Preparation method of polydeoxyribonucleotide

Abstract

The invention discloses a preparation method of polydeoxyribonucleotide, and relates to the technical field of synthetic biology, and the preparation method comprises the following steps: S1, randomly selecting n ssDNAs from a salmon genome sequence; s2, carrying out cyclization on the ssDNA, so as to obtain cssDNA; s3, carrying out amplification on the cssDNA to obtain a repeated long single-stranded DNA (Deoxyribose Nucleic Acid); and S4, breaking the repeated long single-stranded DNA to obtain the PDRN. According to the method, a large amount of repeated long single-stranded DNA can be synthesized only by introducing a small amount of foreign proteins (T4DNA ligase and Phi29 DNA polymerase), the repeated long single-stranded DNA is broken by a physical breaking method, and a large amount of PDRN products with ideal molecular weight can be obtained in a short time.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology, and in particular to a method for preparing polydeoxyribonucleotide. Background Art

[0002] Polydeoxyribonucleotides (PDRN) are a DNA derivative mainly extracted from the testes of Pacific salmon (O.keta) or rainbow trout (O.mykiss). The molecular weight is between 50-1500kDa and the chain length is between 50-2000bp. It is a linear polymer of deoxyribonucleotides with phosphodiester bonds. The base composition of PDRN is as high as 98% similar to human DNA, so PDRN has been shown to provide a source of purine and pyrimidine for different tissues. In addition, at therapeutic concentrations, PDRN has been shown to increase the growth rate of various cells in primary culture, such as fibroblasts, chondrocytes and osteoblasts. Based on these biological effects, its application range in clinical practice has gradually expanded, and its amazing therapeutic effects include anti-inflammation, anti-apoptosis, anti-osteoporosis, anti-melanin production, anti-abnormal pain, anti-osteonecrosis, prevention of tissue damage, anti-ulcer and wound healing.

[0003] Fish testes and semen, which are rich in DNA, are ideal raw materials for extracting PDRN. However, due to seawater pollution caused by nuclear wastewater discharge and oil spills, the continuous improvement of wildlife resource protection regulations, the difficulty in obtaining raw materials and the high cost, directly extracting PDRN through fish testes or semen is no longer the best option.

[0004] Synthetic biology is based on biological science, brings together sciences such as chemistry, physics, and information, integrates engineering principles, designs and transforms natural or synthesizes new organisms, reveals the laws of life (creating knowledge), and transforms the engineering application of biological systems (creating use). It is also called engineering biology. Biomanufacturing has undergone three technological revolutions in the process of technological development over the past century. The first technological revolution was basic fermentation metabolism, which produced primary metabolites through single culture fermentation; the second technological revolution was microbial directed fermentation, which screened bacteria or cells in nature that could produce certain substances to obtain biologically active substances that were helpful to life and health; with the continuous changes in technologies such as gene editing technology and bioinformatics, the third technological revolution with "synthetic biology" as the core was born. In the research and application of PDRN, synthetic biology provides an innovative way to optimize the production process of PDRN, improve its efficacy and application range. Compared with the extraction method, biosynthesized PDRN is more natural, safe, effective, and has better biocompatibility. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for preparing PDRN. PDRN prepared by biosynthesis may become a safe, efficient and low-cost source of PDRN raw materials that replaces the extraction method.

[0006] The technical problem to be solved by the present invention is achieved by adopting the following technical solutions:

[0007] A method for preparing PDRN comprises the following steps:

[0008] S1, randomly select n single-stranded DNA (ssDNA) from the salmon genome sequence;

[0009] S2, cyclizing the ssDNA to obtain circular single-stranded DNA (cssDNA);

[0010] S3, amplifying cssDNA to obtain repetitive long single-stranded DNA;

[0011] S4. Break the repetitive long single-stranded DNA to obtain PDRN.

[0012] Furthermore, n≥1. As a specific implementation, n=6.

[0013] Furthermore, the nucleotide sequence of the ssDNA is shown in SEQ ID NO.1-6.

[0014] Furthermore, the step S2 specifically includes the following steps:

[0015] S21, design ligation primers;

[0016] S22, preparing the preparation liquid and the additive liquid;

[0017] The preparation solution comprises T4 DNA ligase, ligation primers and T4 DNA ligase buffer;

[0018] The additive solution comprises T4 DNA ligase buffer and ssDNA template;

[0019] S23. Gradually add the supplement solution to the preparation solution to circularize the ssDNA to obtain cssDNA.

[0020] Furthermore, the nucleotide sequence of the connecting primer is shown in SEQ ID NO.7-12.

[0021] The present invention circularizes ssDNA to obtain cssDNA by a stepwise addition method. The stepwise addition method is applied, that is, a small amount of ssDNA is added to the circularization system each time, so that it is fully circularized at a low concentration and then ssDNA is added again, and this is repeated multiple times, so that the circularization concentration of ssDNA is always at a low level, and finally a high concentration of cssDNA is accumulated to provide sufficient templates for subsequent rolling circle amplification.

[0022] Furthermore, the ssDNA template is ssDNA with 5' end phosphorylated.

[0023] Furthermore, the cyclization temperature is 23-27° C. and the time is 5-10 h.

[0024] Furthermore, the step S3 specifically includes the following steps:

[0025] S31, design amplification primers;

[0026] S32, prepare a mixed system, pre-denature at 95°C for 5 min, and anneal in an ice bath for 5 min;

[0027] The mixed system comprises amplification primers, cssDNA and Phi29 DNA polymerase buffer;

[0028] S33, adding deoxynucleotide triphosphates (dNTPs), bovine serum albumin (BSA) and Phi29 DNA polymerase to the mixed system for rolling circle amplification;

[0029] S34. Inactivate the Phi29 DNA polymerase in the mixed system to obtain repetitive long single-stranded DNA.

[0030] Furthermore, the amplification primer is a random primer with a thiolation modification at the 3' end, and the nucleotide sequence is 5'-NNNNNN-3'.

[0031] Furthermore, the nucleotide sequences of the amplification primers are shown in SEQ ID NO.7-12.

[0032] Furthermore, the nucleotide sequences of the amplification primers are shown in SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15.

[0033] Furthermore, the temperature of the rolling circle amplification is 30° C. and the time is 3 to 4 hours.

[0034] Furthermore, the interruption is physical interruption, preferably ultrasonic treatment, with an ultrasonic power of 250 to 350 W, a duty cycle of 2:1, and an ultrasonic time of 5 to 15 min.

[0035] Furthermore, the base length of the PDRN is 50 to 500 bp, A 260 / A 280 The value is 1.7~2.0.

[0036] The beneficial effects of the present invention are as follows: in view of the technical defects and application limitations of the existing extraction methods for obtaining PDRN, the present invention provides a method for preparing PDRN by synthetic biology technology, which only requires the introduction of a small amount of exogenous proteins (T4 DNA ligase and Phi29 DNA polymerase) to synthesize a large amount of repetitive long single-stranded DNA, and the repetitive long single-stranded DNA is interrupted by a physical fragmentation method, so that a large amount of PDRN products with an ideal molecular weight can be obtained in a short time. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the denaturing polyacrylamide gel electrophoresis image of cssDNA in Example 1;

[0038] Figure 2 It is the agarose gel electrophoresis diagram of the repetitive long single-stranded DNA (lane 2) after rolling circle amplification and the PDRN fragment (lane 3) after ultrasonic fragmentation in Example 1; wherein, lane 1 is 15kb DNA Marker;

[0039] Figure 3 It is the agarose gel electrophoresis diagram of the repetitive long single-stranded DNA (lane 2) after rolling circle amplification and the PDRN fragment (lane 3) after ultrasonic fragmentation in Example 2; wherein, lane 1 is 15kb DNA Marker;

[0040] Figure 4 It is an agarose gel electrophoresis diagram of the supernatant after rolling circle amplification in Example 3 (lane 2), the PDRN fragment after ultrasonic fragmentation of the supernatant (lane 3), and the PDRN fragment after ultrasonic fragmentation of the suspension (lane 4); wherein, lane 1 is a 15kbDNAMarker. DETAILED DESCRIPTION

[0041] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments and diagrams.

[0042] Example 1

[0043] Step 1: Circularize ssDNA to obtain cssDNA by stepwise addition

[0044] (1) Using the salmon genome sequence as a reference, 6 ssDNAs (L1-L6) with a length of about 100 nt were randomly selected, and their nucleotide sequences were shown in SEQ ID NOs. 1-6; at the same time, a connecting primer splint (splint1-splint 6) was designed for each ssDNA, and its nucleotide sequence was shown in SEQ ID NOs. 7-12. ssDNA and splint were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0045] (2) Prepare the preparation solution according to Table 1: including 10 Weiss U T4 DNA ligase, splint, and 0.1× T4 DNA ligase buffer (4 mL Tris-HCl, 1 mM MgCl2, 1 mM DTT, 50 μm ATP, pH = 7.8, 25°C).

[0046] (3) Prepare the additive solution according to Table 1: including 0.1×T4 DNA ligase buffer (4 mL Tris-HCl, 1 mM MgCl2, 1 mM DTT, 50 μm ATP, pH=7.8, 25° C.) and ssDNA template. The ssDNA template is ssDNA with 5′-end phosphorylation.

[0047] Table 1

[0048]

[0049] (4) Add the additive solution to the preparation solution every 30 minutes, 10 times, 2 μL each time. After the addition of the additive solution, the reaction is extended for 5 hours and then terminated. The reaction temperature is 25°C to obtain cssDNA.

[0050] Denaturing polyacrylamide gel electrophoresis verification:

[0051] Prepare 12% denaturing polyacrylamide gel according to Table 2, and perform gel electrophoresis on the cssDNA obtained after ssDNA cyclization at a voltage of 100 V for 80 min. Observe the results on a gel imager, as shown in Figure 2. Figure 1 shown.

[0052] Table 2

[0053]

[0054] from Figure 1 It can be seen that L1-L6 all successfully obtained cyclization products.

[0055] Step 2: Amplify cssDNA by rolling circle amplification to obtain repetitive long single-stranded DNA

[0056] (1) Prepare the mixed system according to Table 3.

[0057] Table 3

[0058]

[0059] In Table 3, the amplification primer is a random primer with a phosphorylation modification at the 3' end, and the nucleotide sequence thereof is 5'-NNNNNN-3'; the mixed cssDNA is a mixture of cssDNA obtained by circularizing 6 ssDNAs.

[0060] (2) The mixed system was pre-denatured at 95°C for 5 min and then immediately annealed in an ice bath for 5 min.

[0061] (3) Add dNTPs, BSA and phi29 DNA polymerase to the mixed system according to Table 4 and incubate at 30°C for 4 h.

[0062] Table 4

[0063]

[0064] (4) After the incubation, the final system was heated to 65°C for 10 min and stored at 4°C for later use.

[0065] Agarose gel electrophoresis verification: weigh 1g agarose powder into a 250mL conical flask, add 100mL 1×TAE buffer to prepare 1% agarose gel, perform gel electrophoresis on the repetitive long single-stranded DNA obtained after cssDNA amplification, the voltage is 120V, the time is 80min, and the results are observed on the gel imager, such as Figure 2 shown.

[0066] Step 3: Ultrasonic break of repetitive long single-stranded DNA

[0067] The above-mentioned repetitive long single-stranded DNA was ultrasonically fragmented with an ultrasonic power of 300 W, a duty cycle of 2:1, and an ultrasonic time of 10 min.

[0068] Agarose gel electrophoresis verification: weigh 1g agarose powder into a 250mL conical flask, add 100mL 1×TAE buffer to prepare 1% agarose gel, perform gel electrophoresis on the repetitive long single-stranded DNA after ultrasonic treatment, the voltage is 120V, the time is 80min, and the results are observed on the gel imager, such as Figure 2 shown.

[0069] Step 4: Ethanol precipitation of PDRN fragments

[0070] Add sodium acetate solution (3M, pH=5.2) to the ultrasonically treated long single-stranded repetitive DNA to a final concentration of 0.3M and mix; add 2 times the volume of ice ethanol and mix; place at -20°C for 5h; centrifuge at 4°C and 12000rpm for 10min, and remove the supernatant; add half the volume of 75% ethanol, centrifuge at 4°C and 12000rpm for 10min, and remove the supernatant; evaporate the organic solvent in an open air; add ddH2O for re-dissolution to obtain a PDRN sample.

[0071] Nanodrop micro-spectrophotometer was used to measure the absorbance A of the above PDRN samples at 260nm and 280nm wavelengths. 260 and A 280 , calculate A 260 / A 280 The value is 1.79.

[0072] from Figure 2 It can be seen that long single-stranded DNA (lane 2) was obtained by rolling circle amplification, and its base length was broken into 50-500 bp after ultrasonic treatment.

[0073] Example 2

[0074] The method of Example 1 was followed, except that splint 1 to splint 6 were used as amplification products, and the mixed system was prepared according to Table 5.

[0075] Table 5

[0076]

[0077] 10×phi 29 DNA polymerase buffer 5μL

[0078]

[0079] Calculate A 260 / A 280 The value is 1.76.

[0080] from Figure 3 It can be seen that long single-stranded DNA (lane 3) was obtained by rolling circle amplification, and its base length was broken into 50-500 bp after ultrasonic treatment.

[0081] Example 3

[0082] Step 1: Same as Example 1.

[0083] Step 2: Amplify cssDNA by rolling circle amplification to obtain repetitive long single-stranded DNA

[0084] (1) Amplification primers P1, P2, and P3 were designed, and their nucleotide sequences are shown in SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15, which were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0085] (2) Prepare the mixed system according to Table 6.

[0086] Table 6

[0087]

[0088]

[0089] (3) Incubate the mixed system at 30°C for 4 h.

[0090] (4) Add P2 and P3 to the mixed system according to Table 6 and incubate at 30°C for 24 h.

[0091] Table 6

[0092]

[0093] (5) Incubate the mixture at 30°C overnight for 24 h.

[0094] (6) After the incubation, heat the final system to 65°C for 10 min and store at 4°C until use.

[0095] (7) The sample was centrifuged at 12000 rpm for 10 min, the supernatant was separated and collected, and deionized water 10 times the volume of the supernatant was added to the precipitate, and the mixture was vortexed until the precipitate was dispersed to obtain a suspension.

[0096] Agarose gel electrophoresis verification: weigh 1g agarose powder into a 250mL conical flask, add 100mL 1×TAE buffer to prepare 1% agarose gel, perform gel electrophoresis on the supernatant at a voltage of 120V for 80min, and observe the results on a gel imager. Figure 4 shown.

[0097] Step 3: Ultrasonication of the suspension and supernatant

[0098] The suspension and supernatant prepared in step 2 were subjected to ultrasonic disruption using an ultrasonic cell disruptor with an ultrasonic power of 300 W, a duty cycle of 2:1, and an ultrasonic time of 10 min. After ultrasonic treatment, it can be found that the suspension becomes a clear solution and the precipitate is dissolved.

[0099] Agarose gel electrophoresis verification: Weigh 1g agarose powder into a 250mL conical flask, add 100mL 1×TAE buffer to prepare 1% agarose gel, perform gel electrophoresis on the supernatant and the PDRN fragments after ultrasonic treatment of the suspension at a voltage of 120V for 80min, and observe the results on a gel imager, as shown in Figure 4 shown.

[0100] Step 4: Same as in Example 1. Calculate A 260 / A 280 The value is 1.77.

[0101] Repeat steps 2 and 3 to amplify and ultrasonically disrupt cssDNA (L2-L6), and mix the clarified solutions obtained to obtain a PDRN sample.

[0102] from Figure 4 It can be seen that long single-stranded DNA was obtained by rolling circle amplification (lane 2), the supernatant was subjected to ultrasonic treatment to break its base length to 50-500 bp (lane 3), and the suspension was subjected to ultrasonic treatment to break its base length to 50-500 bp (lane 4).

[0103] SEQ ID NO.1:

[0104] CTCTTGCTGTATCTCATTGAGTTGGGCCCTTAGGATGGTGCTCTAAG GGTGGGTATGGAGGTCCCTATACCCTCTATAAGTATTTAAAACCGT

[0105] SEQ ID NO.2:

[0106] CACACTTCTGTGAAATCAAACTGTCCACTTAGGAAGCAACACTGAT TGACAATAAATTTCACATGCTGTTGTGCAAATGGAATAGACAACAGGT

[0107] SEQ ID NO.3:

[0108] TAGCAGACGCTCTTATCCAGAGCGACTTACAAATTGGTGCATTCACC TTATGATATCCAGTGGAACAACCACTTTACAATAGTGCATC

[0109] SEQ ID NO.4:

[0110] TTAGGCCTGTCCAGAATGTCGCTTTTTCGGCATGATCGGAGTCATCGTTTTTAGGGACAAAATAGAAATCTGCAATTTTTTGTGAAAATGGTTTTAAATGTTTTTTTAGGCCTGTCCA

[0111] SEQ ID NO.5:

[0112] GGAAGTTACAATCCAAACACATAGTTGTGCTTGTTTTAACGTGGTGCCTCTATCGCGGAAGTTACAATCCAAACACACAGCTGTGCTTGTTTTAACGTGGTGCCTCTA

[0113] SEQ ID NO.6:

[0114] ACAGAGACTGACATTCCCATTAGTACTACAGTGTTACTGTATCTAGC TGATAAACAGAGACTGACAG

[0115] SEQ ID NO.7:

[0116] CAAGAGACGGTT

[0117] SEQ ID NO.8:

[0118] AGTGTGACCTGT

[0119] SEQ ID NO.9:

[0120] CTGCTAGATGCA

[0121] SEQ ID NO.10:

[0122] GCCTAATGGACA

[0123] SEQ ID NO.11:

[0124] ACTTCCTAGAGG

[0125] SEQ ID NO.12:

[0126] CTCTGTCTGTCA

[0127] SEQ ID NO.13:

[0128] ACTCAATGAGATACAGCA

[0129] SEQ ID NO.14:

[0130] GCTCTAAGGGTGGGTATG

[0131] SEQ ID NO.15:

[0132] GAGGGTATAGGGACCTCCATACC

[0133] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for preparing PDRN, characterized in that: The following steps are involved: S1, randomly select n ssDNA from the salmon genome sequence; S2, cyclizing the ssDNA to obtain cssDNA; S3, amplifying cssDNA to obtain repetitive long single-stranded DNA; S4. Break the repetitive long single-stranded DNA to obtain PDRN.

2. The preparation method of PDRN according to claim 1, characterized in that: Said n≥1; preferably, said n=6.

3. The preparation method of PDRN according to claim 1, characterized in that: The nucleotide sequence of the ssDNA is shown in SEQ ID NO.1-6.

4. The method for preparing PDRN according to any one of claims 1 to 3, characterized in that: The step S2 specifically includes the following steps: S21, design ligation primers; S22, preparing the preparation liquid and the additive liquid; The preparation solution comprises T4 DNA ligase, ligation primers and T4 DNA ligase buffer; The additive solution comprises T4 DNA ligase buffer and ssDNA template; S23. Gradually add the supplement solution to the preparation solution to circularize the ssDNA to obtain cssDNA.

5. The preparation method of PDRN according to claim 4, characterized in that: The nucleotide sequence of the connecting primer is shown in SEQ ID NO.7-12; Preferably, the ssDNA template is ssDNA with 5'-end phosphorylation; Preferably, the cyclization temperature is 23-27° C. and the time is 5-10 h.

6. The preparation method of PDRN according to claim 1, characterized in that: The step S3 specifically comprises the following steps: S31, design amplification primers; S32, prepare a mixed system, pre-denature at 95°C for 5 min, and anneal in an ice bath for 5 min; The mixed system comprises amplification primers, cssDNA and Phi29 DNA polymerase buffer; S33, adding dNTPs, BSA and Phi29 DNA polymerase to the mixed system for rolling circle amplification; S34. Inactivate the Phi29 DNA polymerase in the mixed system to obtain repetitive long single-stranded DNA.

7. The preparation method of PDRN according to claim 6, characterized in that: The amplification primer is a random primer with a thiolation modification at the 3' end, and the nucleotide sequence is 5'-NNNNNN-3'.

8. The preparation method of PDRN according to claim 6, characterized in that: The nucleotide sequences of the amplification primers are shown in SEQ ID NOs. 7-12.

9. The preparation method of PDRN according to claim 6, characterized in that: The nucleotide sequences of the amplification primers are shown in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.

15.

10. The method for preparing PDRN according to claim 6, characterized in that: The temperature of the rolling circle amplification is 30°C and the time is 3 to 4 hours; Preferably, the interruption is physical interruption, and more preferably ultrasonic treatment, with an ultrasonic power of 250 to 350 W, a duty cycle of 2:1, and an ultrasonic time of 5 to 15 min; Preferably, the base length of the PDRN is 50 to 500 bp. 260 / A 280 The value is 1.7~2.0.

Images