directly used; 2. The filter element was fixed with five pesticide antibodies (10cm 2 The surface of the filter element is uniformly coated with 0.5% to 2% glutaraldehyde, first coated on a thin layer plate and left for 2 hours, and then coated with 1mL of a solution with a total antibody concentration of 0.5mol / L to complete the glutaraldehyde cross-linking fixation. The concentration of each antibody in the antibody solution is 0.1mol / L). 3. The first nucleic acid aptamer (10cm 2 The filter surface is uniformly coated with 1 ml of nucleic acid aptamer solution, and the concentration of each nucleic acid aptamer in the nucleic acid aptamer solution is 20 μmol / L) of a thin layer plate. Then, the test strips and electrochemical detection components of the detection module are respectively tested. The detection method is as in Example 2, and the detection results are shown in Table 1.

[0163] 3) Table 1. Effects of different enrichment methods on detection results

[0164]

[0165] 4) According to Table 1, compared with Groups 1 to 3, immobilizing the antibody of the target analyte or the first nucleic acid aptamer of the target analyte on the filter element can significantly improve the effect of extracting the target analyte from the sample compared with the untreated filter element.

[0166] 5) At the same time, it can be seen from the comparison between the second and third methods that compared with the method of fixing antibodies on the filter element, the method of fixing nucleic acid aptamers on the filter element has a better extraction effect. The reason may be that nucleic acid aptamers are smaller in size, and after being fixed on the filter element, they can form neatly arranged nucleic acid aptamer tentacles to capture the target analyte; while antibody protein molecules are larger and more disorderly after fixation. Because when antibodies are fixed on the surface of the filter element in a random arrangement, different antibodies will have different orientations after cross-linking and fixation. When the effective binding sites on the antibody surface face downward, the capture efficiency of the filter element is reduced. The fixation of nucleic acid aptamers is physically repaired by arranging fixed bases at one end to ensure its fixed direction, so that it has better binding efficiency with the target, and the capture effect is significantly better than that of antibodies.

[0167] Example 4: Effects of different cleaning solutions on test results

[0168] Different cleaning solutions will directly affect the cleaning and elution effects of residual pesticides in agricultural products. In this embodiment, 50g of green vegetable leaves are used, and the pesticide residue detection device provided in Example 1 is used for non-destructive cleaning and detection. The cleaning solutions are respectively 9 cleaning solutions in Table 2 for cleaning, and then the detection is performed respectively by the test strips and electrochemical detection components of the detection module, and the detection results are compared with those of the leaves cut into particles with a particle size of 1mm (the 10th kind). The detection method is the same as in Example 2, and the detection results are shown in Table 2.

[0169] Table 2. Effects of different cleaning solutions on test results

[0170]

[0171]

[0172] According to Table 2, compared with Groups 1 to 6, the cleaning solution prepared by using a combination of sodium lauryl sulfate, cocoyl diethanolamine, and citric acid / citrate is as effective as 20% methanol in eluting residual pesticides from agricultural products, among which 0.2% sodium lauryl sulfate+0.2% cocoyl diethanolamine+1% sodium citrate (Group 2) is even more effective than methanol.

[0173] By comparing groups 2, 7, 8 and 9, it can be seen that when surfactants and builders are added to the cleaning solution, the concentration of pesticides extracted from the sample solution to be tested can be further increased.

[0174] Comparing Group 9 and Group 10, when the cleaning solution provided by the present invention is used for cleaning, no matter whether the agricultural products are cut into particles or directly cleaned without damage, there is no obvious difference in the test results.

[0175] It can be seen that the most preferred cleaning solution is Group 9, which can significantly improve the elution rate of pesticides in agricultural products.

[0176] Example 5: Sequence improvement of the first nucleic acid aptamer fixed on the filter element

[0177] 1. Add a specific sequence

[0178] In order to make the first nucleic acid aptamer more firmly fixed on the filter element (the filter element material is polyvinylidene fluoride), a specific sequence is added to the 5' end of the nucleic acid aptamer to improve the fixing effect of the first nucleic acid aptamer, and at the same time, it is necessary to ensure that its adsorption of the target pesticide will not be affected. The first nucleic acid aptamer sequences used are shown in Table 2. Since the change trends of nucleic acid aptamers of different pesticides are consistent, the first nucleic acid aptamer sequence of malathion is used in this embodiment for research, and it is fixed on the filter element as described in Example 1. The sample used contains a malathion solution with a concentration of 30.12 (ng / mL), and the sample is filtered, eluted and detected by the method provided in Example 2. After elution, the sample is filtered, eluted and detected again, and the electrochemical detection results are converted into specific concentrations by preparing a standard curve. The detection results of the filter element being reused twice are examined, and the results are shown in Table 3.

[0179] Table 3. First nucleic acid aptamer adds specific sequence

[0180]

[0181] It can be seen from Table 3 that when there is no additional sequence at the 5' end of the first nucleic acid aptamer, its fixation effect is poor, resulting in poor adsorption and extraction efficiency. Moreover, when the filter element is reused for the second time, malathion is not detected because the first nucleic acid aptamer has been completely eluted.

[0182] The most preferred method is to add a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence to the 5' end of the first nucleic acid aptamer, which has the highest detection accuracy and the filter element can be reused. Compared with adding a (TTTTTTTTTT)-sequence, a (TTTTTTTTTT)-(CCCCCCCC)-sequence or a (TTTTTTTTTT)-(GGGGGGGGGGGGGGGGG)-sequence to the 5' end of the first nucleic acid aptamer, adding a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence can improve the adsorption and extraction effect of malathion, thereby improving the detection accuracy.

[0183] 2. Optimization of the first aptamer sequence

[0184] In this embodiment, the first nucleic acid aptamer sequences of five pesticides are optimized respectively so that they can improve the specific adsorption and extraction effect of the target pesticides. The first nucleic acid aptamer sequences of the five pesticides before and after optimization are shown in Tables 3 and 4, respectively, and they are fixed on the filter element as described in Example 1, and the sample used contains 30 (ng / mL) of malathion, 30 (ng / mL) of ethyl carbamate, 40 (ng / mL) of acetamiprid, 40 (ng / mL) of clothianidin, and 40 (ng / mL) of thiamethoxam at the same time. Two filter element materials, polyvinylidene fluoride and polyvinyl chloride, are used respectively, and the sample is filtered, eluted and detected by the method provided in Example 2, and after elution, the sample is filtered, eluted and detected again, and the electrochemical detection results are converted into specific concentrations by preparing a standard curve, and the detection results of the filter element are examined after being reused twice, and the results are shown in Tables 4 and 5.

[0185] Table 4. Optimization of the first nucleic acid aptamer sequence (filter material is polyvinylidene fluoride)

[0186]

[0187] Table 5. Optimization of the first nucleic acid aptamer sequence (filter material is polyvinyl chloride)

[0188]

[0189] According to Table 4, the first nucleic acid aptamer sequences of five pesticides were optimized in this example. The optimized first nucleic acid aptamer can improve the specific adsorption and extraction effects of the target pesticides and significantly improve the accuracy of the detection results.

[0190] By comparing Table 4 and Table 5, it can be seen that the optimized first nucleic acid aptamer is more suitable for combination with the filter element material of polyvinylidene fluoride, the accuracy of detecting the target pesticide is higher, and the accuracy of the filter element will not decrease when it is reused.

[0191] Example 6: Effects of different eluents on test results

[0192] Different eluents will also directly affect the elution effect of residual pesticides in the filter element, and will also affect the reuse effect of the filter element. In this embodiment, 50g of green vegetable leaves are used, and the pesticide residue detection device provided in Example 1 is used for non-destructive cleaning detection. The eluents are eluted using the five eluents in Table 6, and then the test strips and electrochemical detection layer of the detection module are used for detection. The detection method is the same as in Example 2, and the electrochemical detection results are converted into specific concentration contents by preparing a standard curve. The detection results are shown in Table 6.

[0193] Table 6. Effects of different eluents on test results

[0194]

[0195] According to Table 6, the elution effects of different eluents are significantly different. The most preferred is the eluent of Group 3, which has the highest elution efficiency for residual pesticides in the filter element, and the filter element can be reused after elution. It can be seen that it can elute the pesticides from the first nucleic acid aptamer without destroying the chemical bond between the first nucleic acid aptamer and the filter element.

[0196] Example 7: Effect of the order of test lines in a multiplex test strip on qualitative test results

[0197] In this example, the multiple detection test strips provided in Example 1 were used to perform qualitative detection on a sample containing five pesticides, wherein the sample simultaneously contained 30 (ng / mL) malathion, 30 (ng / mL) ethyl carbamate, 40 (ng / mL) acetamiprid, 40 (ng / mL) clothianidin, and 40 (ng / mL) thiamethoxam. The order of the detection lines in the multiple detection test strips is shown in Table 7, and the detection results when different orders are used in the multiple detection test strips are examined.

[0198] Table 7. Impact of test line sorting on test results

[0199]

[0200]

[0201] According to Table 7, malathion is most susceptible to the impact of the other four pesticides. The malathion test line must be ranked first. If it is ranked backward, the test results of the test strip will directly change from positive to weak positive. At the same time, if the ethyl carbamate test line is ranked last, it is also easy to have a weak positive phenomenon. Therefore, the order of the test lines in the multiple detection test strips must be malathion test line, ethyl carbamate test line, acetamiprid test line, clothianidin test line, and thiamethoxam test line.

[0202] Example 8: Optimization of the second nucleic acid aptamer sequence in electrochemical detection

[0203] In this embodiment, the second nucleic acid aptamer sequences of five pesticides are optimized respectively, so that it can improve the detection accuracy and sensitivity of the target pesticides. The second nucleic acid aptamer sequences of the five pesticides before and after optimization are shown in Table 8, respectively, and they are fixed on the filter element as described in Example 1, and the sample used contains 30 (ng / mL) of malathion, 30 (ng / mL) of ethyl carbamate, 40 (ng / mL) of acetamiprid, 40 (ng / mL) of clothianidin, and 40 (ng / mL) of thiamethoxam at the same time. The electrochemical detection component provided in Example 1 is used for sample detection, and the electrochemical detection results are converted into specific concentrations by preparing a standard curve, and the electrochemical detection results are converted into specific concentrations by preparing a standard curve. The results are shown in Table 8.

[0204] Table 8. Optimization of the second nucleic acid aptamer sequence (filter material is polyvinylidene fluoride)

[0205]

[0206] It can be seen from Table 8 that, compared with the second nucleic acid aptamer before optimization, the optimized second nucleic acid aptamer can improve the detection accuracy of the target pesticide.

[0207] The technical features of the above-described embodiments can be combined arbitrarily. In order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. Although the present invention is disclosed as above, the present invention is not limited thereto. For example, it can be expanded according to its scope of application in the field of microfluidics. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope defined by the claims.

[0208] Sequence Listing

[0209] Seq ID NO.1

[0210] The first nucleic acid aptamer sequence of malathion: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-CGA TTCGTA CTA TGG TAT CCG AGA GGC CTA CGG-3'

[0211] Seq ID NO.2

[0212] The first nucleic acid aptamer sequence of ethyl carbamate: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-TGGGGG CAT GGG AGG TTG CCT AGA GCG GTG-3'

[0213] Seq ID NO.3

[0214] The first nucleic acid aptamer sequence of acetamiprid: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-TGA TCGCTG ACA CCA TAT TAT GAA GA-3'

[0215] Seq ID NO.4

[0216] The first nucleic acid aptamer sequence of clothianidin: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GCC GCCTCT GGG ACT CTC GTT CCC TG-3'

[0217] Seq ID NO.5

[0218] The first nucleic acid aptamer sequence of thiamethoxam: 5'-(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GAA TTCGTC GAC GGA TCC ACC GAC CAT GCA AAG ATG CAC AA-3'

[0219] Seq ID NO.6

[0220] The second nucleic acid aptamer sequence of malathion: GCG ATT CGT ACT ATG GTA TCC GAG AGG CCTACG; Seq ID NO.7

[0221] The second nucleic acid aptamer sequence of ethyl carbamate: GGG GGC ACG GGA GGT TGC ATC GAG CGGTGG Seq ID NO.8

[0222] The second nucleic acid aptamer sequence of acetamiprid: GAT CGC TGA CAC CAT ATT ATG AAG ASeq ID NO.9

[0223] The second nucleic acid aptamer sequence of clothianidin: TGG CCG CCT CTG GGA CTC TCG TTC CCT GGA SeqID NO.10

[0224] The second nucleic acid aptamer sequence of thiamethoxam: TAG GGA ATT CGT CGA CGG ATC CAC CGA CCA TGCAAA GAT GCA CAA Seq ID NO.11

[0225] Malathion aptamer sequence before optimization:

[0226] TGTACCGTCTGAGCGATTCGTACTATGGTATCCGAGAGGCCTACGGAATTGTTGTACAGCCAGTCA

[0227] GTGTTAAGGAGTGC Seq ID NO.12

[0228] The aptamer sequence of urethane before optimization:

[0229] GGGGGCACGGGAGGTTGCATCGAGCGGTGG Seq ID NO.13

[0230] The aptamer sequence of acetamiprid before optimization:

[0231] TGT AAT TTG TCT GCA GCG GTT CTT GAT CGC TGA CAC CAT ATT ATG AAG ASeqID NO.14

[0232] The nucleic acid aptamer sequence of clothianidin before optimization:

[0233] GGCCGCCTCTGGGACTCTCGTTCCCTGGAG Seq ID NO.15

[0234] The aptamer sequence of thiamethoxam before optimization:

[0235] TCGTCGACGGATCCACCGACATGCAAAGATGCACAAAAACGACAGTAGGGAATTCG

[0236] TCGACGGATCCACCGACCATGCAAAGATGCACAAAAACGACAGCAGCTGCAGGTCG

[0237] ACGCATGCGCCGG.

Claims

1. A pesticide residue detection device, characterized in that: It comprises a pre-treatment module and a detection module, wherein the pre-treatment module is provided with a filtering mechanism, wherein a first nucleic acid aptamer for adsorbing the target analyte is fixed in the filtering mechanism, and is used for pre-treating the sample and enriching the target analyte to obtain a sample liquid to be tested; The detection module is used to detect the target analyte in the sample liquid.

2. The detection device according to claim 1, characterized in that The filtering mechanism comprises a filter element, in which the first nucleic acid aptamer is fixed; the filter element is placed at an angle of 5 to 15 degrees to the horizontal plane, and a flow chamber is provided at the lower end.

3. The detection device according to claim 2, characterized in that: The filtering mechanism also includes a filter screen, a waste liquid bin and a collection bin. The filter screen is located above the filter element, and the waste liquid bin and the collection bin are located below the filter element. A valve is provided between the waste liquid bin and the collection bin to control whether the liquid flows into the waste liquid bin or the collection bin.

4. The detection device according to claim 3, characterized in that: The pre-treatment module also includes a cleaning mechanism and an elution mechanism; the cleaning mechanism uses a cleaning liquid to clean the sample to obtain a coarse sample liquid, which enters the filtering mechanism; the cleaning mechanism includes a cleaning barrel, and a cleaning liquid tank is provided in the cleaning barrel for loading and releasing the cleaning liquid; a rotating disc is provided under the cleaning barrel; The elution mechanism releases the eluent to elute the sample to be tested from the filter element to obtain the sample liquid to be tested; the elution mechanism is located on one side of the cleaning mechanism and is connected to the filtering mechanism through a valve.

5. The detection device according to claim 4, characterized in that: The detection module includes a detection chip, which includes electrochemical detection components. The number of the electrochemical detection components is one or more groups, and each group of electrochemical detection components is used to detect a target analyte; each group of electrochemical detection components includes a working electrode and a probe, and the probe includes a second nucleic acid aptamer that captures the target analyte.

6. The detection device according to claim 5, characterized in that: The detection chip also includes a microfluidic channel and a test strip. The microfluidic channel is used to divert the sample liquid to be tested; the test strip is a multiple detection test strip, which is coated with antibodies of the target object to be tested.

7. The detection device according to claim 6, characterized in that: The target analyte includes any one or more of malathion, ethyl carbamate, acetamiprid, clothianidin, and thiamethoxam; the first nucleic acid aptamer has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-sequence at the 5' end.

8. The detection device according to claim 7, characterized in that: The first nucleic acid aptamer includes a first nucleic acid aptamer of malathion, a first nucleic acid aptamer of ethyl carbamate, a first nucleic acid aptamer of acetamiprid, a first nucleic acid aptamer of clothianidin and a first nucleic acid aptamer of thiamethoxam, and each of them has a nucleotide sequence as shown in Seq ID NO.1 to 5 in the sequence table; The second nucleic acid aptamer includes any one of a second nucleic acid aptamer of malathion, a second nucleic acid aptamer of ethyl carbamate, a second nucleic acid aptamer of acetamiprid, a second nucleic acid aptamer of clothianidin, and a second nucleic acid aptamer of thiamethoxam, and each has a nucleotide sequence as shown in Seq ID NO.6 to 10 in the sequence table.

9. The detection device according to claim 8, characterized in that: The material of the filter element includes any one or more of polyacrylonitrile, polystyrene plastic, polyvinylidene fluoride, polyvinyl chloride, and polypropylene; the cleaning solution includes sodium dodecyl sulfate, cocoyl diethanolamine, and citric acid / citrate; the eluent includes ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl, and Tris buffer containing Tween 20; and the multiple detection test strips are provided with detection lines of malathion, ethyl carbamate, acetamiprid, clothianidin, and thiamethoxam in sequence.

10. A method for detecting pesticide residues in agricultural products, characterized in that: The detection device according to any one of claims 1 to 9 is used for detection, comprising the following steps: (1) placing the product into a cleaning bucket of a detection device, spraying cleaning liquid for cleaning, and obtaining a crude sample solution; (2) The crude sample liquid flows into the filtration mechanism and is adsorbed by the filter element; (3) the elution mechanism sprays the elution liquid to elute the object to be tested from the filter element to obtain the sample liquid to be tested; (4) The sample liquid to be tested flows into the detection module for detection.

Images