Fusion protein and application thereof in degradation of targeted easily-agglomerated protein

Abstract

The invention provides a fusion protein and application of the fusion protein in degradation of targeted easily-agglomerated protein. The fusion protein is formed by fusing a protein of a target protein gene X and an E3TCD protein, namely X-E3TCD, and X is a target protein gene; the gene of the X-E3TCD is transferred into a plant body through a transient expression or transgenosis method, so that the fusion protein of the X-E3TCD is expressed, and the endogenous protein aggregate of the plant can be degraded in a targeted manner; the method provided by the invention not only can realize character improvement of crops, but also can become a potential gene therapy approach for treating human diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of protein targeted degradation, and in particular relates to a fusion protein and application thereof in targeted degradation of easily aggregated proteins. Technical Background

[0002] In the field of plant biology, the dynamic regulation mechanism of protein homeostasis constitutes one of the core strategies for plants to adapt to changing growth conditions and resist biotic and abiotic stresses. This process covers multiple key links such as de novo protein synthesis, post-translational modification, precise intracellular localization and final degradation, which together maintain the balance and functional optimization of intracellular protein components. Recent studies have found that protein aggregation mediated by phase separation plays an important role in the regulation of protein homeostasis. Phase separation allows proteins to spontaneously aggregate under specific conditions to form liquid-liquid phase separation bodies without membrane structures. This process not only regulates the local concentration and interaction network of proteins, but also may play a key role in signal transduction, organelle formation and functional partitioning, thus profoundly affecting the growth and development of plants and their stress response capabilities. Given the importance of protein homeostasis to plant physiological activities, its regulation strategy is gradually becoming a new target for crop genetic improvement. Parallel to the widely used CRISPR-Cas9 gene editing technology and RNA interference and other genetic manipulation methods based on DNA or RNA level, regulating protein homeostasis provides a new way to directly intervene at the protein function level and precisely regulate plant traits. This strategy can not only fine-tune the function and activity of specific proteins, but also unlock the space for trait improvement that is difficult to reach with traditional breeding methods, showing great potential as a future agricultural biotechnology innovation. Therefore, in-depth research on the regulatory mechanism of protein homeostasis and its application potential in plants is of great significance for promoting sustainable agricultural development and improving crop stress resistance and yield.

[0003] In the complex network architecture of protein homeostasis regulation, the ubiquitin-proteasome system (UPS) and the autophagy system occupy an indispensable core position and jointly maintain the dynamic balance of intracellular proteins. Based on the in-depth exploration of these two systems, researchers have successfully designed a variety of innovative tools, such as auxin-induced degraders (AIDs), autophagy targeting chimeras (AUTACs), protein hydrolysis targeting chimeras (PROTACs), and Trimes. These tools have greatly enriched human basic understanding of life processes by precisely targeting and promoting protein degradation, and have shown great application potential and valuable value in the field of drug development. However, although these technologies have made significant progress in biomedical research, their promotion and application in the agricultural field face many challenges. The core problem is that most of these technologies rely on small molecule chemical inducers, specific antibodies, or require gene editing to integrate degrader sequences into endogenous proteins. This process is not only technically complex, but also time-consuming and costly, which limits its widespread application in agricultural practice.

[0004] In view of this, developing a direct, efficient and economical strategy for the specific modification of endogenous plant proteins has become a key issue to be solved in the field of agricultural science research. This strategy aims to promote the targeted improvement of crop traits by simplifying the operation process, reducing technical barriers and costs, and thus conforming to the grand goal of sustainable agricultural development. Summary of the invention

[0005] The purpose of the present invention is to provide a fusion protein and its application in targeted degradation of aggregation-prone proteins. The present invention screened 5 E3TCD1s with aggregation ability and self-degradation characteristics in the model plant Arabidopsis thaliana that can be used in the targeted aggregation protein degradation (TCD) method system, and further demonstrated the effectiveness of the TCD method in targeted degradation of endogenous protein aggregates at the tobacco, rice and animal levels.

[0006] In order to test the above-mentioned purpose, the present invention adopts the following technical scheme:

[0007] In the first aspect of the present invention, a fusion protein is provided, wherein the fusion protein is composed of a fusion of a protein of a target protein gene X and an E3TCD protein, and the structure of the fusion protein is shown in Formula I:

[0008]

[0009] The X is a target protein gene, i.e., a protein gene that needs to be degraded; the E3TCD protein is an E3 ligase with inherent disordered protein characteristics, which can achieve self-degradation through phase separation aggregation; the gene encoding the E3TCD protein includes one of the following:

[0010] The E3TCD protein of Arabidopsis thaliana, referred to as AtE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.25;

[0011] The rice E3TCD protein, referred to as OsE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.26;

[0012] The E3TCD protein of maize, referred to as ZmE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.27;

[0013] The E3TCD protein of wheat, referred to as TaE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.28;

[0014] The soybean E3TCD protein, referred to as GmE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.29;

[0015] The Arabidopsis thaliana E3TCD2 protein, referred to as AtE3TCD2, has a nucleotide sequence as shown in SEQ ID NO.30;

[0016] The Arabidopsis thaliana E3TCD3 protein, referred to as AtE3TCD3, has a nucleotide sequence as shown in SEQ ID NO.31;

[0017] The Arabidopsis thaliana E3TCD4 protein, referred to as AtE3TCD4, has a nucleotide sequence as shown in SEQ ID NO.32;

[0018] The E3TCD5 protein of Arabidopsis thaliana, referred to as AtE3TCD5, has a nucleotide sequence as shown in SEQ ID NO.33.

[0019] Furthermore, the target protein gene X is directly connected to the E3TCD protein or connected via a Linker.

[0020] The linker can be a flexible linker, such as amino acid GGGSSGGGS.

[0021] As a specific implementation, the nucleotide sequence of the linker is:

[0022] 5'-gcacggctcttctcctcactcgaccagatctcgtacgcgtcccggggcggtggctcatctggcggaggtggatct-3' (SEQ ID NO. 37), the amino acid sequence is: ARLFSSLDQISYASRGGGSSGGGGS (SEQ ID NO. 38).

[0023] Further, the gene encoding the E3TCD protein was obtained by PCR amplification using the following primer pair:

[0024] 1) Primer pair AtP1, nucleotide sequence as shown in SEQ ID NO.1-SEQ ID NO.2; amplified a 2001 bp amplified fragment from Arabidopsis thaliana cDNA, i.e., a nucleic acid molecule encoding Arabidopsis thaliana E3TCD protein;

[0025] 2) Primer pair OsP1, nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4; a 2004 bp amplified fragment can be amplified from rice cDNA, i.e., a nucleic acid molecule encoding rice E3TCD protein;

[0026] 3) Primer pair ZmP1, nucleotide sequence as shown in SEQ ID NO.5-SEQ ID NO.6; can amplify a 1992 bp amplified fragment from corn cDNA, i.e., a nucleic acid molecule encoding corn E3TCD protein;

[0027] 4) Primer pair TaP1, nucleotide sequence as shown in SEQ ID NO.7-SEQ ID NO.8; can amplify a 2007 bp amplified fragment from wheat cDNA, i.e., a nucleic acid molecule encoding wheat E3TCD protein;

[0028] 5) Primer pair GmP1, nucleotide sequence as shown in SEQ ID NO.9-SEQ ID NO.10; can amplify a 2148 bp amplified fragment from soybean cDNA, i.e., a nucleic acid molecule encoding soybean E3TCD protein;

[0029] 6) Primer pair AtP2, nucleotide sequence as shown in SEQ ID NO.11-SEQ ID NO.12; amplified fragment of 1485 bp from Arabidopsis thaliana cDNA, i.e., a nucleic acid molecule encoding Arabidopsis thaliana E3TCD2 protein;

[0030] 7) Primer pair AtP3, nucleotide sequence as shown in SEQ ID NO.13-SEQ ID NO.14; amplified a 1461 bp amplified fragment from Arabidopsis thaliana cDNA, i.e., a nucleic acid molecule encoding Arabidopsis thaliana E3TCD3 protein;

[0031] 8) Primer pair AtP4, nucleotide sequence as shown in SEQ ID NO.15-SEQ ID NO.16; amplified a 1038 bp amplified fragment from Arabidopsis thaliana cDNA, i.e., a nucleic acid molecule encoding Arabidopsis thaliana E3TCD4 protein;

[0032] 9) Primer pair AtP5, nucleotide sequence as shown in SEQ ID NO.17-SEQ ID NO.18; a 996 bp amplified fragment was amplified from Arabidopsis thaliana cDNA, namely, a nucleic acid molecule encoding Arabidopsis thaliana E3TCD5 protein.

[0033] In the second aspect of the present invention, a nucleic acid molecule encoding the fusion protein is provided.

[0034] In the third aspect of the present invention, a recombinant vector containing the nucleic acid molecule is provided.

[0035] In the fourth aspect of the present invention, a promoter of a recombinant vector is provided.

[0036] In the fifth aspect of the present invention, a transformant comprising the recombinant vector is provided.

[0037] In the sixth aspect of the present invention, a method for targeted degradation of plant endogenous protein aggregates is provided, the method comprising: transferring the nucleic acid molecule or the recombinant vector into the plant body by transient expression or transgenic method, thereby expressing the fusion protein to achieve targeted degradation of plant endogenous protein aggregates.

[0038] In the sixth aspect of the present invention, provided is the use of the fusion protein, the nucleic acid molecule or the recombinant vector in improving plant traits.

[0039] In the above application, by expressing the above fusion protein in crops, targeted degradation of target endogenous protein aggregates can be achieved, thereby improving crop disease resistance, heading period, fruit setting rate and other traits at the protein level.

[0040] In the seventh aspect of the present invention, provided is the application of the fusion protein, the nucleic acid molecule or the recombinant vector in the field of animal research based on protein targeted degradation.

[0041] In the seventh aspect of the present invention, provided is the use of the fusion protein, the nucleic acid molecule or the recombinant vector in medical treatment or drug research.

[0042] Furthermore, the gene sequence of the target gene-E3TCD and the fusion protein expressed by it can be used in medical treatment and drug development, etc. The above TCD technology, as a potential gene therapy approach, can be used to treat and / or prevent any disease or condition related to and / or caused by protein aggregates, including but not limited to neurodegenerative diseases, metabolic diseases, etc.

[0043] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0044] The present invention innovatively proposes a method based on a novel targeted aggregation-prone protein degradation (TCD) mechanism, and deeply explores its application in basic research on protein function. This method uses transgenic technology to precisely regulate the degradation process of endogenous proteins, showing the advantages of simple operation, significant efficiency and no adverse reactions to organisms. In view of the global challenges faced by the field of modern agriculture, it is urgent to develop crop varieties with excellent characteristics such as high yield and stress resistance to achieve sustainable agricultural development. In this context, the rapid development of transgenic technology, especially in combination with TCD strategies, together with advanced genetic engineering methods such as DNA editing and RNA silencing, provides strong technical support for the cultivation of new crop varieties that can effectively cope with the above challenges. In this study, we successfully verified the degradation activity of the E3TCD1 protein in Arabidopsis thaliana in heterologous expression systems such as tobacco and rice, revealing the extensive conservation of its function. Furthermore, through systematic screening and identification, we found homologous genes of E3TCD1 in multiple plant species. This discovery not only expands the scope of application of the TCD mechanism, but also provides rich genetic resources for subsequent functional verification and improvement among multiple species. More importantly, the universality and efficiency of the TCD method in this study indicate that it also has great application potential in the biomedical field. As a potential gene therapy strategy, TCD technology is expected to provide new ideas and means for the treatment of genetic diseases caused by abnormal protein accumulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the technical method in the embodiment of the present invention, the following will introduce the relevant drawings in the embodiment description. Obviously, the drawings in the following description are some embodiments of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0046] Figure 1., Schematic diagram of TCD. The TCD system targets specific condensates formed by the condensation-prone protein X. These proteins normally aggregate into condensates, transitioning from a soluble phase to an ordered structure, reaching an equilibrium between condensates of different sizes (oligomeric, low-order, and high-order). To remove these condensates, an E3 ligase from the ubiquitin-proteasome system (UPS) is fused to X to form X-E3. This fusion protein mimics X and facilitates its penetration into the interior of the condensate. Once inside, X-E3 triggers the degradation process. Before generating transgenic plants for phenotypic analysis, it is crucial to perform preliminary experiments involving transient expression of X-E3 with X-YFP in N. benthamiana or protoplasts, which can be used to assess TCD efficiency by methods such as microscopic observation or immunoblot analysis. In order to control the spatial and temporal expression of X-E3 as well as the expression intensity, different promoters need to be used.

[0047] Figure 2 .a,b, Degradation of E3TCD1-YFP and E3TCD1ΔRING-YFP condensates by E3TCD1 in preliminary experiments in N. benthamiana by microscopic observation (a) and immunoblot analysis (b). The target protein X was tagged with YFP, while TCD was represented by X-E3TCD1. In microscopic observation, 35S::CFP was used as a control (a). Scale bar, 10 μm. CBB, Coomassie brilliant blue.

[0048] Figure 3.a, OsTB1 was predicted as an intrinsically disordered protein (IDP) using the PLAAC and D2P2 algorithms, indicated by the prion-like domain (PrD) score and disorder score, respectively. The bottom part shows the low complexity region and RING domain annotated by the SMART website. b,c, Preliminary experiments demonstrated the degradation of OsTB1 by the TCD system by microscopic observation (b) and immunoblot analysis (c). In microscopic observation, 35S::CFP was used as a control (b). Semi-quantitative RT-PCR analysis of YFP was performed using NbUBQ as an internal control (c). Scale bar, 10 μm. d,e, Tiller number in rice Zhonghua 11 (ZH11) plants transformed with 35S::E3TCD1 or 35S::OsTB1-E3TCD1. Two independent transgenic lines (#1 and #2) were used for each construct. Bar graphs show mean ± SD of tiller number (n = 30), and significance was determined using a two-sided Student's t test. Scale bar, 10 cm. f, Quantitative RT-PCR shows relative levels of endogenous OsTB1 mRNA in transgenic lines. The endogenous OsTB1 gene was amplified using primers that bind to the untranslated region (not included in the OsTB1-E3TCD1 transgene). Bar graphs show mean ± SD after normalization to ZH11 (n = 3), and significance was determined using a two-sided Student's t test.

[0049] Figure 4 .a,b, Preliminary experiments showing the degradation of OsELF3-1 and OsELF3-2 by the TCD system by microscopic observation (a) and immunoblot analysis (b). In microscopic observation, 35S::CFP was used as a control (a). Semi-quantitative RT-PCR analysis of YFP was performed using NbUBQ as an internal control (b). Scale bar, 10 μm. CBB, Coomassie Brilliant Blue. c,d, Flowering phenotypes of rice Zhonghua 11 (ZH11) plants transformed with 35S::E3TCD1, 35S::OsELF3-1-E3TCD1, or 35S::OsELF3-2-E3TCD1. Scale bar, 10 cm. Two independent transgenic lines (#1 and #2) were used for each construct. The bar graph shows the mean ± SD (n = 15) of days from sowing to heading under natural long day (LD) conditions, and the significance was determined using a two-sided Student's t test.

[0050] Figure 5a, b, Growth phenotypes of rice Zhonghua 11 (ZH11) plants transformed with ProHSP::OsELF3-1-E3TCD1. Two independent transgenic lines (#1 and #2) were used. c, e, f, Seed setting phenotypes of rice Zhonghua 11 (ZH11) plants transformed with ProHSP::OsELF3-1-E3TCD1. d, Days from sowing to heading under natural long day (LD) conditions.

[0051] Figure 6 .Degradation of OCT4 by TCD system was observed by microscopy. mCherry was used as a control. Scale bar, 10 μm. DETAILED DESCRIPTION

[0052] The present invention will be further described below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0053] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0054] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0055] The present invention provides a fusion protein and its application in targeted degradation of aggregation-prone proteins. The overall idea is as follows:

[0056] We explored the application of TCD method in plants, and here we proposed a new method for targeted degradation of endogenous protein aggregates in plants. In previous studies, we screened 5 E3TCD1s with aggregation ability and self-degradation characteristics in the model plant Arabidopsis that can be used in the TCD method system, and further demonstrated the effectiveness of TCD method in targeted degradation of endogenous protein aggregates in tobacco and rice.

[0057] The TCD method modifies and transforms genetic material at the protein level, and has important potential application value in crop breeding, animal research, medical treatment, and drug development.

[0058] As a typical embodiment of the present invention, a fusion protein is provided, characterized in that the fusion protein is composed of a fusion of a protein of a target protein gene X and an E3TCD protein, and the structure of the fusion protein is shown in Formula I:

[0059]

[0060] The X is a target protein gene, i.e., a protein gene that needs to be degraded; the E3TCD protein is an E3 ligase with inherent disordered protein characteristics, which can achieve self-degradation through phase separation aggregation; the gene encoding the E3TCD protein includes one of the genes obtained by PCR amplification using the following primer pairs:

[0061] 1) Primer pair AtP1, nucleotide sequence as shown in SEQ ID NO.1-SEQ ID NO.2;

[0062] 2) Primer pair OsP1, nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4;

[0063] 3) Primer pair ZmP1, the nucleotide sequence is shown in SEQ ID NO.5-SEQ ID NO.6;

[0064] 4) Primer pair TaP1, the nucleotide sequence is shown in SEQ ID NO.7-SEQ ID NO.8;

[0065] 5) Primer pair GmP1, the nucleotide sequence of which is shown in SEQ ID NO.9-SEQ ID NO.10;

[0066] 6) Primer pair AtP2, the nucleotide sequence is shown in SEQ ID NO.11-SEQ ID NO.12;

[0067] 7) Primer pair AtP3, the nucleotide sequence is shown in SEQ ID NO.13-SEQ ID NO.14;

[0068] 8) Primer pair AtP4, the nucleotide sequence is shown in SEQ ID NO.15-SEQ ID NO.16;

[0069] 9) Primer pair AtP5, the nucleotide sequence is shown in SEQ ID NO.17-SEQ ID NO.18.

[0070] Table 1

[0071]

[0072]

[0073] As a specific implementation manner, when the target protein gene X is OsTB1, it can be amplified by the primer pair of SEQ ID NO.39-SEQ ID NO.40.

[0074] As a specific embodiment, when the target protein gene X is ELF3, the use of the ELF3-E3TCD1 nucleic acid molecule in improving the flowering time of the plant of the fusion gene sequence is provided. The nucleic acid molecule encoding the ELF3 protein is selected from one of the following:

[0075] 1) AtELF3, the nucleotide sequence is shown in SEQ ID NO.41; it can be amplified by the primer pair of SEQ ID NO.42-SEQ ID NO.43.

[0076] 2) OsELF3, the nucleotide sequence is shown in SEQ ID NO.44; it can be amplified by the primer pair of SEQ ID NO.45-SEQ ID NO.46.

[0077] 3) ZmELF3, the nucleotide sequence is shown in SEQ ID NO.47; it can be amplified by the primer pair of SEQ ID NO.48-SEQ ID NO.49.

[0078] 4) TaELF3, the nucleotide sequence is shown in SEQ ID NO.50; it can be amplified by the primer pair of SEQ ID NO.51-SEQ ID NO.52.

[0079] 5) GmELF3, the nucleotide sequence is shown in SEQ ID NO.53; it can be amplified by the primer pair of SEQ ID NO.54-SEQ ID NO.55.

[0080] The nucleic acid molecule encoding the ELF3 protein can be obtained by PCR amplification using the primer pairs shown in Table 2.

[0081] Table 2

[0082]

[0083] As a specific embodiment, when the target protein gene X is OCT4, the application of the nucleic acid molecule of OCT4-E3TCD1 in the protein degradation of the HeLa cell system of the fusion gene sequence is provided. The nucleic acid molecule encoding the OCT4 protein is as follows:

[0084] OCT4, the nucleotide sequence is shown in SEQ ID NO.57; it can be amplified by the primer pair of SEQ ID NO.58-SEQ ID NO.59.

[0085] As a specific implementation, Pro HSP :: Application of the nucleic acid molecule of OsELF3-1-E3TCD1 in improving the rice seed setting rate of the fusion gene sequence.HSP The promoter nucleic acid molecule was obtained by PCR amplification using one of the following primer pairs:

[0086] 1) Primer pair HSP1, nucleotide sequence as shown in SEQ ID NO.19-SEQ ID NO.20; a 2043 bp amplified fragment can be amplified from rice genomic DNA, i.e., the rice HSP1 promoter, referred to as Pro HSP1 , the nucleotide sequence is shown in SEQ ID NO.34;

[0087] 2) Primer pair HSP2, nucleotide sequence as shown in SEQ ID NO.21-SEQ ID NO.22; an amplified fragment of 825 bp can be amplified from rice genomic DNA; namely, the rice HSP2 promoter, referred to as Pro HSP2 , the nucleotide sequence is shown in SEQ ID NO.35;

[0088] 3) Primer pair HSP3, nucleotide sequence as shown in SEQ ID NO.23-SEQ ID NO.24. ; Amplified fragment of 829 bp can be amplified from rice genomic DNA; The rice HSP3 promoter, referred to as Pro HSP3 , the nucleotide sequence is shown in SEQ ID NO.36.

[0089] The following will describe in detail a fusion protein of the present application and its application in targeted degradation of aggregation-prone proteins in combination with examples and experimental data.

[0090] Example 1 TCD method determines that TB1 is a negative regulator of rice tillering

[0091] 1. Construction of TB1-E3TCD1 vector

[0092] 1. Primer Design and Synthesis

[0093] Download the OsTB1 genome sequence from the Rice Genome Annotation Project website, design specific amplification primers, and use the total cDNA of Zhonghua 11 (ZH11) as a template to amplify the OsTB1 gene fragment. In our previous study, we have screened and verified E3TCD1 in the TCD method system, and successfully constructed a 35S::E3TCD1 plasmid vector. The construction method is: the universal promoter 35S and E3TCD1 (nucleotide sequence as shown in SEQ ID NO.25) are connected to the pCAMBIA1300 vector by restriction digestion, respectively, using Ecor1 and Sac1 double digestion, and Kpn1 and Bamh1 double digestion.

[0094] Since our vector construction system uses the LIC connection method, we added LIC sequence linkers CGA CGA CAA GAC CGT ACC and GA GGA GAA GAG CCG TGC to the 5' ends of the upstream and downstream primer fragments used for amplification. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The sequences and numbers of each primer are as follows:

[0095] Upstream primer OsTB1-F:

[0096] 5′--3′:CGA CGA CAA GAC CGT ACC ATGCTTCCTTTCTTCGATTCCC (SEQ ID NO. 39);

[0097] Downstream primer OsTB1-R:

[0098] 5′--3′:GA GGA GAA GAG CCG TGC GCAGTAGTGCCGCGAATTGGCG (SEQ ID NO. 40);

[0099] 2. PCR Amplification

[0100] Using the cDNA of ZH11 as a template and the primers synthesized in step 1, PCR amplified the OsTB1 fragment. The amplification reaction system and specific reaction conditions are as follows:

[0101]

[0102] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min; and 72°C for 5 min.

[0103] The amplified PCR product was detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.

[0104] 3. LIC treatment of target fragment and vector

[0105] The target fragment recovered in step 2 is subjected to LIC treatment, and the specific reaction system and steps are as follows:

[0106]

[0107] The above components were mixed using a pipette and the following reactions were performed on a PCR thermal cycler: 12°C for 30 min, 75°C for 10 min.

[0108] The 35S::E3TCD1 vector constructed in the previous study was treated with LIC. The specific reaction system and steps are as follows:

[0109]

[0110] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12°C for 40 min, 75°C for 10 min.

[0111] 4.35S::TB1-E3TCD1 vector construction

[0112] Take out 1.5ul of the vector and target fragment treated with LIC in step 3, mix well, and place in a PCR thermal cycler for reaction: 75℃ for 5min, 22℃ for 5min.

[0113] Transfer the above 3ul ligation product to 30ul supercompetent E. coli DN5α, flick it 3-5 times with your finger, and then let it stand on ice for 20 to 30min. After standing, put it in 42℃ heat shock for 1min, and immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it, and resuscitate it in a shaker at 220rpm and 37℃ for 45-60min. Precipitate E. coli at 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in a 37℃ incubator overnight.

[0114] The next day, eight colonies were streaked onto new plates and colony PCR was performed in the afternoon. A positive colony was selected for sequencing. After the sequencing results were correct, the plasmid was returned from the company for Agrobacterium transformation.

[0115] At the same time, 35S::E3TCD1 and 35S::TB1-mYFP vectors were used as controls, wherein the construction method of the 35S::TB1-mYFP vector was as follows: the universal promoter 35S and TB1-mYFP (nucleotide sequence as shown in SEQ ID NO.56) were ligated to the pCAMBIA1300 vector by enzyme digestion, using Ecor1 and Sac1 double digestion, and Kpn1 and Bamh1 double digestion, respectively.

[0116] The plasmid containing 35S::TB1-E3TCD1 was transferred into Agrobacterium GV3101 (for tobacco injection and other related experiments) and Agrobacterium EHA105 (for obtaining rice transgenic plants).

[0117] The specific steps of Agrobacterium transformation are as follows: transfer the above 3ul plasmid to 30ul supercompetent Agrobacterium GV3101 or EHA105, flick it with your finger 3-5 times, and then let it stand on ice for 10min. First put it in liquid nitrogen to freeze for 1min, then put it in 42℃ heat shock for 1min, and then immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it and revive it in a shaker at 220rpm and 28℃ for 45-60min. Precipitate Agrobacterium at a speed of 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in an incubator at 28℃ for two days. Pick a monoclonal colony of Agrobacterium, shake it, and mix it with 50% glycerol at a ratio of 1:1 and store it in a refrigerator at -80℃.

[0118] 2. Heterologous expression of 35S::TB1-E3TCD1 in tobacco can effectively degrade TB1

[0119] 1. Tobacco injection

[0120] Nicotiana benthamiana tobacco was grown in a greenhouse under the following conditions: 14 h light / 10 h dark, 25°C, 70% relative humidity; the tobacco was ready for injection after approximately 4 to 5 weeks of cultivation.

[0121] Through the above steps, Agrobacterium GV3101 containing 35S::TB1-E3TCD1, 35S::E3TCD1, and 35S::TB1-mYFP vectors was obtained. The Agrobacterium containing the constructed vector was picked into 3 ml LB medium containing Kana antibiotics and cultured in a shaker at 28°C and 200 rpm for 18 hours. (OD 600 About 1.0-2.0)

[0122] Take 100ul of bacterial solution and centrifuge at 6000rpm for 5min at room temperature to collect the bacteria. Resuspend the bacteria in 2mL of impregnation solution (containing 10mM MgCl2, 10mM MES, 150μM acetosyringone (AS), pH=5.6). Then let it stand at room temperature for 2-3h. (At least 0.5h, no more than 3h.)

[0123] Use a needle without a needle to draw up the bacterial solution, and co-inject 35S::TB1-E3TCD1 and 35S::TB1-mYFP into tobacco leaves, and use co-injection of 35S::E3TCD1 and 35S::TB1-mYFP as a control. Use a marker to mark the water-stained area of ​​the tobacco leaves.

[0124] After the injected plants were cultured at about 21°C for 36-48 h, protein immunoblotting was performed to determine the protein content of TB1.

[0125] 2. Western-blot

[0126] Western blotting was performed to analyze TB1 protein expression using anti-YFP as the primary antibody. The specific steps include:

[0127] 1) Sample processing

[0128] 0.1 g of the injected tobacco leaves were ground, and 100 ul of sample buffer (Loading buffer) was added to each of the experimental group and the control group, mixed well, and then boiled in a water bath for 5 min and cooled for later use.

[0129] 2) Protein component separation by SDS-PAGE electrophoresis

[0130] Electrophoresis was performed using 5% concentrated gel and 10% separation gel. The specific steps were as per the Molecular Cloning, Experiment Manual. For ease of comparison, the same volume of each sample was used for electrophoresis.

[0131] 3) Transfer and antibody reaction

[0132] After the electrophoresis is finished, remove the gel and wash it with water. At the same time, soak the nitrocellulose membrane (NC) and filter paper in transfer buffer for 5 minutes, lay the gel and NC membrane in the order of cathode-sponge-filter paper-gel-NC membrane-filter paper-sponge-anode, put them into the electrophoresis tank, and electrophoresed for 3 hours at 88V voltage and low temperature. Take out the NC membrane and wash it with 1×TBST (TBS with % Tween-20) for 5 minutes, add TBST blocking buffer containing 5% skim milk powder, and incubate at 37℃ for 2 hours. Wash the NC membrane 3 times with TBST, each time for 10 minutes. Add mouse anti-YFP (1:500 PBST dilution) and incubate at 37℃ for 2 hours. Wash the NC membrane 3-5 times with TBST, each time for 10 minutes. Add HRP-labeled goat anti-mouse IgG antibody (TBST 1:3000 dilution), incubate at 37℃ for 1 hour, and wash the NC membrane 3-5 times with TBST, each time for 10 minutes. Add DAB color developing solution (for specific formula, see "Molecular Cloning, Experimental Manual"), develop color at room temperature in the dark for 5-10 minutes, wash the NC membrane with clean water, observe and record the results.

[0133] We observed that after co-expression of TB1-E3TCD1 and TB1-mYFP, the protein content of TB1-mYFP decreased, indicating that TB1-E3TCD1 can degrade TB1. (See Figure 3 b,c)

[0134] 3. The number of tillers in 35S::TB1-E3TCD1 transgenic rice increased significantly

[0135] 1. Obtaining genetically modified rice

[0136] The Agrobacterium EHA105 containing 35S::TB1-E3TCD1 and 35S::E3TCD1 vector obtained in step 1 above was sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice transformation. The rice variety we used was Zhonghua 11 (ZH11). After obtaining transgenic rice, we first screened transgenic positive plants. After confirming the positive transgenic plants, we planted them at the Huashan Rice Experimental Base of Wuhan University.

[0137] 2. Phenotypic observation of transgenic rice

[0138] The above-mentioned transgenic rice grows in a natural environment and the management measures are the same as those in the field.

[0139] We observed no significant difference in tiller number between ZH11 and 35S::E3TCD1 control lines. This suggests that the autodegradation properties of E3TCD1 can prevent negative effects on plant growth. Compared with the 35S::E3TCD1 transgenic, the 35S::TB1-E3TCD1 transgenic showed an increase in tiller number, consistent with the phenotype of plants with TB1 DNA mutations reported in the literature. (See Figure 3 d,e)

[0140] Example 2: TCD method can target and degrade rice ELF3-1 to delay rice flowering

[0141] 1. Construction of OsELF3-1-E3TCD1 vector

[0142] 1. Design and synthesis of primers

[0143] Download the OsELF3-1 genome sequence from the Rice Genome Annotation Project website, design specific amplification primers, and use the total cDNA of Zhonghua 11 (ZH11) as a template to amplify the OsELF3-1 gene fragment. In our previous study, we have screened and verified E3TCD1 in the TCD method system and successfully constructed the 35S::E3TCD1 plasmid vector. Since our vector construction system uses the LIC connection method, we added LIC sequence linkers CGACGACAAGACCGT ACC and GAGGAGAAGAGCCGTGC to the 5′ ends of the upstream and downstream primer fragments used for amplification. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The sequences and numbers of each primer are as follows:

[0144] Upstream primer OLM707

[0145] 5′--3′:CGA CGA CAA GAC CGT ACC ATGGCGACGAGGGGAGGAGG (SEQ ID NO.45);

[0146] Downstream primer OLM708

[0147] 5′--3′:GA GGA GAA GAG CCG TGC ATCATCTCGTTGCCGTTCCATTTG (SEQ ID NO. 46);

[0148] 2. PCR amplification

[0149] Using the cDNA of ZH11 as a template and the primers synthesized in step 1, PCR amplified the OsELF3-1 fragment. The amplification reaction system and specific reaction conditions are as follows:

[0150]

[0151] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min; and 72°C for 5 min.

[0152] The amplified PCR product was detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.

[0153] 3. Target fragment and vector LIC treatment

[0154] The target fragment recovered in step 2 is subjected to LIC treatment, and the specific reaction system and steps are as follows:

[0155]

[0156]

[0157] The above components were mixed using a pipette and the following reactions were performed on a PCR thermal cycler: 12°C for 30 min, 75°C for 10 min.

[0158] The 35S::E3TCD1 vector constructed in the previous study was treated with LIC. The specific reaction system and steps are as follows:

[0159]

[0160] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12°C for 40 min, 75°C for 10 min.

[0161] 4. Construction of 35S::OsELF3-1-E3TCD1 vector

[0162] Take out 1.5ul of the vector and target fragment treated with LIC in step 3, mix well, and place in a PCR thermal cycler for reaction: 75℃ for 5min, 22℃ for 5min.

[0163] Transfer the above 3ul ligation product to 30ul supercompetent E. coli DN5α, flick it 3-5 times with your finger, and then let it stand on ice for 20-30min. After standing, put it in 42℃ heat shock for 1min, and immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it, and resuscitate it in a shaker at 220rpm and 37℃ for 45-60min. Precipitate E. coli at 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in a 37℃ incubator overnight.

[0164] The next day, eight colonies were streaked onto new plates and colony PCR was performed in the afternoon. A positive colony was selected for sequencing. After the sequencing results were correct, the plasmid was returned from the company for Agrobacterium transformation.

[0165] The plasmid containing 35S::OsELF3-1-E3TCD1 was transferred into Agrobacterium GV3101 (for tobacco injection and other related experiments) and Agrobacterium EHA105 (for obtaining rice transgenic plants).

[0166] The specific steps of Agrobacterium transformation are as follows: transfer the above 3ul plasmid to 30ul supercompetent Agrobacterium GV3101 or EHA105, flick it with your finger 3-5 times, and then let it stand on ice for 10min. First put it in liquid nitrogen to freeze for 1min, then put it in 42℃ heat shock for 1min, and then immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it and revive it in a shaker at 220rpm and 28℃ for 45-60min. Precipitate Agrobacterium at 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in an incubator at 28℃ for two days. Pick the Agrobacterium colony, shake the bacteria, and mix it with 50% glycerol at a ratio of 1:1 and store it in a refrigerator at -80℃.

[0167] 2. Heterologous expression of 35S::OsELF3-1-E3TCD1 in tobacco can effectively degrade OsELF3-1

[0168] 1. Tobacco injection

[0169] Nicotiana benthamiana tobacco was grown in a greenhouse under the following conditions: 14 h light / 10 h dark, 25°C, 70% relative humidity; the tobacco was ready for injection after approximately 4 to 5 weeks of cultivation.

[0170] Through the above steps, Agrobacterium GV3101 containing 35S::OsELF3-1-E3TCD1, 35S::E3TCD1, 35S::OsELF3-1-mYFP vectors was obtained. The Agrobacterium containing the constructed vector was picked into 3 ml LB medium containing Kana antibiotics and cultured in a shaker at 28°C and 200 rpm for 18 hours. (OD600 is about 1.0-2.0).

[0171] Take 100ul of bacterial solution and centrifuge at 6000rpm for 5min at room temperature to collect the bacteria. Resuspend the bacteria in 2mL of impregnation solution (containing 10mM MgCl2, 10mM MES, 150μM acetosyringone (AS), pH=5.6). Then let it stand at room temperature for 2-3h. (At least 0.5h, no more than 3h.)

[0172] Use a needle without a needle to draw up the bacterial solution, co-inject 35S::OsELF3-1-E3TCD1 and 35S::OsELF3-1-mYFP into tobacco leaves, and use co-injection of 35S::E3TCD1 and 35S::OsELF3-1-mYFP as a control. Use a marker to mark the water-stained area of ​​the tobacco leaves.

[0173] After the injected plants were cultured at about 21°C for 36-48 h, protein immunoblotting was performed to determine the protein content of OsELF3-1.

[0174] 2. Western-blot

[0175] Western blotting was performed to analyze the expression of OsELF3-1 protein using anti-YFP as the primary antibody. The specific steps include:

[0176] (1) Sample processing

[0177] 0.1 g of the injected tobacco leaves were ground, and 100 ul of sample buffer (Loading buffer) was added to each of the experimental group and the control group, mixed well, and then boiled in a water bath for 5 min and cooled for later use.

[0178] (2) SDS-PAGE electrophoresis separation of protein components

[0179] Electrophoresis was performed using 5% concentrated gel and 10% separation gel. The specific steps were as per the Molecular Cloning, Experiment Manual. For ease of comparison, the same volume of each sample was used for electrophoresis.

[0180] (3) Membrane transfer and antibody reaction

[0181] After the electrophoresis is finished, remove the gel and wash it with water. At the same time, soak the nitrocellulose membrane (NC) and filter paper in transfer buffer for 5 minutes, lay the gel and NC membrane in the order of cathode-sponge-filter paper-gel-NC membrane-filter paper-sponge-anode, put them into the electrophoresis tank, and electrophoresed for 3 hours at 88V voltage and low temperature. Take out the NC membrane and wash it with 1×TBST (TBS with % Tween-20) for 5 minutes, add TBST blocking buffer containing 5% skim milk powder, and incubate at 37℃ for 2 hours. Wash the NC membrane 3 times with TBST, each time for 10 minutes. Add mouse anti-YFP (1:500 PBST dilution) and incubate at 37℃ for 2 hours. Wash the NC membrane 3-5 times with TBST, each time for 10 minutes. Add HRP-labeled goat anti-mouse IgG antibody (TBST 1:3000 dilution), incubate at 37℃ for 1 hour, and wash the NC membrane 3-5 times with TBST, each time for 10 minutes. Add DAB color developing solution (for specific formula, see "Molecular Cloning, Experimental Manual"), develop color at room temperature in the dark for 5-10 minutes, wash the NC membrane with clean water, observe and record the results.

[0182] We observed that co-expression of OsELF3-1-E3TCD1 and OsELF3-1-mYFP could reduce the aggregation of OsELF3-1-mYFP, indicating that OsELF3-1-E3TCD1 could degrade OsELF3-1. Figure 4 a,b)

[0183] 3. Delayed flowering of 35S::OsELF3-1-E3TCD1 transgenic rice

[0184] 1. Obtaining genetically modified rice

[0185] The Agrobacterium EHA105 containing 35S::OsELF3-1-E3TCD1 and 35S::E3TCD1 vectors obtained in the above steps was sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice transformation. The rice variety we used was Zhonghua 11 (ZH11). After obtaining transgenic rice, we first screened transgenic positive plants. After confirming the positive transgenic plants, we planted them at the Huashan Rice Experimental Base of Wuhan University.

[0186] 2. Phenotypic observation of transgenic rice

[0187] The above-mentioned transgenic rice grows in a natural environment and the management measures are the same as those in the field.

[0188] We observed that flowering of 35S::OsELF3-1-E3TCD1 transgenic rice was significantly delayed compared with that of 35S::E3TCD1 control line ( Figure 4 c,d).

[0189] Example 3: Temperature-responsive promoter regulation and targeted degradation of rice ELF3-1 can improve rice fruit setting rate

[0190] 1. Build Pro HSP1 ::OsELF3-1-E3TCD1 vector

[0191] 1. Design and synthesis of primers

[0192] Download the HSP1 promoter sequence from the Rice Genome Annotation Project website, design specific amplification primers, and use the genome of Zhonghua 11 (ZH11) as a template to amplify the HSP1 promoter fragment. Previous studies have successfully constructed the 35S::OsELF3-1-E3TCD1 plasmid vector (see Example 1). In view of the LIC connection method used in our vector construction system, we used Ecor1 and Kpn1 double enzyme digestion to replace 35S with the LIC sequence tcgacgacaagaccgggcccggctcttctcctca. We added LIC sequence linkers CGACGACAAGACCGT and GAGGAGAAGAGCCGT to the 5′ ends of the upstream and downstream primer fragments used for amplification. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the sequences and numbers of each primer are as follows:

[0193] Upstream primer HSP1-F

[0194] 5′--3′:CGA CGA CAA GAC CGT GGTGGCAAAGAAAGAGGTTGGTTTA (SEQ ID NO. 19);

[0195] Downstream primer HSP1-R

[0196] 5′--3′:GA GGA GAA GAG CCGT GCTCGGTGGGAGGAGGGGTTTAAAT (SEQ ID NO. 20);

[0197] 2. PCR amplification

[0198] Using the genomic DNA of ZH11 as a template and the primers synthesized in step 1, PCR amplified the HSP promoter fragment. The amplification reaction system and specific reaction conditions are as follows:

[0199]

[0200] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min; and 72°C for 5 min.

[0201] The amplified PCR product was detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.

[0202] 3. Target fragment and vector LIC treatment

[0203] The target fragment recovered in step 2 is subjected to LIC treatment, and the specific reaction system and steps are as follows:

[0204]

[0205] The above components were mixed using a pipette and the following reactions were performed on a PCR thermal cycler: 12°C for 30 min, 75°C for 10 min.

[0206] The Pro::OsELF3-1-E3TCD1 vector constructed in the previous study was treated with LIC. The specific reaction system and steps are as follows:

[0207]

[0208] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12°C for 40 min, 75°C for 10 min.

[0209] 4. Pro HSP ::OsELF3-1-E3TCD1 vector construction

[0210] Take out 1.5ul of the vector and target fragment treated with LIC in step 3, mix well, and place in a PCR thermal cycler for reaction: 75℃ for 5min, 22℃ for 5min.

[0211] Transfer the above 3ul ligation product to 30ul supercompetent E. coli DH5α, flick it 3-5 times with your finger, and then let it stand on ice for 20-30min. After standing, put it in 42℃ heat shock for 1min, and immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it, and resuscitate it in a shaker at 220rpm and 37℃ for 45-60min. Precipitate E. coli at 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in a 37℃ incubator overnight.

[0212] The next day, eight colonies were streaked onto new plates and colony PCR was performed in the afternoon. A positive colony was selected for sequencing. After the sequencing results were correct, the plasmid was returned from the company for Agrobacterium transformation.

[0213] Will contain Pro HSP The plasmid of ::OsELF3-1-E3TCD1 was transformed into Agrobacterium EHA105 (used to obtain transgenic rice plants).

[0214] The specific steps of Agrobacterium transformation are as follows: transfer the above 3ul plasmid to 30ul supercompetent Agrobacterium GV3101 or EHA105, flick it with your finger 3-5 times, and then let it stand on ice for 10min. First put it in liquid nitrogen to freeze for 1min, then put it in 42℃ heat shock for 1min, and then immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it and revive it in a shaker at 220rpm and 28℃ for 45-60min. Precipitate Agrobacterium at 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in an incubator at 28℃ for two days. Pick the Agrobacterium colony, shake the bacteria, and mix it with 50% glycerol at a ratio of 1:1 and store it in a refrigerator at -80℃.

[0215] 2. Pro HSP ::OsELF3-1-E3TCD1 transgenic rice has delayed flowering

[0216] 1. Obtaining genetically modified rice

[0217] The Pro HSP Agrobacterium EHA105 carrying the ::OsELF3-1-E3TCD1 vector was sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice transformation. The rice variety we used was Zhonghua 11 (ZH11). After obtaining transgenic rice, we first screened transgenic positive plants. After confirming the positive transgenic plants, we planted them at the Huashan Rice Experimental Base of Wuhan University.

[0218] 2. Phenotypic observation of transgenic rice

[0219] The above-mentioned transgenic rice grows in a natural environment and the management measures are the same as those in the field.

[0220] We observed that compared with the ZH11 control line, Pro HSP :: The flowering of OsELF3-1-E3TCD1 transgenic rice was significantly delayed, and the fruiting rate was significantly increased ( Figure 5 c,e,f).

[0221] Example 4: TCD method can target and degrade Hela cell OCT4 protein

[0222] 1. Construction of OCT4-EGFP and OCT4-E3TCD1 vectors

[0223] 1. Primer Design and Synthesis

[0224] Download the OCT4 genome sequence from the NCBI website, design specific amplification primers, and use the total cDNA of Hela cells as a template to amplify the OCT4 gene fragment. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The sequences and numbers of each primer are as follows:

[0225] Upstream primer OLM1132:

[0226] 5′--3′:CGA CGA CAA GAC CGT ACC ATGGCGGGACACCTGGCTTC (SEQ ID NO.58);

[0227] Downstream primer OLM1133:

[0228] 5′--3′:gaggagaagagccgtagaccctccgcc GTTTGAATGCATGGGAGAGCC

[0229] (SEQ ID NO.59);

[0230] 2. PCR Amplification

[0231] Using the total cDNA of Hela cells as a template and the primers synthesized in step 1, PCR amplified the OCT4 fragment. The amplification reaction system and specific reaction conditions are as follows:

[0232]

[0233] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 56°C for 30 sec, and 72°C for 2 min; and 72°C for 5 min.

[0234] The amplified PCR product was detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified using a gel recovery kit.

[0235] 3. LIC treatment of target fragment and vector

[0236] The target fragment recovered in step 2 is subjected to LIC treatment, and the specific reaction system and steps are as follows:

[0237]

[0238]

[0239] The above components were mixed using a pipette and the following reactions were performed on a PCR thermal cycler: 12°C for 30 min, 75°C for 10 min.

[0240] The CMV promoter::EGF and PGK promoter::E3TCD1 vectors were treated with LIC. The specific reaction system and steps are as follows:

[0241]

[0242] Mix the above components with a pipette and perform the following reaction on a PCR thermal cycler: 12°C for 40 min, 75°C for 10 min.

[0243] Transfer the above 3ul ligation product to 30ul supercompetent E. coli DH5α, flick it 3-5 times with your finger, and then let it stand on ice for 20 to 30min. After standing, put it in 42℃ heat shock for 1min, and immediately transfer it to ice bath for 2min. Add 200ul of non-antibiotic LB to it, and resuscitate it in a shaker at 220rpm and 37℃ for 45-60min. Precipitate E. coli at 6000rpm for 2min, and evenly spread it on a culture dish with Kana resistance, and grow it in a 37℃ incubator overnight.

[0244] The next day, eight colonies were streaked onto new plates and colony PCR was performed in the afternoon. A positive colony was selected for sequencing, and plasmids were extracted after the sequencing results were confirmed.

[0245] 2. Expression of OCT4-E3TCD1 in Hela cells can effectively degrade OCT4-EGFP

[0246] Transfection of OCT4-EGFP and OCT4-E3TCD1 plasmids

[0247] 1 μg of OCT4-EGFP plasmid and 1 μg of OCT4-E3TCD1 plasmid were mixed and added to the prepared Hela cells and the invasion dye solution, and then the cells were cultured for 48 hours; Hela cells transformed with 1 μg of OCT4-EGFP plasmid alone were used as the control group. The fluorescence intensity of OCT4-EGFP protein was observed using a laser confocal microscope, and it was found that after co-expression of OCT4-E3TCD1 and OCT4-EGFP, the protein content of OCT4-EGFP decreased, indicating that OCT4-E3TCD1 can degrade OCT4. (See Figure 6 ).

[0248] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0249] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0250] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A fusion protein, characterized in that The fusion protein is composed of the protein of the target protein gene X and the E3TCD protein, and the structure of the fusion protein is shown in Formula I: The X is a target protein gene, i.e., a protein gene that needs to be degraded; the E3TCD protein is an E3 ligase with inherent disordered protein characteristics, which can achieve self-degradation through phase separation aggregation; the gene encoding the E3TCD protein includes one of the following: The E3TCD protein of Arabidopsis thaliana, referred to as AtE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.25; The rice E3TCD protein, referred to as OsE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.26; The E3TCD protein of maize, referred to as ZmE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.27; The E3TCD protein of wheat, referred to as TaE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.28; The soybean E3TCD protein, referred to as GmE3TCD1, has a nucleotide sequence as shown in SEQ ID NO.29; The Arabidopsis thaliana E3TCD2 protein, referred to as AtE3TCD2, has a nucleotide sequence as shown in SEQ ID NO.30; The Arabidopsis thaliana E3TCD3 protein, referred to as AtE3TCD3, has a nucleotide sequence as shown in SEQ ID NO.31; The Arabidopsis thaliana E3TCD4 protein, referred to as AtE3TCD4, has a nucleotide sequence as shown in SEQ ID NO.32; The E3TCD5 protein of Arabidopsis thaliana, referred to as AtE3TCD5, has a nucleotide sequence as shown in SEQ ID NO.

33.

2. A fusion protein according to claim 1, characterized in that: The gene encoding the E3TCD protein was obtained by PCR amplification using the following primer pair: 1) Primer pair AtP1, nucleotide sequence as shown in SEQ ID NO.1-SEQ ID NO.2; amplified a 2001 bp amplified fragment from Arabidopsis thaliana cDNA; 2) Primer pair OsP1, nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4; can amplify a 2004 bp amplified fragment from rice cDNA; 3) Primer pair ZmP1, nucleotide sequence as shown in SEQ ID NO.5-SEQ ID NO.6; can amplify a 1992 bp amplified fragment from corn cDNA; 4) Primer pair TaP1, nucleotide sequence as shown in SEQ ID NO.7-SEQ ID NO.8; can amplify a 2007 bp amplified fragment from wheat cDNA; 5) Primer pair GmP1, nucleotide sequence as shown in SEQ ID NO.9-SEQ ID NO.10; can amplify a 2148 bp amplified fragment from soybean cDNA; 6) Primer pair AtP2, nucleotide sequence as shown in SEQ ID NO.11-SEQ ID NO.12; amplified a 1485 bp amplified fragment from Arabidopsis thaliana cDNA; 7) Primer pair AtP3, nucleotide sequence as shown in SEQ ID NO.13-SEQ ID NO.14; amplified a 1461 bp amplified fragment from Arabidopsis thaliana cDNA; 8) Primer pair AtP4, nucleotide sequence as shown in SEQ ID NO.15-SEQ ID NO.16; amplified a 1038 bp amplified fragment from Arabidopsis thaliana cDNA; 9) Primer pair AtP5, nucleotide sequence as shown in SEQ ID NO.17-SEQ ID NO.18; a 996 bp amplified fragment was amplified from Arabidopsis thaliana cDNA.

3. A fusion protein according to claim 1, characterized in that: The target protein gene X is directly connected to the E3TCD protein or connected via a Linker.

4. A nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 3.

5. A recombinant vector containing the nucleic acid molecule according to claim 4. A transformant comprising the recombinant vector according to claim 5 .

7. A method for targeted degradation of plant endogenous protein aggregates, characterized in that: The method comprises: transferring the nucleic acid molecule of claim 4 or the recombinant vector of claim 5 into a plant by transient expression or transgenic method, thereby expressing the fusion protein of any one of claims 1 to 3, thereby achieving targeted degradation of plant endogenous protein aggregates.

8. Use of the fusion protein according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the recombinant vector according to claim 5 in improving plant traits.

9. Use of the fusion protein according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the recombinant vector according to claim 5 in the preparation of a product based on protein targeted degradation.

10. Use of the fusion protein according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the recombinant vector according to claim 5 in drug screening.

Images