Primer probe set for oviductus ranae medicinal material detection and oviductus ranae medicinal material detection method
By designing primer probe sets and TaqMan probes based on the COI gene sequence of toad oil, combined with fast real-time fluorescence quantitative PCR technology, the problem of difficulty in identifying toad oil in the existing technology is solved, and the identification effect of high specificity and high sensitivity is achieved, which is suitable for large-scale screening and rapid identification.
Patent Information
- Application Number
- CN202411898796.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-23
- Publication Date
- 2025-03-07
AI Technical Summary
The prior art is difficult to effectively identify toad oil, traditional methods are susceptible to human factors, environmental conditions or the medicinal materials themselves, and molecular identification methods such as DNA barcode and fluorescence quantitative PCR have problems such as cumbersome operation, high cost or poor specificity.
A primer probe set was designed, based on the COI gene sequence of toad oil and combined with the TaqMan probe, and a fast real-time fluorescence quantitative PCR identification method was established. The rapid and accurate identification of toad oil was achieved through primers COI-F and COI-R and probe COI-P.
It improves the specificity and sensitivity of the detection, can effectively eliminate interference from other mixed products, achieve accurate identification of toad oil, and is easy to operate, suitable for large-scale screening and rapid identification.
Smart Images
Figure CN119570946A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biological detection, and relates to a primer probe group for detecting toad oil medicinal materials and a toad oil medicinal material detection method. Background Art
[0002] Toad oil (Ranae oviductus) is obtained by collecting, processing and drying the oviduct of the female Chinese forest frog (Rana temporariachensinensis David), a species of the Ranidae family. It has the effects of nourishing the kidney and essence, nourishing yin and moistening the lungs. It is used for weakness after illness, fatigue, palpitations and insomnia, night sweats, tuberculosis and coughing up blood. It is a precious Chinese medicinal material that combines edible and medicinal uses. Due to various reasons, the supply of toad oil is in short supply, resulting in counterfeit products flooding the market. At present, the counterfeit toad oil on the market mainly includes four types: Heilongjiang forest frog oil, frog oil, toad oil, and bullfrog oil. Other types of counterfeit products are rare. The identification methods of toad oil included in the 2020 edition of the "Chinese Pharmacopoeia" are property identification, high-performance liquid chromatography identification, and expansion determination, but these methods are easily restricted by human factors, environmental conditions or the medicinal materials themselves. In practice, the identification of toad oil is still very difficult.
[0003] With the development of molecular pharmacognosy, molecular identification technology has been continuously applied in the identification of toad oil medicinal materials, which has largely made up for the shortcomings of traditional identification methods. The currently established methods for molecular identification of toad oil mainly include DNA barcode technology, PCR-based molecular marker technology and fluorescence quantitative PCR technology. DNA barcodes and ordinary PCR require sequencing and electrophoresis detection, which are relatively cumbersome and costly; dye-based fluorescence quantitative PCR is easy to operate and has a low detection cost, but its specificity is not strong and is mainly used in the field of scientific research. Summary of the invention
[0004] The present invention provides a primer probe set for detecting toad oil medicinal materials and a toad oil medicinal material detection method. Primers and TaqMan probes are designed based on the toad oil COI gene sequence, and a toad oil rapid real-time fluorescence quantitative PCR identification method is established, in order to provide technical support for food, medicinal material markets, production enterprises, and regulatory authorities.
[0005] In a first aspect of the present invention, a primer-probe set for detecting toad oil medicinal materials is provided, comprising primers COI-F and COI-R and probe COI-P, wherein the nucleotide sequence of primer COI-F is shown in SEQ ID NO.1, the nucleotide sequence of primer COI-R is shown in SEQ ID NO.2, and the nucleotide sequence of probe COI-P is shown in SEQ ID NO.3.
[0006] The second aspect of the present invention provides a method for detecting toad oil medicinal materials based on the above primer probe set, comprising the following steps:
[0007] S1, extracting genomic DNA of the sample to be tested;
[0008] S2, using the genomic DNA of the sample to be tested extracted in step S1 as a test template, and using primers and probes to perform real-time fluorescence quantitative PCR amplification reaction on the test template;
[0009] S3, the method for judging whether the sample is toad oil is as follows: judging based on the CT value, if the CT value is less than or equal to 35, it is judged as positive, and if the sample CT value is greater than 35 or has no value, it is judged as negative.
[0010] Preferably, the reaction system for real-time fluorescence quantitative PCR amplification in step S2 is: TaqMan Universal Master MixⅡwith UNG 2μL, 10pmol·μL -1 0.5 μL each of primers COI-F and COI-R, 2 μL of template, and make up to 20 μL with sterile double-distilled water.
[0011] Preferably, the real-time fluorescence quantitative PCR amplification program in step S2 is: 50°C, 2 min, pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 62°C-64°C, 1 min to collect corresponding fluorescence.
[0012] Preferably, the above method further comprises establishing a standard curve for quantitative analysis, wherein the standard curve equation is: y=-3.4850x+24.439, R2=0.9996.
[0013] The third aspect of the present invention provides the use of the primer probe set for detecting the toad oil medicinal material in preparing a toad oil medicinal material detection kit.
[0014] By implementing the above technical solution, the present invention has the following beneficial effects:
[0015] 1. Enhanced specificity: Compared with the fluorescent dye method, the TaqMan probe method designs a specific probe based on the specific primer, which overcomes the problems of non-specific amplification and false positives caused by primer dimers in the fluorescent dye method. It has stronger specificity and is more suitable for the field of inspection and detection. After verification of the method specificity, it was found that the method can effectively eliminate the interference of other counterfeit products, and only produces specific amplification for toad oil samples, and no amplification of counterfeit products. This innovation significantly improves the accuracy of detection.
[0016] 2. Improved sensitivity: The minimum detection limit of the new method reaches 0.0005ng / μl, which means that even if there is a very small amount of toad oil DNA in the sample, it can be detected. Compared with traditional detection methods, this high sensitivity greatly enhances the ability to identify trace toad oil components.
[0017] 3. Wide linear range: The standard curve shows a good linear relationship (y = -3.4850x + 24.439, R2 = 0.9996), and the amplification efficiency is 93.636%, indicating that this method has a good linear relationship in a wide concentration range and is suitable for quantitative analysis.
[0018] 4. Optimized reaction conditions: By optimizing the PCR reaction conditions (such as annealing temperature, primer and probe dosage), the best reaction system and reaction conditions are established, making the test results more stable and reliable. This reduces the uncertainty caused by changes in reaction conditions and improves the reproducibility of the experiment.
[0019] 5. Simple and fast: Compared with traditional PCR and DNA barcode technology, real-time fluorescence quantitative PCR technology is easier to operate and has a faster detection speed. It reduces the time consumption required for electrophoresis separation, sequencing and other steps, and is more suitable for large-scale screening and rapid identification.
[0020] 6. By establishing a standard curve and conducting repeatability tests, the standardization of the entire detection process is ensured, and the reliability and operability of the method are improved. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Schematic diagram of the amplification results using universal primers lw01-F / lw01-R.
[0022] Figure 2 Schematic diagram of amplification results at different annealing temperatures.
[0023] Figure 3 Schematic diagram of amplification results under different primer and probe concentrations.
[0024] Figure 4 Schematic diagram of method specificity test results.
[0025] Figure 5 Schematic diagram of the standard curve.
[0026] Figure 6 This is a schematic diagram of the sensitivity test results.
[0027] Figure 7 Schematic diagram of the repeatability test results. DETAILED DESCRIPTION
[0028] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0029] The experimental methods in the following examples without specifying specific conditions are generally based on conventional conditions.
[0030] Example 1 Genomic DNA extraction and detection
[0031] 1. Materials and instruments
[0032] 1.1 Medicinal Materials The control medicinal materials of toad oil (batch number: 121484-200501) were purchased from the China Food and Drug Inspection Institute. At the same time, 10 batches of Chinese forest frogs, 5 batches of Heilongjiang forest frogs, 4 batches of black-spotted frogs, 4 batches of Chinese giant toads, and 3 batches of bullfrogs were collected from different origins. All the original animals were processed into toad oil, Heilongjiang forest frog oil, black-spotted frog oil, toad oil, and bullfrog oil according to traditional processing methods. The samples were collected from Jilin, Heilongjiang, Liaoning, Inner Mongolia, Shandong, Jiangsu, Hunan and other places. They were identified by Professor Wang Zhenyue of the Chinese Medicine Resources and Development Teaching and Research Office of Heilongjiang University of Chinese Medicine, and the voucher specimens were stored in the Harbin Drug and Medical Device Inspection and Testing Center, see Table 1.
[0033] Table 1 Experimental materials
[0034]
[0035]
[0036] 1.2 Instruments: S1000 gradient PCR instrument (Bio-rad); steponeplus fluorescence quantitative PCR instrument (ABI); 22R high-speed refrigerated microcentrifuge (Beckman); ZH-2 vortex oscillator (Tianjin Pharmacopoeia Standard Instrument Factory); MM400 ball mill (Retsch); DYY-6C electrophoresis instrument (Beijing Liuyi Instrument Factory); 310 gel imaging system (UVP), 2000C spectrophotometer (NanoDrop).
[0037] 1.3 Reagents Agarose (Biowestagarose, Spain); Gelred was purchased from Biotium; Ex Taq DNA polymerase and DL 2000 DNA Marker were purchased from TaKaRa; TaqMan Universal Master MixⅡwith UNG was purchased from Thermo Fisher Scientific, and the primers and probes were commissioned to Shanghai Jierui Bioengineering Co., Ltd. for synthesis; other reagents were domestically produced analytical grade.
[0038] 2. Methods
[0039] Weigh 10 mg of ground medicinal powder, extract total DNA using the Chelex-100 method, and detect the concentration and purity of DNA using an ultra-micro spectrophotometer. Dilute the concentration to 50 ng·μL-1 and store at -20°C for later use. Select universal primers lw01-F and lw01-R to amplify samples of toad oil and its mixed products. The primer sequences and amplification procedures are shown in Table 2. PCR products were detected by 1% agarose gel electrophoresis and observed and recorded in a gel imaging system.
[0040] The electrophoresis results are shown in Figure 1 , both the authentic Hama Oil medicinal material and its adulterated products obtained amplification products of about 800bp in size, indicating that the extracted DNA can meet the requirements of PCR reaction.
[0041] Table 2 Universal primers
[0042] Primers Sequence (5′-3′) lw01-F TCTCTACTAATCATAAAGAYATYGG lw01-R TAAACTTCAGGGTGACCAAARAATCA
[0043] PCR amplification system (25 μL): 10×PCR Buffer 2.5 μL, TaqDNA polymerase 0.1 μL, dNTPs 2 μL, 10 pmol·μL -1 0.25 μL of each upstream and downstream primers, 2 μL of template, and 25 μL of sterile distilled water. PCR amplification program: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 1 min, 52-54℃ annealing for 1.5 min, 72℃ extension for 60 s, 35 cycles; 72℃ extension for 5 min.
[0044] Example 2 Design of primers and probes for identifying toad oil based on COI sequence
[0045] Twelve COI sequences of Rana chinensis (GeneBank accession numbers MH481255-MH481266), five COI sequences of Rana amurensis (GeneBank accession numbers MH481267-MH481271), three COI sequences of Rana nigromaculata (GeneBank accession numbers MH481278-MH481280), six COI sequences of Bufo bufo gargarizans (GeneBank accession numbers MH481272-MH481277), and five COI sequences of Rana bullfrog (GeneBank accession numbers KT388391-KT388393, EF525848, EF525851) were downloaded from GenBank. Primer Express 3.0 software was used to design primers and probes. The primers were named COI-F / COI-R and the probe was named COI-P. The sequences are shown in Table 3. Primers and probes were synthesized by Shanghai Jierui Bioengineering Co., Ltd.
[0046] Table 3 Quantitative PCR primers and probes
[0047] Primers Sequence (5′-3′) COI-F TTCTGGCTACTCCCACCATC COI-R GCTAGGTTGCCAGCTAAAGG COI-P TCAGCCTGTACCTGCTCCAGCT
[0048] Example 3 Optimization of quantitative PCR reaction conditions
[0049] Using the genomic DNA of the toad oil control medicinal material, the fluorescence quantitative PCR reaction was carried out according to the above initial reaction conditions and procedures, and the effects of annealing temperatures: 60, 62, 64°C; primer and probe amounts: 2.5, 5, 10 pmol on the stability of the PCR reaction were examined in turn.
[0050] 1. Optimization of annealing temperature
[0051] Set the initial reaction conditions of the PCR reaction according to the Tm value of the primers and the length of the product. 20μL PCR reaction system: 20μL: TaqMan Universal Master MixⅡwith UNG2μL, 10pmol·μL -1 1 μL of upstream and downstream primers, 2 μL of template, and 20 μL of sterile double distilled water. PCR reaction was carried out on a steponeplus fluorescent quantitative PCR instrument, and the PCR amplification program was: 50℃2min, 95℃ pre-denaturation 10min; 95℃ denaturation 15s, 60-64℃ annealing 1min, 40 cycles.
[0052] By investigating the annealing temperature of the fluorescence quantitative PCR reaction system, the results are shown in Figure 2The results showed that the annealing temperature was between 60 and 64°C, and the number of cycles of frog oil amplification was between 15.99 and 17.56. When the annealing temperature was 60°C, there was non-specific amplification of frog oil, and the Ct value was 37.58, which did not meet the quantitative requirements. The above results showed that the amplification results of frog oil primers and probes at different annealing temperatures were slightly different, and the final annealing temperature was determined to be 62°C.
[0053] 2. Optimization of primer and probe dosage
[0054] The results show that the amount of primers and probes used in the fluorescence quantitative PCR reaction system Figure 3 The results showed that when the dosage of primers and probes was 2.5, 5, and 10 pmol, the number of toad oil amplification cycles was between 15.99 and 16.89, which had little effect on the amplification results. Considering the amplification results and resource conservation, the dosage of primers and probes was set to 5 pmol.
[0055] Example 4 Method Specificity Investigation
[0056] In order to investigate the specificity of the established method, this experiment carried out fluorescence quantitative PCR reaction on toad oil, Heilongjiang forest frog oil, black-spotted frog oil, toad oil, bullfrog oil and negative control double distilled water. The reaction system was: 20 μl: TaqMan Universal Master MixⅡwith UNG 2μl, 10 pmol·μl -1 0.5 μl of upstream and downstream primers, 2 μl of template, and 20 μl of sterile double distilled water. Amplification program: 50℃, 2 min, 95℃ pre-denaturation 10 min; 95℃ denaturation 15 s, 62℃ annealing 1 min, 40 cycles.
[0057] Results Figure 4 The results showed that only two samples of toad oil had a typical S-shaped amplification curve, and none of the mixed products had amplification. This shows that the primers and probes of toad oil have good specificity and no cross reaction with other sample DNA.
[0058] Example 5 Establishment of standard curve
[0059] In order to examine the linear relationship of the established method, the genomic DNA of the control medicinal material of Toad Oil was diluted 10 times (10 times, 100 times, 1000 times, 10000 times), and the corresponding concentrations were 50μM, 5μM, 0.5μM, 0.05μM, 0.005μM, and 3 parallel samples were set for each reaction. The standard curve was drawn according to the content of the control medicinal material DNA of Toad Oil and its Ct value.
[0060] When the concentration of the toad oil medicinal material genome was 50μM, 5μM, 0.5μM, 0.05μM, and 0.005μM, the corresponding Ct values were 18.64, 21.94, 25.36, 29.93, and 32.57. The standard curve was drawn with the concentration as the horizontal axis and the Ct value as the vertical axis. Figure 5 The standard curve equation is: y = -3.4850x + 24.439, R2 = 0.9996, and the amplification efficiency is 93.636%. Within this range, the linear relationship is good and can be used for the quantitative analysis of toad oil DNA.
[0061] Example 6 Sensitivity Study
[0062] In order to investigate the sensitivity of the established method, the genomic DNA of the control medicinal material of Toad Oil was diluted 10 times (10 times, 100 times, 1000 times, 10000 times, 100000 times, 100000 times), corresponding to the concentrations of 50μM, 5μM, 0.5μM, 0.05μM, 0.005μM, and 3 parallel samples were set for each reaction. Fluorescence quantitative PCR detection was performed. The reaction system was: 20μl: TaqMan Universal Master MixⅡwith UNG 2μl, 10pmol·μl -1 0.5 μl of upstream and downstream primers, 2 μl of template, and sterile double-distilled water to make up to 20 μl.
[0063] Amplification program: 50°C for 2 min, pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 62°C for 1 min, 40 cycles.
[0064] Results Figure 6 The results showed that when the sample DNA concentration was 0.00005 ng / μl and above, clear fluorescence signals could be detected after amplification. However, when the concentration was 0.00005 ng / μl, the Ct values of the three parallel samples were 37.08, 34.13, and 34.32, respectively, and one value was greater than 35. At this time, the result was not stable enough. Therefore, the sensitivity was determined to be 0.0005 ng / μl. At this time, the Ct values were all less than 35, indicating that this method has high sensitivity and can be used to detect trace DNA of toad oil.
[0065] Example 7 Repeatability Study
[0066] In order to investigate the repeatability of the established method, genomic DNAs of 11 toad oils, 4 black-spotted frog oils, 5 Heilongjiang forest frog oils, 4 toad oils and 3 bullfrog oils were extracted as templates for fluorescence quantitative PCR detection.
[0067] The 27 samples of toad oil and its counterfeits were tested by fluorescence quantitative PCR using the established method. Figure 7 All 11 samples of toad oil had typical S-shaped amplification curves, and none of the counterfeit products had amplification. The test results were consistent with the actual identification results, indicating that the established method can meet the needs of authenticity identification of toad oil.
[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A primer probe set for detecting toad oil medicinal materials, characterized in that: The method comprises primers COI-F and COI-R, wherein the nucleotide sequence of primer COI-F is shown in SEQ ID NO.1, The nucleotide sequence of primer COI-R is shown in SEQ ID NO.
2.
2. The primer probe set for detecting toad oil medicinal material according to claim 1, characterized in that: It includes a probe COI-P, and the nucleotide sequence of the probe COI-P is shown in SEQ ID NO.
3.
3. A method for detecting toad oil medicinal materials based on the primer-probe set as claimed in claim 1 or 2, characterized in that: The following steps are involved: S1, extracting genomic DNA of the sample to be tested; S2, using the genomic DNA of the sample to be tested extracted in step S1 as a test template, and using primers and probes to perform real-time fluorescence quantitative PCR amplification reaction on the test template; S3, the method for judging whether the sample is toad oil is as follows: judging based on the CT value, if the CT value is less than or equal to 35, it is judged as positive, and if the sample CT value is greater than 35 or has no value, it is judged as negative.
4. The method for detecting the medicinal material of toad oil according to claim 3, characterized in that: The reaction system for real-time fluorescence quantitative PCR amplification in step S2 is: TaqMan Universal Master MixⅡwith UNG 2μL, 10pmol·μL -1 0.5 μL each of primers COI-F and COI-R, 2 μL of template, and make up to 20 μL with sterile double-distilled water.
5. The method for detecting the medicinal material of toad oil according to claim 4, characterized in that: The real-time fluorescence quantitative PCR amplification program in step S2 is: 50°C, 2 min, 95°C pre-denaturation for 10 min; 95°C denaturation for 15 s, 62°C-64°C, 1 min annealing and extension stage to collect corresponding fluorescence.
6. The method for detecting the medicinal material of toad oil according to claim 4, characterized in that: The method also includes establishing a standard curve for quantitative analysis, and the standard curve equation is: y=-3.4850x+24.439, R2=0.9996.
7. Use of the primer probe set for detecting the toad oil medicinal material as claimed in claim 1 or 2 in preparing a toad oil medicinal material detection kit.