Primer and kit for detecting STR region variation of fragile X syndrome related gene FMR1 and application
Through the preparation of long-segment high-GC PCR amplification and third-generation sequencing library, the problem of inaccurate detection of FMR1 STR regional mutations in the prior art is solved, and the precise detection of variants such as CGG expansion and AGG insertion is achieved, which is suitable for large-scale screening.
Patent Information
- Application Number
- CN202411980777.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-03-07
AI Technical Summary
The prior art cannot accurately detect STR regional variations in the fragile X syndrome-related gene FMR1, especially CGG repeated expansion and AGG insertion, resulting in incomplete detection coverage and insufficient accuracy.
The FMR1 STR region was amplified by long-fragment high GC PCR, and a third-generation sequencing library was prepared. The pre-mutation and total mutation caused by CGG expansion, AGG insertion in CGG repeats, and slight deletion in the 5’-UTR region were detected by PacBio sequencing.
The comprehensive, accurate and rapid detection of FMR1 STR regional variation is achieved, and the accuracy and coverage of detection is improved, which is suitable for large-scale carrier screening.
Smart Images
Figure CN119570926A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene detection, and in particular to a primer, a kit and an application thereof for detecting STR region variation of a fragile X syndrome-related gene FMR1. Background Art
[0002] Fragile X syndrome (FXS) is the most common single gene disease causing intellectual disability and autism spectrum disorder (ASD), caused by mutations in the FMR1 (fragile X messenger ribonucleoprotein 1) gene. About 99% of FXS cases are caused by dynamic expansion and abnormal methylation of the CGG repeat sequence in the 5' untranslated region of the FMR1 gene.
[0003] The causative gene of FXS and its related diseases, the FMR1 gene (OMIM 309550), is located at Xq27.3 and contains 17 exons. It encodes the fragile X mental retardation protein (FMRP), which is highly expressed mainly in the brain and testes. The degree of FMRP level decrease is positively correlated with the degree of cognitive impairment. The average number of CGG trinucleotide repeats in the 5' untranslated region of the FMR1 gene in the normal population is 30. When the number of CGG repeats is between 45 and 54, it is called an intermediate type; when the number of repeats is between 55 and 200, it is called a premutation; when the number of repeats is >200, it is called a full mutation, which causes methylation inactivation of the FMR1 gene, resulting in the inability to express FMRP and causing disease. The CGG repeat sequence has the risk of further expansion during meiosis and embryonic development (mitosis). Male premutation carriers usually do not expand to full mutations when passing on to female offspring, while female premutation carriers have the risk of expanding to full mutations when passing on to offspring.
[0004] At present, most of the tests for FXS carrier screening in my country first use PCR-capillary electrophoresis to detect the number of CGG repeats in the FMR1 gene. If the test result is a full mutation, or near the critical value between premutation and full mutation (200±30), Southern blotting and other methods can be used to determine the methylation status. However, PCR-capillary electrophoresis cannot confirm a higher number of CGG repeats due to the influence of the detection length; since CE can only infer the number of CGG repeats from the length of the PCR product, the accuracy of this method mainly depends on the accuracy of the standard selection, and the noise in the detection signal will also have an adverse effect on the result judgment. Southern blotting can reflect the size and methylation level of the CGG repeat fragment, but the resolution is low and it cannot accurately determine the number of repeats of intermediate and premutations, which is easy to cause errors and omissions. It is time-consuming and labor-intensive and is not suitable for large-scale carrier screening alone. Sanger sequencing and next-generation sequencing (NGS) cannot detect the repeat expansion of CGG in FXS. Summary of the invention
[0005] In view of the deficiencies of the above-mentioned prior art, the present invention aims to provide a primer, a kit and an application for detecting STR regional variation of the fragile X syndrome-related gene FMR1, which are used to detect premutation and full mutation caused by CGG expansion, AGG insertion in CGG repeat and small deletion in 5'-UTR region; solve the problems of incomplete coverage of FXS pathogenic gene detection at this stage, inability to accurately judge CGG repeat expansion and AGG insertion in CGG repeat; amplify the FMR1 STR region by long-fragment high GC PCR, and prepare a third-generation sequencing library at the same time, so as to achieve the goal of comprehensive, accurate and rapid detection of FXS STR regional mutations in multiple samples; at the same time, Pacbio sequencing has the characteristics of long sequence read length and small GC fragment content preference, and can detect tandem repeat sequence regions with multiple copies of long units.
[0006] In order to solve the above problems, the present invention adopts the following technical solutions:
[0007] In a first aspect, the present invention provides a primer for detecting STR region variation of the fragile X syndrome-related gene FMR1, comprising one or more pairs of primers with nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.30.
[0008] Furthermore, the 5' end of the primer includes a DNA barcode of different sequences of 5-50 nt.
[0009] Furthermore, the variation types of the Fragile X syndrome-related gene FMR1 STR region include at least one of the following variations: premutation and full mutation caused by CGG expansion, AGG insertion in CGG repeats, and small deletions in the 5'-UTR region.
[0010] In a second aspect, the present invention provides a kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1, the kit comprising an amplification system; the amplification system comprising the above-mentioned primers.
[0011] Furthermore, the upstream and downstream primers of the primers are both 10 μM and 1 volume part; the amplification system also includes 0.2 volume parts of 5U / μl Vazyme LAmp DNA Polymerase, 2 volume parts of 10×Vazyme LAmp Buffer, 0.4 volume parts of 10mM dATP, 0.4 volume parts of 10mM dTTP, 0.4 volume parts of 10mM dCTP, 0.8 volume parts of 5mM 7-Deaza-dGTP, 4 volume parts of PCR Enhancer, 5 volume parts of Q-Solution and enzyme-free water.
[0012] Furthermore, the kit also includes a library preparation system; the library preparation system includes 2.5 volumes of 20 μM adapters, 1 volume of 10×T4 DNA ligase buffer, 0.6 volumes of 10 mM ATP solution, 0.4 volumes of 10 mM dNTP, 0.25 volumes of T4 polynucleotide kinase, 0.25 volumes of T4 DNA polymerase, 0.3 volumes of T4 DNA ligase and 0.6 volumes of enzyme-free water.
[0013] Further, the high GCPCR amplification conditions of the amplification system are: 95°C, 5 min; 97°C, 35 s, 68°C and decrease by 1°C each cycle, 35 s, 68°C, 6 min, 10 cycles; 97°C, 35 s, 60°C, 35 s, 68°C, 6 min and increase by 20 s each cycle, 20 cycles; 68°C, 10 min; maintain at 4°C;
[0014] The PCR reaction conditions of the library preparation system are: 37°C, 20 min; 25°C, 15 min; 65°C, 10 min.
[0015] Furthermore, the sequencing library prepared by the library preparation system was sequenced using third-generation sequencing to obtain raw sequencing data. The original PacBio sequencing data was split according to specific index sequences using Lima software, and the data was accurately assigned to different samples. The sequencing data was compared with the reference genome using the Minimap2 tool to verify the accuracy of the sequencing data. Quality control and statistical analysis were performed on the sequencing data of the target region, including data volume, alignment rate, and fragment length distribution indicators. The BAM file was processed based on the bed coordinates of the FMR1 repeat region using the Trgt software to perform genotyping on the target tandem repeat sequence, analyze the composition of the repeat sequence, and count the number of repetitions. Based on the statistical results, the copy position with the highest mutation frequency was obtained, and the mutation type and repeat copy number of the FMR1 STR region mutation were determined based on the copy position with the highest mutation frequency, and compared with the known clinical pathogenic-related repeat copy number to determine the positive and negative nature of the sample.
[0016] In a third aspect, the present invention provides a method for detecting non-disease diagnosis purposes of STR regional variation of fragile X syndrome-related gene FMR1, comprising preparing a sequencing library using the above-mentioned kit, sequencing and analyzing the sequencing library using third-generation sequencing, and determining the positive or negative nature of the sample by comparing the mutation type and the number of repeated copies of the copy position with the highest analyzed variation frequency with the known number of repeated copies associated with clinical pathogenicity.
[0017] In a fourth aspect, the present invention provides the use of the above-mentioned primers for detecting STR regional variation of the fragile X syndrome-related gene FMR1 or the above-mentioned kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1 in preparing a detection reagent for fragile X syndrome.
[0018] The beneficial effects of the present invention are:
[0019] The method of the present invention is easy to operate, and the long-fragment high-GC PCR and third-generation library have reliable quality and strong repeatability, which is conducive to the application of third-generation sequencing technology in clinical detection.
[0020] It can detect mutations that cannot be detected by the second generation: Since the FMR1 STR region has the characteristics of high GC repeats, long-fragment amplification is difficult, and both the first-generation and second-generation sequencing cannot accurately detect the mutation type. The present invention specifically amplifies the FMR1 STR region and then uses long-fragment sequencing to accurately detect not only the premutation and full mutation caused by CGG expansion, but also the AGG insertion in the CGG repeat and the tiny deletion in the 5'-UTR region.
[0021] High-throughput detection: The third-generation sequencing can realize 384 kinds of barcode DNA barcodes. In fact, more barcode DNA barcodes can be designed according to needs; or a dual barcode system with primer barcodes and adapter barcodes can be used to achieve more barcode combinations. The high-throughput characteristics of the third-generation sequencing platform determine that high-throughput sample detection can be achieved.
[0022] High accuracy: PacBio's dumbbell-shaped library can be read multiple times during sequencing, and the base accuracy of the sequencing results after correction is greater than 99%. In addition, PacBio sequencing errors are random, and the base accuracy is greater than 99.9% after sequencing depth correction. Therefore, gene mutations within the primer detection range can be accurately read.
[0023] Accurate typing: The copy position with the highest mutation frequency is obtained, and the mutation type of the FMR1 STR regional variation is determined according to the copy position with the highest mutation frequency. The FMR1 STR regional variation and position can be accurately determined. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is a comparison chart of the results of 9 different amplification methods in Example 2 of the present invention.
[0025] Figure 2 This is a graph showing the agarose gel electrophoresis results of some samples in Example 2 of the present invention. DETAILED DESCRIPTION
[0026] The present invention is further described in detail below in conjunction with specific embodiments.
[0027] It should be noted that these embodiments are only used to illustrate the present invention rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention all fall within the scope of protection claimed by the present invention.
[0028] Example 1 FMR1 gene STR region variation detection process
[0029] 1. Genomic DNA Extraction
[0030] 1. Collect 10mL of peripheral blood from each patient using EDTA anticoagulation tube;
[0031] 2. Genomic DNA Extraction
[0032] The peripheral blood of the subject obtained in step 1 was extracted using MagAttract HMW DNA Kit (Qiagen, 67563) to obtain gDNA, and the concentration was measured and the integrity of the genomic DNA (greater than 50 kb) was detected by agarose gel electrophoresis.
[0033] 2. High GC PCR Amplification
[0034] High GC PCR reaction system was prepared according to 9 different amplification methods to amplify peripheral blood genomic DNA samples.
[0035] The PCR reaction system for the first amplification is shown in Table 1.
[0036] Table 1 Reaction system preparation
[0037]
[0038] Amplify on a PCR instrument according to the conditions shown in Table 2.
[0039] Table 2 PCR program
[0040]
[0041] The PCR reaction system for the second amplification is shown in Table 3.
[0042] Table 3 Reaction system preparation
[0043]
[0044] Amplify on a PCR instrument according to the conditions shown in Table 4.
[0045] Table 4 PCR program
[0046]
[0047] The PCR reaction system for the third amplification is shown in Table 5.
[0048] Table 5 Reaction system preparation
[0049]
[0050] Amplify on a PCR instrument according to the conditions shown in Table 6.
[0051] Table 6 PCR program
[0052]
[0053] The PCR reaction system for the fourth amplification is shown in Table 7.
[0054] Table 7 Reaction system preparation
[0055]
[0056]
[0057] Amplify on a PCR instrument according to the conditions shown in Table 8.
[0058] Table 8 PCR program
[0059]
[0060] The PCR reaction system for the fifth amplification is shown in Table 9.
[0061] Table 9 Reaction system preparation
[0062]
[0063] Amplify on a PCR instrument according to the conditions shown in Table 10.
[0064] Table 10 PCR program
[0065]
[0066] The PCR reaction system for the sixth amplification is shown in Table 11.
[0067] Table 11 Reaction system preparation
[0068]
[0069] Amplify on a PCR instrument according to the conditions shown in Table 12.
[0070] Table 12 PCR program
[0071]
[0072] The PCR reaction system for the seventh amplification is shown in Table 13.
[0073] Table 13 Reaction system preparation
[0074]
[0075] Amplify on a PCR instrument according to the conditions shown in Table 14.
[0076] Table 14 PCR program
[0077]
[0078]
[0079] The PCR reaction system for the 8th amplification is shown in Table 15.
[0080] Table 15 Reaction system preparation
[0081]
[0082] Amplify on a PCR instrument according to the conditions shown in Table 16.
[0083] Table 16 PCR program
[0084]
[0085] The PCR reaction system for the 9th amplification is shown in Table 17.
[0086] Table 17 Reaction system preparation
[0087]
[0088]
[0089] Amplify on a PCR instrument according to the conditions shown in Table 18.
[0090] Table 18 PCR program
[0091]
[0092] The nucleotide sequences of the primers used in the present invention are as follows.
[0093] Primer 1F: CCAGCAGCAACATCCTCTCA (SEQ ID NO. 1);
[0094] Primer 1R: AAACGCGGGGTTACCTTTTG (SEQ ID NO. 2).
[0095] Primer 2F: ACAGCTTACACTTGGAGGGG (SEQ ID NO. 3);
[0096] Primer 2R: CCTTCCACACGCACCTTCTAT (SEQ ID NO. 4). Primer 3F: AGTGCATCACAGGTTCAGGG (SEQ ID NO. 5);
[0097] Primer 3R: TAACAAAAAGGGGGACGCGA (SEQ ID NO. 6). Primer 4F: ACAGGTTGAGTTGTGGCTTGT (SEQ ID NO.7);
[0098] Primer 4R: TGCCGACTACCGCTTCTTAC (SEQ ID NO. 8).
[0099] Primer 5F: AGATGCCCGATCAGTAGGGA (SEQ ID NO. 9);
[0100] Primer 5R: ACACGCACCTTCTATTGCCA (SEQ ID NO.10). Primer 6F: TCAGGGAGTTGGCAGTAACC (SEQ ID NO.11); Primer 6R: CACACGCACCTTCTATTGCC (SEQ ID NO.12). Primer 7F: AGGACGCATGACTGCTACAC (SEQ ID NO.13); Primer 7R: AGTAGTGGCTCTGGTGATCG (SEQ ID NO.14). Primer 8F: GCAGTAACCTAGATGCCCGA (SEQ ID NO.15); Primer 8R: GCCAAACGTGTCCTGTCTGA (SEQ ID NO.16). Primer 9F: GACAGGACGCATGACTGCTA (SEQ ID NO.17); Primer 9R: AAGTAGTGGCTCTGGTGATCG (SEQ ID NO.18). Primer 10F: GCACACGATAGATGCTCCGT (SEQ ID NO. 19); Primer 10R: ACACTTCTCCACAGCAGTTCA (SEQ ID NO. 20). Primer 11F: CCCCTATTCTCGCCTTCCAC (SEQ ID NO. 21); Primer 11R: CCACAACTACCCACACGACA (SEQ ID NO. 22). Primer 12F: CACCCCTATTCTCGCCTTCC (SEQ ID NO. 23); Primer 12R: CCCGCTGGGAGATGATGTTT (SEQ ID NO. 24). Primer 13F: ACAGGACGCATGACTGCTAC (SEQ ID NO. 25); Primer 13R: GTGCCGACTACCGCTTCTTA (SEQ ID NO. 26). Primer 14F: CTTCTGCCTCTACGGGTCAC (SEQ ID NO. 27); Primer 14R: AATAAGCCATCGCCGTCACT (SEQ ID NO. 28). Primer 15F: CTACACACGTGTTCACCCCA (SEQ ID NO. 29);
[0101] Primer 15R: AAGAGAACCCTCTCCTCGCT (SEQ ID NO. 30).
[0102] The 5' end of the primer includes a DNA barcode of different sequences of 5-50 nt. The DNA barcode is a barcode designed by PacBio or a self-designed barcode, and those skilled in the art can select one according to their needs.
[0103] After amplification, 5ul of each sample was taken and tested on a 1% DNA gel.
[0104] 3. Construction of PacBio sequencing library
[0105] Prepare the reaction system according to Table 19.
[0106] Table 19 Reaction system configuration
[0107]
[0108] The reaction was carried out on a PCR instrument under the following conditions: 37°C, 20 min; 25°C, 15 min; 65°C, 10 min.
[0109] After the reaction is completed, add 0.5μL Exonuclease III (NEB, Cat#M0206L) and 0.5μL Exonuclease VII (NEB, Cat#M0379L) and continue to react at 37°C for 1 hour. Purify twice with 0.6x Ampure PB magnetic beads (PacBio, Cat#100-265-900) according to the manufacturer's instructions, and finally elute the DNA with 10uL Elution Buffer. The resulting DNA eluate is the target DNA PacBio sequencing library. The DNA concentration is determined on Qubit 3Fluoromter (ThermoFisher, Cat#Q33216) using Qubit dsDNA HS reagent (ThermoFisher, Cat#Q32851). When there are multiple sample PacBio sequencing libraries, equal amounts of libraries can be mixed together to prepare a mixed library.
[0110] 4. PacBio sequencing and analysis method development
[0111] According to the total concentration and molar concentration of the library, an appropriate volume of the library was reacted with binding reagents (PacBio, Cat#101-820-200) and primers (PacBio, Cat#100-970-100) to prepare the final machine-ready library.
[0112] The specific analysis method is as follows:
[0113] 1) PacBio sequencing data allocation through Lima software: Lima software is used to split the original PacBio sequencing data according to a specific index sequence (Index), and the data is accurately allocated to different samples to ensure the independence and accuracy of the data of each sample.
[0114] 2) Use Minimap2 for alignment operation: The cleaned sample data (called "cleandata") is aligned with the reference genome (such as hg38) through the Minimap2 tool to verify the accuracy of the sequencing data and ensure the consistency and reliability of the obtained data with the reference genome.
[0115] 3) Data quality control and statistical analysis: The technology involved in the present invention also includes comprehensive quality control and statistical analysis of the sequencing data of the target region to evaluate the quality and reliability of the data. The analysis content includes but is not limited to key quality indicators such as data volume, alignment rate, and fragment length distribution.
[0116] 4) Trgt software processing and analysis of tandem repeats: Based on the Trgt software, the BAM file is processed through the bed coordinates of the FMR1 repeat region, the target tandem repeat sequence is genotyped, the composition of the repeat sequence is analyzed, and the number of repeats is counted.
[0117] 5) Used to obtain the copy position with the highest mutation frequency based on the statistical results, determine the mutation type and repeat copy number of the FMR1 STR region mutation based on the copy position with the highest mutation frequency, and compare it with the clinical pathogenic repeat sequence: By comparing the analyzed repeat copy number with the known clinical pathogenic related repeat copy number, the positive and negative status of the sample can be further determined, and an auxiliary basis for clinical diagnosis can be provided.
[0118] The third generation sequencing is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of Oxford Nanopore Technologies.
[0119] Example 2 Determining the STR region mutation of the fragile X syndrome-related gene FMR1 using the method of Example 1
[0120] The same positive sample (FMR1 CGG expansion number>200) was tested using 9 different amplification methods to determine the optimal amplification conditions for CGG expansion number>200. The test results are as follows Figure 1 As shown, the results show that amplification method 9 has the best amplification effect.
[0121] Different positive samples were tested using amplification method 9. The agarose gel electrophoresis results of some samples are shown in Figure 2 The detection results are shown in Table 20: Compared with CE and Sanger sequencing, for alleles with CGG repeat numbers > 200, the present invention can accurately detect the CGG repeat numbers.
[0122] Table 20 Pacbio sequencing analysis results of 13 samples
[0123]
[0124] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.
Claims
1. A primer for detecting STR region variation of the fragile X syndrome-related gene FMR1, characterized in that: One or more pairs of primers comprising the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.
30.
2. The primer for detecting STR region variation of the fragile X syndrome-related gene FMR1 according to claim 1, characterized in that: The 5' end of the primer includes a DNA barcode of different sequences of 5-50 nt.
3. The primer for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to claim 1, characterized in that: The variation types in the Fragile X syndrome-related gene FMR1 STR region include at least one of premutation and full mutation caused by CGG expansion, AGG insertion in CGG repeats, and minor deletion variation in the 5'-UTR region.
4. A kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1, characterized in that: The kit comprises an amplification system; the amplification system comprises the primers described in any one of claims 1-3.
5. The kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to claim 4, characterized in that: The upstream and downstream primers of the primers are both 10 μM and 1 volume part; the amplification system also includes 0.2 volume parts of 5U / μl Vazyme LAmp DNA Polymerase, 2 volume parts of 10×Vazyme LAmp Buffer, 0.4 volume parts of 10mM dATP, 0.4 volume parts of 10mM dTTP, 0.4 volume parts of 10mM dCTP, 0.8 volume parts of 5mM 7-Deaza-dGTP, 4 volume parts of PCR Enhancer, 5 volume parts of Q-Solution and enzyme-free water.
6. The kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to claim 5, characterized in that: The kit also includes a library preparation system; the library preparation system includes 2.5 volumes of a 20 μM adapter, 1 volume of a 10×T4 DNA ligase buffer, 0.6 volumes of a 10 mM ATP solution, 0.4 volumes of a 10 mM dNTP, 0.25 volumes of T4 polynucleotide kinase, 0.25 volumes of T4 DNA polymerase, 0.3 volumes of T4 DNA ligase, and 0.6 volumes of enzyme-free water.
7. The kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to claim 6, characterized in that: The high GC PCR amplification conditions of the amplification system are: 95°C, 5 min; 97°C, 35 s, 68°C with a decrease of 1°C each cycle, 35 s, 68°C, 6 min, 10 cycles; 97°C, 35 s, 60°C, 35 s, 68°C, 6 min with an increase of 20 s each cycle, 20 cycles; 68°C, 10 min; 4°C hold; The PCR reaction conditions of the library preparation system are: 37°C, 20 min; 25°C, 15 min; 65°C, 10 min.
8. The kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to claim 7, characterized in that: The sequencing library prepared by the library preparation system was sequenced by third-generation sequencing to obtain the raw sequencing data. The original PacBio sequencing data was split according to the index sequence using Lima software, and the data was accurately assigned to different samples. The sequencing data was compared with the reference genome using the Minimap2 tool to verify the accuracy of the sequencing data. The sequencing data of the target region was quality controlled and statistically analyzed, including data volume, alignment rate, and fragment length distribution indicators. The BAM file was processed based on the bed coordinates of the FMR1 repeat region using the Trgt software to perform genotyping on the target tandem repeat sequence, analyze the composition of the repeat sequence, and count the number of repeats. Based on the statistical results, the copy position with the highest mutation frequency was obtained, and the mutation type and repeat copy number of the FMR1 STR region mutation were determined based on the copy position with the highest mutation frequency, and compared with the known clinical pathogenic-related repeat copy number to determine the positive and negative of the sample.
9. A method for detecting non-disease diagnosis purposes of STR region variation of fragile X syndrome-related gene FMR1, characterized in that: The method comprises preparing a sequencing library using the kit described in any one of claims 4 to 8, performing sequencing analysis on the sequencing library using third-generation sequencing, and determining the positive or negative nature of the sample by comparing the mutation type and the number of repeated copies of the copy position with the highest mutation frequency analyzed with the known clinical pathogenic related repeated copy numbers.
10. Use of the primers for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to any one of claims 1 to 3 or the kit for detecting STR regional variation of the fragile X syndrome-related gene FMR1 according to any one of claims 4 to 8 in the preparation of a detection reagent for fragile X syndrome.