Micro-fluidic chip based on deoxyribozyme and photonic crystal technology and application thereof

Abstract

The invention discloses a microfluidic chip based on deoxyribozyme and photonic crystal technology and application thereof, and belongs to the technical field of analysis and detection. The microfluidic chip based on the deoxyribozyme and photonic crystal technology is mainly composed of a deoxyribozyme sample inlet, an escherichia coli sample inlet, a snakelike reaction flow channel, a magnetic bead enrichment chamber and a signal detection chamber, polystyrene balls serve as photonic crystals to be assembled in the signal detection chamber, and magnets are fixed to the bottom of the magnetic bead enrichment chamber. In a reaction flow channel, after deoxyribozyme coupled to a magnetic bead reacts with an escherichia coli target, a substrate chain with an FAM fluorophore is broken and enters a signal detection cavity along with flowing of fluid, under irradiation of 488 nm exciting light, a fluorescence microscope is used for observing a fluorescence image, the fluorescence intensity is in direct proportion to the content of the escherichia coli target, and the fluorescence intensity is in direct proportion to the content of the escherichia coli target. And the detection time is about 25 minutes. The micro-fluidic chip disclosed by the invention is light and portable, rapid in detection, high in sensitivity and good in selectivity, and can realize on-site quantitative detection of an object to be detected.

Description

Technical Field

[0001] The invention belongs to the technical field of analysis and detection, and specifically relates to a microfluidic chip based on DNA enzyme and photonic crystal technology and application thereof. Background Art

[0002] E. coli is one of the common harmful bacteria in the intestines of humans and animals. Infection with E. coli in people with weakened immune systems can lead to symptoms such as urinary tract infections and gastrointestinal damage. Common infectious strains are E. coli strains, which account for about 80% of urinary tract infection cases in outpatient clinics. Pathogenic strains such as E. coli O157:H7 produce toxins that damage the intestinal lining, causing anemia, stomach cramps and bloody diarrhea.

[0003] At present, E. coli detection mainly includes culture method and molecular biology method. Using culture method to count bacterial colonies is a common means for E. coli detection. This method can obtain accurate and effective results, but it has limitations for field applications. For example, this method requires a long time of culture to form colonies, which is difficult to meet field needs. Molecular biology method is also one of the common methods for E. coli detection. It has fast detection speed, good selectivity and low detection limit, but due to the expensive experimental instruments and complicated operation, it is still difficult to meet immediate needs. Therefore, although these methods are very effective in conventional indoor analysis, they are difficult to apply in daily field use due to complex operation, expensive instruments, and time-consuming detection. Therefore, it is necessary to develop a simple and rapid method for detecting E. coli.

[0004] With the continuous development of modern molecular biology, researchers have found that in addition to the classic Watson-Crick base pairing, some nucleic acid molecules also have the function of specifically binding or catalyzing specific target molecules. DNAzymes are nucleic acid fragments with recognition, catalysis and regulation functions obtained through in vitro screening technology. For example, in a research result published in 2023, Professor Liu Meng's research group at Dalian University of Technology obtained for the first time through in vitro screening an acidic RNA-cleaving DNAzyme that cleaves RNA under pH 5.3 conditions and named it aRCD-EC1 (In Vitro Selection of M2+-Independent, Fast-Responding Acidic Deoxyribozymes for Bacterial Detection; Qinbin Zhou, Guangxiao Zhang, Yunping Wu, Qiang Zhang, Yi Liu, Yangyang Chang, and Meng Liu; Journal of the American Chemical Society 2023 145(39), 21370-21377; DOI: 10.1021 / jacs.3c06155). The enzyme can be activated by Escherichia coli (E. coli) at pH 5.3. Based on the recognition and catalytic function of DNAzymes, a series of fluorescent, colorimetric and electrochemical sensors can be developed to detect pathogens in urine, feces and other environments.

[0005] Photonic crystals are one of the most widely studied artificial periodic nanostructures, which show a special ability to enhance the intensity of optical species. Usually, when the emission light of fluorophores on the surface of photonic crystals overlaps with the photonic band gap of the photonic crystals, the emission light cannot pass through the photonic crystals and will be effectively reflected in the direction of the band gap. The reflected light signal can be collected simultaneously with the emission signal of the fluorophores, thereby enhancing the signal intensity. Microfluidics is a technology characterized by micron size and capable of handling microliter volumes of liquid. It can also integrate microvalves and pumps to precisely control reagents within microchannels, which is ideal for complex biological analysis.

[0006] However, so far, there has been no report on the rapid, highly sensitive and highly selective detection of Escherichia coli using microfluidic chips based on DNAzymes and photonic crystal technology. Summary of the invention

[0007] In view of this, the purpose of the present invention is to provide a microfluidic chip based on DNAzyme and photonic crystal technology and its application. The microfluidic chip of the present invention can realize rapid, sensitive and highly selective detection of Escherichia coli.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] The invention provides a microfluidic chip based on DNAzyme and photonic crystal technology, which mainly comprises a DNAzyme injection port 1, an Escherichia coli sample injection port 2, a serpentine reaction flow channel 3, a magnetic bead enrichment chamber 4 and a signal detection chamber 5; the DNAzyme injection port 1 and the Escherichia coli sample injection port 2 are respectively provided with injection pumps, the DNAzyme injection port 1 and the Escherichia coli sample injection port 2 are respectively connected with the inlet of the serpentine reaction flow channel 3 after merging through flow channels, the outlet of the serpentine reaction flow channel 3, the magnetic bead enrichment chamber 4 and the signal detection chamber 5 are sequentially connected through the flow channel, a magnet is fixed at the bottom of the magnetic bead enrichment chamber 4, and photonic crystals are evenly distributed at the bottom of the signal detection chamber 5.

[0010] Based on the above technical scheme, further, the serpentine reaction channel 3 has a rectangular cross-section, a channel width of 300 to 700 μm, a channel height of 300 to 700 μm, a length of 100 to 1000 mm, the magnetic bead enrichment chamber 4 and the signal detection chamber 5 are both cylindrical, the specifications of the magnetic bead enrichment chamber 4 are φ6 to 10 mm × 0.6 to 1 mm, and the specifications of the signal detection chamber 5 are φ4 to 9 mm × 2 to 4 mm.

[0011] Based on the above technical solution, further, the material of the microfluidic chip is polymethyl methacrylate (PMMA), and the chip specification is 50-70 mm×20-40 mm×5-7 mm.

[0012] Based on the above technical solution, further, the photonic crystal is a polystyrene sphere with a particle size of 200 to 230 nm.

[0013] Based on the above technical solution, further, a method for uniformly distributing photonic crystals at the bottom of the signal detection chamber 5 is as follows: a polystyrene microsphere suspension is dropped to the bottom of the signal detection chamber 5, and after uniform distribution, it is baked at 50-80°C for 1-2 hours.

[0014] The present invention also provides a method for detecting Escherichia coli using the above-mentioned microfluidic chip based on DNAzyme and photonic crystal technology, comprising the following steps:

[0015] (1) Coupling of DNAzyme and magnetic beads: fully suspend the magnetic beads labeled with streptavidin, add washing solution, wash the magnetic beads, add biotinylated DNAzyme-substrate linker, add washing solution again, oscillate and suspend for 10 to 30 minutes, separate magnetically, add washing solution again, wash the magnetic beads, and resuspend in reaction buffer;

[0016] (2) Preparation of E. coli CIM: centrifuge the sample to be tested at 6000-10000 rpm, discard the supernatant, resuspend the precipitate in 100-300 μL of reaction buffer, disrupt by ultrasonication, centrifuge the resulting bacterial suspension at 2000-4000 rpm, take the supernatant, and heat it at 80-95°C for 2-10 min to obtain CIM;

[0017] (3) Reaction of E. coli CIM and DNAzyme: The magnetic beads loaded with biotinylated DNAzyme-substrate linkers obtained in step (1) and the E. coli CIM obtained in step (2) are respectively injected into the chip serpentine reaction flow channel 3 through the DNAzyme injection port 1 and the E. coli sample injection port 2, the DNAzyme is activated by the E. coli target, the RNA in the biotinylated DNAzyme-substrate linker is cleaved, and the substrate chain with the fluorescent group is broken. When the mixed fluid flows through the magnetic bead enrichment chamber 4, the magnetic beads are retained under the action of the bottom magnet, and the fluid with the substrate chain with the fluorescent group flows into the signal detection chamber 5;

[0018] (4) Signal detection: After all the fluids in step (3) flow into the signal detection chamber 5, a fluorescence microscope is used to take pictures to analyze whether the sample to be tested contains E. coli and the content thereof.

[0019] Based on the above technical solution, further, in step (1), the concentration of the magnetic beads loaded with the biotinylated deoxyribozyme-substrate linker in the reaction buffer is 0.1-1 mg / mL, and the loading amount of the magnetic beads labeled with streptavidin for the biotinylated deoxyribozyme-substrate linker is 100-2000 pmol / mg.

[0020] Based on the above technical solution, further, the structure of the biotinylated deoxyribozyme-substrate linker described in step (1) is as follows:

[0021] FAM- CTATGAACTGACTrATGACCTCACTACCAAG CAGGTCCATCGAGTGGTAGG ATGCGGCGGTCAGTCGCACTGCTCCTTTTTTTTTTT-Biotin, the underlined nucleotide sequence part is the substrate chain, and the other nucleotide sequence parts are deoxyribozymes, which are modified with FAM fluorescent group at the 5' end and biotin at the 3' end. The substrate chain contains a deoxyribozyme cleavage site RNA—rA.

[0022] Based on the above technical solution, further, the washing solution in step (1) is composed of: 10mM Tris-HCl, 1mM EDTA, 1M NaCl, 0.01%-0.1% Tween-20, and the remainder is water.

[0023] Based on the above technical solution, further, the reaction buffer in step (1) is composed of: 50mM NaAC, 20mM EDTA, 150mM NaCl, 50mM KCl and 0.01% Tween 20, and the balance is water.

[0024] Based on the above technical solution, further, the centrifugation time in step (2) is 5 to 30 minutes.

[0025] Based on the above technical solution, further, the injection speed of the magnetic beads loaded with biotinylated deoxyribozyme-substrate connector described in step (3) is the same as that of Escherichia coli CIM, the injection speed is controlled at 2-8 μL / min, and the reaction time in the serpentine reaction channel 3 is controlled at more than 20 min.

[0026] Based on the above technical solution, further, in step (4), the excitation wavelength of the fluorescence microscope is 480-500 nm, and the fluorescence intensity is proportional to the content of the Escherichia coli target.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] 1. The present invention applies DNA enzyme fluorescence detection and photonic crystal fluorescence enhancement effect to microfluidic detection of Escherichia coli, which has the advantages of rapid response and high sensitivity (10 3 CFU / mL detection limit);

[0029] 2. The detection method of the present invention has good specificity and has a significant specific recognition effect on Escherichia coli;

[0030] 3. The microfluidic chip of the present invention is light and portable, has a low manufacturing cost, effectively reduces the cost required for detection, is easy to promote, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention, the drawings related to the embodiments are briefly introduced below.

[0032] Figure 1 It is a schematic diagram of the structure of the microfluidic chip in Example 1, wherein 1: DNAzyme injection port, 2: Escherichia coli sample injection port, 3: serpentine reaction channel, 4: magnetic bead enrichment chamber, 5: signal detection chamber.

[0033] Figure 2This is a schematic diagram of the photonic crystal signal amplification principle in Example 1.

[0034] Figure 3 This is a graph showing the relationship between the fluorescence intensity detected by the microfluidic chip and the reaction time in Example 1.

[0035] Figure 4 1 and 10. These are the results of the detection of Escherichia coli in the actual urine sample in Example 2, wherein A is the detection result of the Escherichia coli colorimetric culture plate, and B is the detection result of the microfluidic chip. DETAILED DESCRIPTION

[0036] The present invention is described in detail below with reference to the embodiments, but the embodiments of the present invention are not limited thereto. Obviously, the embodiments described below are only partial embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative labor all fall within the protection scope of the present invention.

[0037] Unless otherwise specified, the materials and reagents in the examples can be obtained from commercial sources.

[0038] The reaction buffer in the embodiment is as follows: 50 mM NaAc, 20 mM EDTA, 150 mM NaCl, 50 mM KCl and 0.01% Tween 20 are dissolved in 50 mL sterile water, dissolved by ultrasonication, the pH is adjusted to 5.3, and stored at 4°C.

[0039] The washing solution in the embodiment is: 10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.01%-0.1% Tween-20 dissolved in 50 mL sterile water, adjusted to pH 7.5, and stored at 4°C.

[0040] Example 1

[0041] This embodiment provides a construction of a microfluidic chip based on DNAzyme and photonic crystal technology and a process for detecting Escherichia coli, which specifically includes the following steps:

[0042] Step 1: Design of microfluidic chip: Use SOLIDWORKS2023 software for design. The microfluidic chip is made of polymethyl methacrylate (PMMA). The chip size is 60mm×30mm×6.6mm. The structure is as follows: Figure 1As shown, it mainly includes a DNA enzyme injection port 1, an Escherichia coli sample injection port 2, a serpentine reaction flow channel 3, a magnetic bead enrichment chamber 4 and a signal detection chamber 5; the DNA enzyme injection port 1 and the Escherichia coli sample injection port 2 are respectively provided with injection pumps, the DNA enzyme injection port 1 and the Escherichia coli sample injection port 2 are respectively connected with the inlet of the serpentine reaction flow channel 3 after merging through the flow channel, the outlet of the serpentine reaction flow channel 3, the magnetic bead enrichment chamber 4 and the signal detection chamber 5 are sequentially connected through the flow channel, the flow channel cross-section of the serpentine reaction flow channel 3 is square, the flow channel width and height are both 500μm, the length of the serpentine reaction flow channel 3 is 526mm, the magnetic bead enrichment chamber 4 and the signal detection chamber 5 are both cylindrical, the specification of the magnetic bead enrichment chamber 4 is φ8×0.8mm, the specification of the signal detection chamber 5 is φ6.5×3mm, and a magnet is fixed at the bottom of the magnetic bead enrichment chamber 4.

[0043] Step 2: Assembly of photonic crystal: 4 μL of polystyrene microsphere suspension (particle size 220 nm, polystyrene sphere solid content 4%) is added dropwise to the center of the microfluidic chip signal detection chamber 5, so that the polystyrene microsphere suspension is evenly spread to the bottom of the signal detection chamber 5, and the microfluidic chip is dried in a 70°C oven for 1.5 hours to assemble into a photonic crystal, which can effectively achieve signal amplification. The amplification principle is as follows: Figure 2 shown.

[0044] Step 3: Coupling of DNAzyme and magnetic beads: fully suspend 5 μL of magnetic beads labeled with streptavidin, add 50 μL of washing solution, wash the magnetic beads thoroughly, add 5 μL of biotinylated DNAzyme-substrate linker (DNAzyme reference In Vitro Selection of M2+-Independent, Fast-Responding Acidic Deoxyribozymes for Bacterial Detection; Qinbin Zhou, Guangxiao Zhang, Yunping Wu, Qiang Zhang, Yi Liu, Yangyang Chang, and Meng Liu; Journal of the American Chemical Society 2023145(39), 21370-21377; DOI: 10.1021 / jacs.3c06155), then add 20 μL of washing solution (to make the concentration of magnetic beads 2 mg / mL), vortex thoroughly to suspend, and place on a rotary mixer for low-speed vortexing (room temperature, 30 min). After magnetic separation, 20 μL of washing solution was added to wash the magnetic beads thoroughly, and the beads were resuspended in 25 μL of reaction buffer at a concentration of 0.5 mg / mL. The loading amount of the streptavidin-labeled magnetic beads for the biotinylated deoxyribozyme-substrate linker was 1000 pmol / mg and stored at 4°C;

[0045] The specific sequence of the biotinylated DNAzyme-substrate linker is as follows:

[0046] CTATGAACTGACTrATGACCTCACTACCAAG CAGGTCCATCGAGTGGTAGGATGC GGCGGTCAGTCGCACTGCTCCTTTTTTTTTTT, with FAM fluorescent group modified at the 5' end and biotin modified at the 3' end. The underlined part is the substrate chain, and the other parts are deoxyribozymes. The substrate chain contains a deoxyribozyme cleavage site RNA—rA;

[0047] Step 4: Cultivation of E. coli: Add 10 μL of E. coli BL21 to 5 mL of LB medium and culture overnight. The temperature of the shaker is 37°C and the shaking speed is 150 rpm. After overnight culture, the concentration of E. coli is measured. When the OD 600 =1, remove the E. coli from the shaker.

[0048] Step 5: Preparation of CIMs: Take out 1 mL of E. coli suspension (OD 600=1), centrifuge for 10 min (8000 rpm, 4°C), discard the supernatant, resuspend the cell pellets deposited at the bottom in 300 μL reaction buffer, break the suspension in an ultrasonic machine for 30 s, place it in ice and freeze it for 2 min, repeat this operation 6 times, place the suspension in a centrifuge and centrifuge it again for 10 min (3000 rpm, 4°C), aspirate the supernatant, place it in 90°C and heat it for 5 min to obtain the corresponding CIM-EC, and the prepared CIMs are stored in a -20°C refrigerator.

[0049] Step 6: Reaction of E. coli CIM and DNAzyme: 25 μL of magnetic beads loaded with biotinylated DNAzyme-substrate linker and 25 μL of E. coli CIMs were injected into the chip serpentine reaction channel 3 through DNAzyme injection port 1 and E. coli sample injection port 2, respectively, and the injection was pushed by the injection pump at different speeds (the injection speed of the magnetic beads loaded with biotinylated DNAzyme-substrate linker and E. coli CIM was the same, and the injection speeds were 8 μL / min, 7 μL / min, and 10 μL / min, respectively). The two realize different mixing reaction times in the serpentine reaction flow channel, the DNAzyme is activated by the Escherichia coli target, the RNA in the biotinylated DNAzyme-substrate connector is cleaved, the substrate chain with the fluorescent group is broken, and when the mixed fluid flows through the magnetic bead enrichment chamber 4, the magnetic beads are retained under the action of the bottom magnet, and the fluid with the fluorescent substrate chain flows into the signal detection chamber 5.

[0050] Step 7: Signal detection: After all the fluid flows into the signal detection chamber 5, a fluorescence microscope is used to take pictures under 488nm excitation light. The fluorescence intensity is proportional to the content of the E. coli target, and the pictures are analyzed using ImageJ software.

[0051] The specific process of the blank experiment is the same as above, the difference is that the reaction buffer is injected into the E. coli injection port.

[0052] The results are as follows Figure 3 As shown in the figure, the effect of different reaction times on the fluorescence intensity is compared. As the injection speed decreases, the reaction time increases and the fluorescence intensity gradually increases. After 20 minutes of reaction, the increase in fluorescence intensity slows down. Therefore, the injection speed is preferably 4 μL / min and the reaction time is 20 minutes.

[0053] Example 2 Selective testing of microfluidic chip for detection of Escherichia coli urine samples

[0054] Step 1: Take 1 mL of clinical urine sample in the clean bench and dilute it by 10 and 10 respectively. 2 and 10 3times, then take 10μL of the diluted urine sample and drop it on the E. coli color culture medium plate with a micropipette, and spread it evenly with a smear stick. Seal the culture dish with sealing film and invert it in a 37℃ constant temperature incubator for 24-48h to observe the growth of the colonies. The blue-green colonies are E. coli.

[0055] Step 2: Take out 1 mL of urine sample, centrifuge in a centrifuge for 10 min (8000 rpm, 4°C), discard the supernatant, and resuspend the cell clumps deposited at the bottom in 300 μL of reaction buffer. Break the suspension in an ultrasonic machine for 30 seconds, place it in ice cubes and freeze it for 2 minutes, repeat this operation 6 times, place the suspension in a centrifuge and centrifuge it again for 10 min (3000 rpm, 4°C), aspirate the supernatant, place it in 90°C and heat it for 5 minutes to obtain the corresponding bacterial CIM;

[0056] Step 3: 25 μL of magnetic beads loaded with biotinylated DNAzyme-substrate connectors (same as in Example 1) and 25 μL of bacterial CIM are injected into the chip serpentine reaction channel 3 through the DNAzyme inlet sample 1 and the Escherichia coli sample inlet 2, respectively. The two are driven by the injection pump (the injection speed is 4 μL / min) to achieve a mixed reaction in the serpentine reaction channel for 20 minutes. The DNAzyme is activated by the Escherichia coli target, the RNA in the biotinylated DNAzyme-substrate connector is cleaved, and the substrate chain with the fluorescent group is broken. When the mixed fluid flows through the magnetic bead enrichment chamber 4, the magnetic beads are retained under the action of the bottom magnet, and the fluid with the fluorescent short chain flows into the signal detection chamber 5.

[0057] Step 4: Signal detection: After all the fluid flows into the signal detection chamber 5, a fluorescence microscope is used to take pictures under 488nm excitation light. The fluorescence intensity is proportional to the content of the E. coli target, and the pictures are analyzed using ImageJ software.

[0058] The results are as follows Figure 4 As shown, the CIM detection signals of the microfluidic chip for different groups of Escherichia coli match the plate culture count results. It can be seen that the microfluidic chip can detect Escherichia coli in clinical urine samples.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A microfluidic chip based on DNAzyme and photonic crystal technology, characterized in that: The invention mainly comprises a DNA enzyme injection port (1), an Escherichia coli sample injection port (2), a serpentine reaction flow channel (3), a magnetic bead enrichment chamber (4) and a signal detection chamber (5); the DNA enzyme injection port (1) and the Escherichia coli sample injection port (2) are respectively provided with injection pumps; the DNA enzyme injection port (1) and the Escherichia coli sample injection port (2) are respectively connected to the inlet of the serpentine reaction flow channel (3) after merging through flow channels; the outlet of the serpentine reaction flow channel (3), the magnetic bead enrichment chamber (4) and the signal detection chamber (5) are sequentially connected through the flow channel; a magnet is fixed at the bottom of the magnetic bead enrichment chamber (4); and photonic crystals are evenly distributed at the bottom of the signal detection chamber (5).

2. The microfluidic chip according to claim 1, characterized in that: The serpentine reaction channel (3) has a rectangular cross section, a channel width of 300 to 700 μm, a channel height of 300 to 700 μm, a length of 100 to 1000 mm, a magnetic bead enrichment chamber (4) and a signal detection chamber (5) are both cylindrical, the specification of the magnetic bead enrichment chamber (4) is φ6 to 10 mm × 0.6 to 1 mm, and the specification of the signal detection chamber (5) is φ4 to 9 mm × 2 to 4 mm.

3. The microfluidic chip according to claim 1, characterized in that: The material of the microfluidic chip is polymethyl methacrylate (PMMA), and the chip specification is 50-70mm×20-40mm×5-7mm.

4. The microfluidic chip according to claim 1, characterized in that: The photonic crystal is a polystyrene sphere with a particle size of 200-230nm.

5. A method for detecting Escherichia coli using a microfluidic chip based on DNAzyme and photonic crystal technology according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) Coupling of DNAzyme and magnetic beads: fully suspend the magnetic beads labeled with streptavidin, add washing solution, wash the magnetic beads, add biotinylated DNAzyme-substrate linker, add washing solution again, oscillate and suspend for 10 to 30 minutes, separate magnetically, add washing solution again, wash the magnetic beads, and resuspend in reaction buffer; (2) Preparation of E. coli CIM: centrifuge the sample to be tested at 6000-10000 rpm, discard the supernatant, resuspend the precipitate in reaction buffer, disrupt by ultrasonication, centrifuge the resulting bacterial suspension at 2000-4000 rpm, take the supernatant, and heat at 80-95°C for 2-10 min to obtain; (3) Reaction of E. coli CIM and DNAzyme: The magnetic beads loaded with biotinylated DNAzyme-substrate linkers obtained in step (1) and the E. coli CIM obtained in step (2) are respectively injected into the chip serpentine reaction flow channel (3) through the DNAzyme injection port (1) and the E. coli sample injection port (2) of the microfluidic chip, and the DNAzyme is activated by the E. coli target, and the RNA in the biotinylated DNAzyme-substrate linker is cleaved, and the substrate chain with the fluorescent group is broken. When the mixed fluid flows through the magnetic bead enrichment chamber (4), the magnetic beads are retained under the action of the bottom magnet, and the fluid with the substrate chain with the fluorescent group flows into the signal detection chamber (5); (4) Signal detection: After all the fluids in step (3) flow into the signal detection chamber (5), a fluorescence microscope is used to take pictures to analyze whether the sample to be tested contains E. coli and the content thereof.

6. The method according to claim 5, characterized in that In step (1), the concentration of the magnetic beads loaded with the biotinylated deoxyribozyme-substrate linker in the reaction buffer is 0.1-1 mg / mL, and the loading amount of the magnetic beads labeled with streptavidin on the biotinylated deoxyribozyme-substrate linker is 100-2000 pmol / mg; The structure of the biotinylated DNAzyme-substrate linker is as follows: FAM- CTATGAACTGACTrATGACCTCACTACCAAG CAGGTCCATCGAGTGGTAGG ATGCGGCGGTCAGTCGCACTGCTCCTTTTTTTTTTT-Biotin, the underlined nucleotide sequence part is the substrate chain, and the other nucleotide sequence parts are deoxyribozymes, which are modified with FAM fluorescent group at the 5' end and biotin at the 3' end. The substrate chain contains a deoxyribozyme cleavage site RNA—rA.

7. The method according to claim 5, characterized in that The washing solution in step (1) is composed of: 10mM Tris-HCl, 1mM EDTA, 1M NaCl, 0.01%-0.1% Tween-20, and the balance is water; the reaction buffer is composed of: 50mM NaAC, 20mM EDTA, 150mM NaCl, 50mM KCl and 0.01% Tween 20, and the balance is water.

8. The method according to claim 5, characterized in that The centrifugation time in step (2) is 5 to 30 minutes.

9. The method according to claim 5, characterized in that The injection speed of the magnetic beads loaded with biotinylated DNAzyme-substrate connector described in step (3) is the same as that of Escherichia coli CIM, which is controlled at 2-8 μL / min, and the reaction time in the serpentine reaction channel 3 is controlled at more than 20 min.

10. The method according to claim 5, characterized in that In step (4), the excitation wavelength of the fluorescence microscope is 480-500 nm, and the fluorescence intensity is proportional to the content of the Escherichia coli target.

Images