Adjuvant composition and application thereof in preparation of antiviral vaccine

Abstract

The invention relates to an adjuvant composition and application thereof in preparation of an antiviral vaccine, and provides a novel adjuvant composition which can induce an organism to generate a remarkable high-titer specific IgG antibody and enhance humoral immunity, and particularly has a good application prospect for development of the antiviral vaccine.

Description

Technical Field

[0001] The present application relates to the field of biomedicine, and in particular, to an adjuvant composition and its application in the preparation of antiviral vaccines. Background Art

[0002] Adjuvants are non-specific immunomodulators, which refer to auxiliary substances that can enhance the body's immune response to antigens or change the type of immune response when injected into the body together with antigens or in advance. Adjuvants can be immunogenic or non-immunogenic. There are many types of adjuvants, and there is no unified classification method. The immunobiological effects of adjuvants are to enhance immunogenicity, increase the titer of antibodies, change the type of antibodies produced, and cause or enhance delayed hypersensitivity reactions, but the mechanism of action of adjuvants is not yet fully understood, and the mechanisms of action of different adjuvants are also different.

[0003] Aluminum adjuvants have been used as immune adjuvants for a long time, and their safety and immune enhancement effects have long been proven. However, aluminum adjuvants lack or have only a weak adjuvant effect on some candidate vaccine antigens. Although they can enhance humoral immune responses, they have no strengthening effect on cellular immunity, and have no obvious effect of enhancing immune responses in many human vaccines. Therefore, with the emergence of more and more candidate vaccines, the demand for new adjuvants that can be used clinically is growing rapidly.

[0004] Therefore, it is necessary to develop a new adjuvant combination for the development of antiviral vaccines to enhance the immune response effect of the vaccine. Summary of the invention

[0005] In a first aspect of the present invention, an adjuvant composition is provided, wherein the adjuvant composition comprises 1) an aluminum agent, and 2) a STING agonist.

[0006] Preferably, the aluminum agent includes but is not limited to aluminum hydroxide, aluminum phosphate or alum.

[0007] Preferably, the STING agonist includes but is not limited to 2'3'-cGAMP, 3'3'-cGAMP, c-di-AMP, c-di-GMP, cAIMP or sting-22.

[0008] In one embodiment, the adjuvant composition comprises aluminum and sting-22.

[0009] Preferably, the ratio of the STING agonist to the aluminum agent is (1-5): (1-50), for example (1, 2, 3, 4, 5):

[0010] (1, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50).

[0011] The above ratios are mass ratios.

[0012] The second aspect of the present invention provides a use of the above-mentioned adjuvant composition in the preparation of an antiviral vaccine.

[0013] Preferably, the antiviral vaccine comprises viral antigenic proteins and an adjuvant composition.

[0014] Preferably, the virus includes but is not limited to hepatitis B virus, herpes simplex virus, human papillomavirus, Epstein-Barr virus, cytomegalovirus, smallpox virus, varicella-zoster virus (VZV), 2019 novel coronavirus (SARS-CoV-2), HIV, coxsackievirus, poliovirus, rhinovirus, foot-and-mouth disease virus, yellow fever virus, dengue virus, epidemic encephalitis B virus, Lassa fever virus, rabies virus, Hantavirus, Ebola virus, Marburg virus, influenza virus, parainfluenza virus, measles virus, rubella virus, mumps virus, respiratory syncytial virus, hepatitis virus, rotavirus or MERS virus.

[0015] Preferably, the SARS-CoV-2 includes any original strain and / or mutant strain, such as XBB, BQ.1.1, XBB1.16, SARS, EG.5, BA.5, BA.2.86, etc.

[0016] Preferably, the influenza virus includes subtypes such as type A and / or type B, such as H1N1, H3N2, B / Yamagata and / or B / Victoria, etc.

[0017] Preferably, the antigen protein described in 1) can form a fusion protein.

[0018] Preferably, the fusion protein may include one or more antigenic proteins, and more preferably, the multiple antigenic proteins may be the same or different antigenic proteins.

[0019] Preferably, the antigen protein includes but is not limited to shell protein, glycoprotein, lipoprotein, glycoprotein receptor binding region, etc. Further preferably, the antigen protein at least includes glycoprotein or glycoprotein receptor binding region.

[0020] Preferably, the fusion protein further comprises an Fc fragment (Fc).

[0021] Preferably, the fusion protein also includes a self-assembled oligomeric protein. Further preferably, the oligomeric protein includes but is not limited to Helicobacter pylori ferritin, dihydrotetrahydropterin synthase, C4b binding protein or dihydrosulfide acetyltransferase.

[0022] More preferably, the fusion protein includes a fusion protein formed by RBD proteins derived from the same / different mutant strains of SARS-CoV-2, such as XBB, BQ.1.1, XBB1.16, SARS, EG.5, BA.5, BA.2.86, etc.

[0023] Preferably, the antigen protein in 2) is from a virus lysate, such as an influenza virus lysate. Or,

[0024] Preferably, the antigen protein in 3) is derived from a purified antigen protein of a virus, such as the gE protein of VZV.

[0025] In a specific embodiment, the fusion protein comprises the amino acid sequence shown in any one of SEQ ID No: 1 or 3.

[0026] Preferably, the ratio of the antigen protein to the adjuvant is (1-5):(1-60), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5, 8, 10, 20, 21, 22, 25, 30, 40, 50, 60).

[0027] Preferably, the ratio of the antigen protein to the aluminum agent is (1-5):(1-50), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5, 8, 10, 20, 21, 22, 25, 30, 40, 50).

[0028] Preferably, the ratio of the antigen protein to the STING agonist is (1-5):(1-5), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5).

[0029] The above ratios are mass ratios.

[0030] Preferably, the antiviral vaccine further comprises one or more pharmaceutically acceptable carriers.

[0031] The pharmaceutically acceptable carrier may be a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, an adsorption carrier, a surfactant or a lubricant but is not limited thereto.

[0032] The third aspect of the present invention provides a vaccine composition, which includes the above-mentioned viral antigen protein and the above-mentioned adjuvant composition.

[0033] Preferably, the virus includes but is not limited to hepatitis B virus, herpes simplex virus, human papillomavirus, Epstein-Barr virus, cytomegalovirus, smallpox virus, varicella-zoster virus (VZV), 2019 novel coronavirus (SARS-CoV-2), HIV, coxsackievirus, poliovirus, rhinovirus, foot-and-mouth disease virus, yellow fever virus, dengue virus, epidemic encephalitis B virus, Lassa fever virus, rabies virus, Hantavirus, Ebola virus, Marburg virus, influenza virus, parainfluenza virus, measles virus, rubella virus, mumps virus, respiratory syncytial virus, hepatitis virus, rotavirus or MERS virus.

[0034] Preferably, the SARS-CoV-2 includes any original strain and / or mutant strain, such as XBB, BQ.1.1, XBB1.16, SARS, EG.5, BA.5, BA.2.86, etc.

[0035] Preferably, the influenza virus includes subtypes such as type A and / or type B, such as H1N1, H3N2, B / Yamagata and / or B / Victoria, etc.

[0036] Preferably, the antigen protein described in 1) can form a fusion protein.

[0037] Preferably, the fusion protein may include one or more antigenic proteins, and more preferably, the multiple antigenic proteins may be the same or different antigenic proteins.

[0038] Preferably, the antigen protein includes but is not limited to shell protein, glycoprotein, lipoprotein, glycoprotein receptor binding region, etc. Further preferably, the antigen protein at least includes glycoprotein or glycoprotein receptor binding region.

[0039] Preferably, the fusion protein further comprises an Fc fragment (Fc).

[0040] Preferably, the fusion protein also includes a self-assembled oligomeric protein. Further preferably, the oligomeric protein includes but is not limited to Helicobacter pylori ferritin, dihydrotetrahydropterin synthase, C4b binding protein or dihydrosulfide acetyltransferase.

[0041] More preferably, the fusion protein includes a fusion protein formed by RBD proteins derived from the same / different mutant strains of SARS-CoV-2, such as XBB, BQ.1.1, XBB1.16, SARS, EG.5, BA.5, BA.2.86, etc.

[0042] Preferably, the antigen protein in 2) is from a virus lysate, such as an influenza virus lysate. Or,

[0043] Preferably, the antigen protein in 3) is derived from a purified antigen protein of a virus, such as the gE protein of VZV.

[0044] Preferably, the fusion protein comprises the amino acid sequence shown in any one of SEQ ID No: 1 or 3.

[0045] Preferably, the ratio of the antigen protein to the adjuvant is (1-5):(1-60), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5, 8, 10, 20, 21, 22, 25, 30, 40, 50, 60).

[0046] Preferably, the ratio of the antigen protein to the aluminum agent is (1-5):(1-50), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5, 8, 10, 20, 21, 22, 25, 30, 40, 50).

[0047] Preferably, the ratio of the antigen protein to the STING agonist is (1-5):(1-5), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5).

[0048] The above ratios are mass ratios.

[0049] Preferably, the vaccine composition further comprises one or more pharmaceutically acceptable carriers.

[0050] The pharmaceutically acceptable carrier may be a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, an adsorption carrier, a surfactant or a lubricant but is not limited thereto.

[0051] The fourth aspect of the present invention provides a method for preparing the above vaccine composition, the preparation method comprising the following steps:

[0052] The above-mentioned viral antigen protein and the above-mentioned adjuvant composition are mixed to obtain an antiviral vaccine composition.

[0053] Preferably, the ratio of the antigen protein to the adjuvant is (1-5):(1-60), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5, 8, 10, 20, 21, 22, 25, 30, 40, 50, 60).

[0054] Preferably, the ratio of the antigen protein to the aluminum agent is (1-5):(1-50), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5, 8, 10, 20, 21, 22, 25, 30, 40, 50).

[0055] Preferably, the ratio of the antigen protein to the STING agonist is (1-5):(1-5), for example (1, 2, 3, 4, 5):(1, 2, 3, 4, 5).

[0056] The above ratios are mass ratios.

[0057] The technical effects of the present invention are:

[0058] The present invention provides a new adjuvant combination, wherein both the Al and STING agonist adjuvant combinations can induce the body to produce significant high-titer specific IgG antibodies and enhance humoral immunity; the vaccine composition prepared after adding the adjuvant combination can produce high immunogenicity against different viruses and their variants; and the combined adjuvant system can show obvious synergistic effects.

[0059] The above merely summarizes some aspects of the present invention and is not and should not be considered to limit the present invention in any aspect.

[0060] All patents and publications mentioned in this specification are incorporated herein by reference as a whole. Those skilled in the art will recognize that certain changes may be made to the present invention without departing from the concept or scope of the present invention. The following examples further illustrate the present invention in detail and should not be considered to limit the scope of the present invention or the specific methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0062] Figure 1 : Vaccination protocol for mice.

[0063] Figure 2 : Specific IgG antibody titers in the serum of mice on the 35th day after vaccination, * represents P < 0.05, **** represents P < 0.001.

[0064] Figure 3 : Pseudovirus experiment results of AL+STING adjuvant combination and AL+CpG adjuvant combination, * represents P<0.05, ** represents P<0.01, *** represents P<0.001, ns represents non-significant difference. DETAILED DESCRIPTION

[0065] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0066] Example 1 Screening of SARS-CoV-2 vaccine adjuvants and immunogenicity studies

[0067] 1. Preparation of fusion protein

[0068] The present invention adopts the RBD of SARS-CoV-2, and connects the epidemic strain XBB, BQ.1.1, the original RBD site mutation (8m18m2) in series with the Fc fragment of IgG1 to form a dimer or fuses with the Helicobacter pylori ferritin sequence to express and self-assemble into 24-hedron nanoparticles. After adding the signal peptide sequence to this amino acid sequence, Nanjing GenScript Biotechnology Co., Ltd. is entrusted to optimize the synthesis. The synthesized gene includes a restriction site, a Kozak sequence, a signal peptide, a target gene, and a stop codon. The codon optimization was performed during the synthesis of the recombinant gene to facilitate expression in Chinese hamster ovary cells Cricetulus griseus (CHO cells). For details, please refer to the patent application with application number 202311684180.5, which is a part of the present application and is cited as a whole to the present application. The universal SARS-CoV-2 vaccine dimer amino acid sequence (XBBBQ.1.18m18m2-Fc) is shown in SEQ ID No: 1, and the nucleotide sequence encoding the above dimer amino acid is shown in SEQ ID No: 2. The amino acid sequence of the universal SARS-CoV-2 nanoparticle (XBBBQ.1.18m18m2-NP) is shown in SEQ ID No: 3. The nucleic acid sequence encoding the universal SARS-CoV-2 nanoparticle of SEQ ID No: 3 is shown in SEQ ID No: 4.

[0069] 2. Screening of relevant adjuvants and immunogenicity studies

[0070] In this example, the SARS-CoV-2RBD-Fc fusion protein prepared in 1 was used as an immunogen (SEQ ID No: 1), diluted with 20 mM histidine hydrochloride, 140 mM arginine hydrochloride, and 0.02% polysorbate 80 pH 6.0, and mixed evenly with each adjuvant at room temperature to prepare each adjuvant vaccine solution, which was then placed at 2-8°C.

[0071] Specific adjuvants used include:

[0072] 1. Sting-22 was purchased from MCE, Germany, 1 mg / 1 ml, Cat No. HY-152955;

[0073] 2. Simvastatin was purchased from Sigma, USA, batch number: 79902-63-9, 1 mg / vial;

[0074] 3. Aluminum hydroxide adjuvant was purchased from Changchun Institute of Biological Products Co., Ltd. 21 mg / ml batch number: 2P18-003-202106;

[0075] 4. CpG1018 was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., batch number: GA0220301A;

[0076] 5. Manganese adjuvant was prepared by itself from hydrated powder purchased from Sinopharm Chemical Reagent Co., Ltd.

[0077] The above vaccine solution at 2-8°C is aseptically dispensed into 2 ml vials (or pre-filled glass syringes), 0.5 ml (or 1.0 ml) per vial, and stored at 2-8°C away from light after sealing.

[0078] The above vaccine solution was taken out, and immunogenicity study was carried out using C57BL / 6 mice (purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.) as animal model.

[0079] The specific method is as follows: the C57BL / 6 female mice in this example were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd. 6-8 week old C57BL / 6 mice were randomly divided into groups, 5 mice in each group, and the above vaccine composition was injected intramuscularly, and different groups were set up: PBS control group, each adjuvant vaccine group (protein and adjuvant prepared in Example 1) and adjuvant group. The specific grouping refers to the immunization scheme of the specific experiment. Immunization was performed at 0 and 3 weeks, blood was collected at 3 and 5 weeks, and spleen was taken at 5 weeks. The vaccination protocol of mice is as follows Figure 1 As shown. The ELISA method was used to detect the antibody titer (ie, total IgG) against SARS-CoV-2 RBD-Fc protein in the serum.

[0080] ELISA method:

[0081] 1. Reagent Preparation

[0082] 1.1 Preparation of ELISA coating solution (1X): Take ELISA coating solution (10X) (purchased from Solebol, product number: C1055) and dilute it to 1X with sterile distilled water.

[0083] 1.2. PBS preparation: Take out PBS powder and dissolve each bag with 2L of sterile distilled water.

[0084] 1.3. Washing solution: PBST (PBS containing 0.05% Tween-20)

[0085] Measure 1L of filtered PBS into a blue-capped bottle, add 500μL Tween-20, mix thoroughly, and store at 2-8°C for later use. Prepare the required volume of PBST according to the actual situation.

[0086] Note: PBST should be prepared fresh and used on the same day.

[0087] 1.4. Blocking solution and sample diluent (PBS containing 5% skim milk powder)

[0088] Weigh 5% of the volume of PBS with skim milk powder (milk powder mass / g = PBS volume / mL x 5%), equilibrate the PBS taken out from 2-8°C to room temperature, measure the required volume of PBS solution into the centrifuge tube to which the milk powder has been added, and then fully dissolve it for use.

[0089] Note: The blocking solution and sample diluent should be prepared freshly and used on the same day.

[0090] 1.5. Dilute goat anti-mouse secondary antibody

[0091] Equilibrate 1 mL of secondary antibody (purchased from CST, catalog number 7076s) to room temperature, then aliquot and store at -20°C ± 5°C. Take out before each use and dilute at 1:4000, where the diluent is PBS.

[0092] Note: The diluted secondary antibody should be used on the same day.

[0093] 1.6. Stop solution (purchased from Solebro, product number C1058)

[0094] 2.ELISA to detect serum binding antibody titer:

[0095] 2.1 Coating: Take the SARS-CoV-2RBD-Fc antigen stock solution (prepared by Beijing Geneway Products Co., Ltd., with a concentration of 2 mg / ml) and dilute it to 1000 ng / mL with ELISA coating solution (1X), coat the ELISA plate, 100 μl / well, and place it at 4°C overnight.

[0096] 2.2 Blocking: After taking out the coated plate from 2-8℃, wash the plate three times, each time with a washing volume of 300μl / well. If there is any washing solution left in the wells after washing, pat it dry on absorbent paper; then add the pre-prepared blocking solution to the coated wells, 300μl / well, cover with sealing film, and incubate at 37℃ for 60-90min.

[0097] 2.3 Serum dilution: Dilute the serum to be tested to an appropriate concentration using sample diluent in a centrifuge tube.

[0098] 2.4 Sample addition: Wash the blocked coated plate 3 times, with a washing volume of 300μl / well each time. If there is any washing solution left in the well after washing, pat it dry on absorbent paper. Add the diluted samples of various concentrations to the sample wells in sequence, 100μl / well; add 100μl of sample dilution as a blank control (Blk), set up 5 replicate wells, cover with sealing film, and incubate at 37℃ for 60min.

[0099] 2.5 Add secondary antibody: discard the sample, wash the plate 3 times, each time with a washing volume of 300μl / well. If there is any washing solution left in the well after washing, pat it dry on absorbent paper; add diluted secondary antibody, 100μl / well, cover with sealing film, and incubate at 37℃ for 60min.

[0100] 2.6 Color development: Wash the 96-well plate three times, with a washing volume of 300 μl / well each time. If there is any washing solution left in the wells after washing, pat it dry on absorbent paper, add single-component TMB color development solution 1 (taken out in advance and equilibrated to room temperature), 100 μl / well, and develop color at 25°C in the dark for 15 minutes.

[0101] 2.7 Termination: Add stop solution immediately after color development to terminate the reaction, 50 μl / well, and shake gently to mix.

[0102] 2.8 Detection: Place the ELISA plate into the ELISA reader and measure the absorbance at a wavelength of 450nm.

[0103] 2.9 Judgment: A value greater than 2.1 times the OD value of negative mice is considered positive.

[0104] Note: The following ELISA methods for detecting binding antibody titers are the same as above.

[0105] With reference to the screening doses of the previous experiments, the immunization scheme was designed according to Table 1 to immunize animals, and the best adjuvant was screened by detecting the ELISA titers of groups 1-10 after the second immunization for 14 days.

[0106] Table 1 Immunization scheme for screening the best adjuvant

[0107]

[0108] Table 2 Elisa EC50 results of each adjuvant combination immunization mice

[0109]

[0110]

[0111] The results are shown in Table 2 and Figure 2 As shown, for humoral immunity:

[0112] (1) ELISA antibody titer results showed that if only a single adjuvant was added, the effect of sting-22 was better than that of aluminum hydroxide alone, CpG adjuvant, simvastatin alone, manganese ion alone, manganese ion + aluminum hydroxide adjuvant combination, and aluminum hydroxide + simvastatin adjuvant combination.

[0113] (2) The ELISA antibody titer results showed that if two adjuvants were added, the combination of aluminum adjuvant + sting-22 adjuvant was better and more effective than other adjuvant regimens.

[0114] Using XBBBQ.1.18m18m2-NP as the antigen protein, basically the same effect was obtained. The combination of aluminum adjuvant + sting-22 adjuvant is better and more effective than other adjuvant schemes.

[0115] 3. Vaccine pseudovirus neutralization experiment

[0116] The known lentiviral packaging system was used for testing. The adjuvant dosage was shown in Table 1. The virus dosage was 2×10 4 TCID 50 / ml.

[0117] The experimental results are as follows Figure 3 As shown:

[0118] The pseudovirus neutralization results showed that the effect of the aluminum + sting-22 adjuvant combination was significantly higher than that of the aluminum + CpG adjuvant combination. In addition to having a high neutralizing effect on the original WT, it also had a high neutralizing effect on other mutant strains such as XBB, XBB1.16, SARS, EG.5, BQ.1.1, BA.5, BA.2.86, etc.; this shows that the aluminum + sting-22 adjuvant combination can make the vaccine exert a higher immunogenicity and the vaccine effect is the best.

[0119] Example 2 Immune Response to Influenza Vaccine

[0120] 1. Balb / c mice were divided into 4 groups, with 6 mice in each group.

[0121] The first group was immunized twice with 0.1 ml of PBS alone.

[0122] The second group was vaccinated only with the split influenza virus quadrivalent vaccine (Beijing Genowei) (including influenza subtypes H1N1, H3N2, B / Yamagata and B / Victoria, see CN116650632B for details).

[0123] The third group received aluminum adjuvanted and split influenza virus quadrivalent vaccine.

[0124] The fourth group received STING-22 and split influenza virus quadrivalent vaccine.

[0125] The fifth group received a combination of aluminum with STING-22 and a split influenza virus quadrivalent vaccine.

[0126] Serum was collected 14 days after vaccination. A second booster vaccination was given 21 days after the first vaccination, and serum was collected 21 days after the second vaccination.

[0127] 2. Evaluation of influenza virus HA-specific antibody titers in the sera of vaccinated mice

[0128] 1) HA proteins of four influenza virus subtypes corresponding to the virus subtypes in the vaccine (subtypes H1N1, H3N2, B / Yamagata and B / Victoria, purchased from Sino Biological Inc.) were coated onto ELISA plates.

[0129] 2) The mouse serum was serially diluted 3-fold or 5-fold using PBST, and then the diluted serum was added to the coated ELISA plate.

[0130] After incubation at 37°C for 1 hour, the plate was washed five times with PBST, and rabbit anti-mouse HRP secondary antibody (Dako, 1:2000 dilution) was added.

[0131] 4) After incubation at 37°C for 1 hour, the plate was washed 5 times with PBST, TMB (Sigma) substrate was added for color development, and H2SO4 was added to terminate the reaction. OD450 was read on a microplate reader.

[0132] The results are shown in Table 3. Among the five groups of mice, 21 days after the second vaccination, the antibody titer against HA protein of four influenza virus subtypes in the sera of mice vaccinated with the quadrivalent influenza virus vaccine and the combination vaccine of aluminum and STING-22 was the highest, which was significantly higher than the titer in the sera of mice vaccinated with the quadrivalent influenza virus vaccine without adjuvant and mice vaccinated with the quadrivalent influenza virus vaccine and the aluminum adjuvant vaccine.

[0133] Table 3. Antibody titers of influenza virus in the serum of mice after inoculation with quadrivalent influenza vaccine

[0134]

[0135] The results showed that the double adjuvant group 5 was significantly better than the single adjuvant groups 3 and 4 (p < 0.0001), indicating that influenza vaccines using a combination of aluminum and STING-22 as adjuvants can produce more potent antibody immune responses in mice.

[0136] Example 3: Combination of aluminum and STING-22 can enhance immune response to varicella zoster (VZV) gE protein

[0137] Materials: Varicella zoster (VZV) gE protein-Fc fusion protein (VZV-gE-FC) (for specific preparation, see CN116023510B).

[0138] The mice were divided into four groups, with 5 mice in each group (see Table 4).

[0139] 1) The first group was immunized twice with 0.1 ml PBS only.

[0140] 2) The second group of mice was vaccinated intramuscularly with 0.2 mg of aluminum adjuvant and 7.5 μg of VZV-gE-FC fusion protein.

[0141] 3) The third group of mice was vaccinated intramuscularly with 10 μg of STING-22 and 7.5 μg of VZV-gE-FC fusion protein.

[0142] 4) The fourth group of mice was vaccinated intramuscularly with a combination of 0.2 mg of aluminum and 10 μg of STING-22 and containing 7.5 μg of VZV-gE-FC fusion protein.

[0143] 5) The fifth group of mice was vaccinated intramuscularly with only 7.5 μg of VZV-gE-FC fusion protein.

[0144] Mice were vaccinated on days 0, 14, and 28, and sera were collected from mice on days 21 and 35.

[0145] On days 21 and 35, ELISA test was used to determine the level of antibodies specifically binding to VZV gE protein in mouse sera, see Table 5.

[0146] ELISA test was performed using .

[0147] Table 4 Immunization schedule

[0148]

[0149]

[0150] Table 5 ELISA test results

[0151]

[0152] The results are shown in Table 5. The double adjuvant group 4 was significantly superior to the single adjuvant groups 3, 2 and 5 (p = 0.0004; p < 0.0001; p < 0.0001), indicating that the combination of aluminum and STING-22 as adjuvants for VZV vaccines can produce more potent antibody immune responses in mice. These results fully show that the combination of aluminum and STING-22 can be used as a universal adjuvant to stimulate more potent immune responses to different viral subunits and vaccines.

[0153] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0154] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0155] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

[0156] Sequence Description:

[0157] 1. Amino acid sequence of universal COVID-19 vaccine dimer (XBBBQ.1.1 8m18m2-Fc, SEQ ID No: 1):

[0158] MLRGPGPGLLLAVLCLGTAVRCTEA

[0159]

[0160] Among them, positions 1-25 are signal peptides, positions 26-244 are RBD of XBB, positions 245-249 are connecting peptides, positions 250-468 are RBD of BQ.1.1, positions 469-473 are connecting peptides, positions 474-692 are 8m1 mutants of the original strain RBD, positions 693-697 are connecting peptides, positions 698-916 are 8m2 mutants of the original strain RBD, positions 917-924 are connecting peptides, and positions 925-1152 are Fc fragments of IgG1.

[0161] 2. Nucleotide sequence encoding the above dimer amino acid (SEQ ID No: 2):

[0162]

[0163] 3. Amino acid sequence of universal new crown nanoparticles (XBBBQ.1.1 8m18m2-NP, SEQ ID No: 3):

[0164] MLRGPGPGLLLAVLCLGTAVRCTEA

[0165]

[0166] in,

[0167] Among them, positions 1-25 are signal peptides, positions 26-244 are RBD of XBB, positions 245-249 are connecting peptides, positions 250-468 are RBD of BQ.1.1, positions 469-473 are connecting peptides, positions 474-692 are 8m1 mutants of the original strain RBD, positions 693-697 are connecting peptides, positions 698-916 are 8m2 mutants of the original strain RBD, positions 917-924 are connecting peptides, and positions 925-1089 are Helicobacter pylori ferritin (Ferritin, or HPF).

[0168] The mutation sites of 8M1 amino acids relative to the original strain include R346T, K417N, K444T, G446S, L452R, N460K, E484A, and F486S;

[0169] The mutation sites of 8M2 amino acids relative to the original strain include R346T, K417N, V445A, G446S, L452R, N460K, E484A, and F486S;

[0170] 4. Nucleic acid sequence encoding SEQ ID No: 3 universal new crown nanoparticles (SEQ ID No: 4):

[0171] ATGCTACGAGGTCCAGGTCCAGGTCTACTATTGGCTGTGCTTGTGCCTGGGCACCGCCGTGA

[0172] GATGCACCGAGGCC

[0173] AGAGTGCAGCCTACCGAATCAATCGTGAGATTCCCTAACATCACCAACCTCTGTCCTTTCCACGAGGTGTTCAACGCCACAACCTTTGCTTCTGTGTACGCCTGGAACAGAAAGCGCATCTCCAACTGCGTGGCCGACTACTCCGTGATCTACAACTTCGCCCCTTTCTTCGCCTTCAAGTGTTACGGTGTGTCCCCAACCAAGCTGAACGACCTGTGCTTTACCAACGTGTACGCCGACAGCTTCGTCATCCGGGGCAACGAGGTGTCCCAGATCGCACCCGGCCAAACCGGAAACATCGCCGACTACAACTACAAGCTGCCTGACGACTTCACCGGCTGTGTGATCGCTTGGAACTCTAACAAACTGGACTCTAAGCCCTCCGGCAACTACAACTACCTGTATAGACTGTTCCGGAAGAGCAAGCTGAAGCCCTTCGAGCGGGACATCTCTACCGAGATCTACCAGGCCGGCAACAAACCTTGCAATGGCGTCGCAGGCAGCAACTGCTACTCCCCCCTGCAGAGCTACGGCTTCAGACCTACCTACGGAGTGGGCCACCAGCCTTACAGAGTGGTCGTGCTGTCCTTTGAGCTGCTGCATGCTCCTGCGACCGTGTGCGGCCCAAAGAAGTCTAC

[0174] AAACCTGGTGAAGAACAAG

[0175] GGCGGCTCCGGAGGC

[0176] AGAGTGCAGCCTACCGAGTCCATCGTGCGGTTCCCCAACATCACCAACCTGTGTCCTTTCGACGAGGTGTTCAACGCCACCACCTTCGCCTCCGTGTACGCCTGGAACAGAAAGCGTATCTCCAACTGTGTGGCCGATTACTCTGTGCTGTACAACTTTGCCCCATTCTTCGCCTTCAAGTGCTACGGCGTGTCTCCTACCAAGCTGAACGACCTGTGCTTCACCAACGTGTATGCTGATTCTTTCGTGATCAGGGGCAACGAGGTGTCTCAGATCGCTCCTGGCCAGACAGGAAACATCGCAGACTACAACTACAAGCTGCCTGACGACTTCACCGGCTGTGTGATCGCCTGGAACTCCAACAAGCTCGACTCCACAGTGGGAGGCAACTACAATTACCGCTACAGACTGTTTCGGAAGTCTAAACTGAAGCCTTTCGAAAGAGACATCTCTACTGAAATCTACCAAGCAGGCAATAAGCCCTGCAACGGAGTGGCTGGCGTAAACTGCTATTTCCCTCTGCAGAGCTACGGCTTCAGACCCACCTACGGCGTCGGCCATCAGCCCTACAGAGTGGTGGTGCTGTCCTTCGAGCTGCTGCACGCTCCAGCTACCGTCTGTGGTCCTAAGAAGTCCACC

[0177] AACCTGGTGAAGAATAAA

[0178] GGCGGTTCTGGCGGA

[0179]

[0180] ATGGAGTTGGATACCAACCTTACCGGGTGGTGGTGCTGTCCTTCGAGCTGCTGCACGCCCCTGC

[0181] GACCGTGTGCGGCCCTAAGAAATCTACCAACCTGGTGAAGAACAAGTCCGGCTCTGGCGGCGG

[0182] CTCCGGCGACATCATCAAGCTGCTGAACGAGCAGGTGAACAAAGAGATGCAGTCCTCCAACCT

[0183] GTACATGTCCATGTCCTCTTGGTGCTACACCCACTCTCTGGATGGCGCTGGACTGTTCCTGTTCG

[0184] ACCACGCCGCTGAAGAGTATGAGCACGCCAAGAAGCTGATCATCTTCCTGAACGAAAACAACG

[0185] TGCCTGTGCAACTGACATCCATCTCCGCTCCTGAGCACAAGTTCGAGGGTCTGACCCAGATCTT

[0186] CCAGAAGGCCTACGAGCATGAACAGCACATCTCCGAGTCCATCAACAACATCGTGGACCACGCC

[0187] ATCAAGTCTAAGGACCACGCTACCTTCAACTTCTTACAGTGGTACGTGGCCGAGCAGCACGAGG

[0188] AAGAAGTGCTGTTCAAGGACATCCTGGACAAGATCGAGCTGATCGGCAACGAGAACCACGGCC

[0189] TGTACCTGGCCGACCAGTACGTGAAGGGCATCGCCAAGTCCCGGAAGAGCGGCTCC(SEQ ID

[0190] No:4)。

Claims

1. An adjuvant composition, characterized in that The adjuvant composition comprises 1) an aluminum agent, and 2) a STING agonist.

2. The adjuvant composition according to claim 1, characterized in that The aluminum agent includes aluminum hydroxide, aluminum phosphate or alum; The STING agonist includes 2'3'-cGAMP, 3'3'-cGAMP, c-di-AMP, c-di-GMP, cAIMP or sting-22, Preferably, the ratio of the STING agonist to the aluminum agent is (1-5): (1-50).

3. Use of the adjuvant composition according to any one of claims 1 to 2 in the preparation of an antiviral vaccine.

4. The use according to claim 3, characterized in that: The antiviral vaccine comprises a viral antigen protein and an adjuvant composition. Preferably, the virus includes but is not limited to hepatitis B virus, herpes simplex virus, human papillomavirus, Epstein-Barr virus, cytomegalovirus, smallpox virus, varicella-zoster virus, 2019 novel coronavirus, HIV, coxsackievirus, poliovirus, rhinovirus, foot-and-mouth disease virus, yellow fever virus, dengue virus, epidemic encephalitis B virus, Lassa fever virus, rabies virus, Hantavirus, Ebola virus, Marburg virus, influenza virus, parainfluenza virus, measles virus, rubella virus, mumps virus, respiratory syncytial virus, hepatitis virus, rotavirus or MERS virus.

5. A vaccine composition, characterized in that The vaccine composition comprises viral antigen protein and the adjuvant composition according to any one of claims 1-2.

6. The vaccine composition according to claim 5, characterized in that The viruses include hepatitis B virus, herpes simplex virus, human papillomavirus, Epstein-Barr virus, cytomegalovirus, smallpox virus, varicella-zoster virus, 2019 novel coronavirus, HIV, coxsackievirus, poliovirus, rhinovirus, foot-and-mouth disease virus, yellow fever virus, dengue virus, Japanese encephalitis virus, Lassa fever virus, rabies virus, Hantavirus, Ebola virus, Marburg virus, influenza virus, parainfluenza virus, measles virus, rubella virus, mumps virus, respiratory syncytial virus, hepatitis virus, rotavirus or MERS virus.

7. The vaccine composition according to any one of claims 5-6, characterized in that 1) The antigen protein forms a fusion protein, wherein the fusion protein comprises one or more antigen proteins, and preferably, the fusion protein further comprises an Fc fragment and / or a self-assembled oligomeric protein, 2) The antigen protein is derived from virus lysate, or 3) The antigen protein is derived from the purified antigen protein of the virus.

8. The vaccine composition according to any one of claims 5 to 7, characterized in that The ratio of the antigen protein to the adjuvant is (1-5):(1-60).

9. The vaccine composition according to any one of claims 5 to 8, characterized in that The ratio of the antigen protein to the aluminum adjuvant is (1-5): (1-50) The ratio of the antigen protein to the STING agonist is (1-5):(1-5).

10. The method for preparing the vaccine composition according to any one of claims 5 to 9, characterized in that: The preparation method comprises the following steps: The virus antigen protein and the adjuvant composition are mixed to obtain an antiviral vaccine composition.

Images