Super enhancer RNA BOB1-seRNA and application thereof

Abstract

The invention discloses a super enhancer RNABOB1-seRNA and application thereof, and belongs to the technical field of biological medicine. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1. Experiments further prove that the expression of the BOB1-seRNA in a patient with the coronary heart disease is reduced, and the BOB1-seRNA can be applied to preparation of a product for diagnosing or predicting the coronary heart disease. The molecular marker can be used for diagnosing the coronary heart disease in the early stage, is rapid and effective, has important significance on early treatment of the coronary heart disease and saving of medical cost, and provides a treatment target and an important basis for clinical application such as gene therapy and drug therapy.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a super enhancer RNA BOB1-seRNA and an application thereof. Background Art

[0002] Atherosclerosis is a chronic inflammatory disease caused by abnormal deposition of lipids in the arterial wall and is the main cause of cardiovascular and cerebrovascular diseases and deaths. Studies have shown that lipid-lowering therapy through statins and cholesterol absorption inhibitors can significantly reduce the risk of atherosclerosis and related diseases, but there is still a residual risk of cardiovascular disease. Related studies have shown that BOB1 protein plays a key role in reverse cholesterol transport and is involved in the development of atherosclerosis-related diseases.

[0003] In addition, new lipid-lowering drugs targeting RNA have outstanding performance in regulating lipid homeostasis, but their epigenetic mechanisms in maintaining cholesterol homeostasis are still unclear. Summary of the invention

[0004] The purpose of the present invention is to provide a super enhancer RNA BOB1-seRNA and its application to solve the problems existing in the above-mentioned prior art.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is a super enhancer RNA BOB1-seRNA, whose nucleotide sequence is shown in SEQ ID NO.1.

[0007] The second technical solution of the present invention is the use of the super enhancer RNA BOB1-seRNA in the preparation of a drug for preventing, alleviating and / or treating atherosclerosis.

[0008] The third technical solution of the present invention is a drug for preventing, alleviating and / or treating atherosclerosis, wherein the active ingredient of the drug includes a substance that promotes the expression of super enhancer RNA BOB1-seRNA.

[0009] A fourth technical solution of the present invention is the use of the super enhancer RNA BOB1-seRNA in the preparation of a product for predicting the risk of coronary heart disease.

[0010] Based on the above technical solution, the present invention has the following technical effects:

[0011] The present invention innovatively discovered the non-coding RNA BOB1-seRNA derived from the super enhancer through transcriptomic sequencing and corresponding bioinformatics analysis methods for patients with coronary heart disease, and it was significantly negatively correlated with the coronary risk of patients with dilated and coronary heart disease. A large number of animal experiments have confirmed that upregulating BOB1-seRNA can effectively lower blood lipids and reduce the number and area of ​​aortic plaques, thereby exerting an anti-atherosclerotic effect. In order to achieve the therapeutic purpose, the present invention applies human BOB1-seRNA to animal experiments, and the results show that its synthetic product can significantly improve the lipid imbalance and atherosclerotic plaque formation induced by the Western diet, ultimately providing a basis for the development of clinical coronary heart disease treatment drugs and risk prediction products. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0013] Figure 1 The results of detecting the lipid-lowering effect of super enhancer RNA BOB1-seRNA in vitro. A: Overexpression of super enhancer RNA BOB1-seRNA can significantly upregulate the expression of BOB1; B: Overexpression of super enhancer RNA BOB1-seRNA can significantly reduce intracellular lipid aggregation; C: Overexpression of super enhancer RNA BOB1-seRNA can significantly enhance the ability of cellular reverse cholesterol transport.

[0014] Figure 2 The results of detecting super enhancer RNA BOB1-seRNA in reducing blood lipids and improving liver steatosis in C57BL / C mice. A: Detecting the effect of injection of recombinant adeno-associated virus vector overexpressing super enhancer RNA BOB1-seRNA on plasma lipid levels; B: Detecting the effect of injection of recombinant adeno-associated virus vector overexpressing super enhancer RNA BOB1-seRNA on liver lipid deposition.

[0015] Figure 3The results of detecting the effect of super enhancer RNA BOB1-seRNA on improving arterial atherosclerosis in APOE- / - mice. A: Detecting the effect of injection of recombinant adeno-associated virus vector overexpressing super enhancer RNA BOB1-seRNA on the levels of plasma inflammatory factors (IL-1b, IL-6, MCP-1, TNF-a); B: Detecting the effect of injection of recombinant adeno-associated virus vector overexpressing super enhancer RNA BOB1-seRNA on the area of ​​aortic atherosclerosis; C: Detecting the effect of injection of recombinant adeno-associated virus vector overexpressing super enhancer RNA BOB1-seRNA on the size of aortic valve atherosclerotic plaques.

[0016] Figure 4 To detect the relationship between super enhancer RNA BOB1-seRNA and the risk of coronary artery disease in people with coronary heart disease. A: Patients with high super enhancer expression levels have lower Gensini scores and lower risk of coronary artery disease; B: Patients with high super enhancer expression levels have lower SYNTAX scores and lower risk of coronary artery disease. DETAILED DESCRIPTION

[0017] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0018] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0019] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0020] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0021] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0022] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0023] The embodiment of the present invention provides a super enhancer RNA BOB1-seRNA, whose nucleotide sequence is shown as SEQ ID NO.1.

[0024] The embodiments of the present invention also provide the use of the super enhancer RNA BOB1-seRNA in preparing a drug for preventing, alleviating and / or treating atherosclerosis.

[0025] The embodiment of the present invention further provides a drug for preventing, alleviating and / or treating atherosclerosis, wherein the active ingredient of the drug includes a substance that promotes the expression of super enhancer RNA BOB1-seRNA.

[0026] In some specific embodiments, the substance that promotes the expression of super enhancer RNA BOB1-seRNA includes a recombinant expression vector, an overexpression vector, an interference vector, a recombinant virus or a recombinant gene expression cassette that overexpresses BOB1-seRNA.

[0027] In some specific embodiments, the medicament further comprises a pharmaceutically acceptable excipient.

[0028] In some specific embodiments, the dosage form of the drug includes oral preparations, external preparations, injection preparations or molecular kits.

[0029] The embodiment of the present invention also provides the use of the super enhancer RNA BOB1-seRNA in preparing a product for predicting the risk of coronary heart disease.

[0030] The present invention further confirms through experiments that BOB1-seRNA is down-regulated in patients with coronary heart disease, and can be used in the preparation of products for diagnosing or predicting coronary heart disease. The molecular marker can be used to diagnose coronary heart disease in its early stages, which is fast and effective, and is not only of great significance for the early treatment of coronary heart disease and the saving of medical costs, but also provides a therapeutic target and important basis for clinical applications such as gene therapy and drug therapy.

[0031] Example 1

[0032] A total of 380 patients with coronary heart disease were selected from a tertiary hospital in Hubei Province during 2020-2022, including 211 males and 169 females, aged between 18 and 70 years old. Peripheral blood was collected for transcriptomic sequencing, and the results were imported into the bioinformatics website for subsequent analysis (the information analysis website is https: / / www.ncbi.nlm.nih.gov / ; https: / / www.ebi.ac.uk / ).

[0033] The full length of enhancer RNA BOB1-seRNA amplified by 5'RACE and 3'RACE is shown below:

[0034] SEQ ID NO.1: AGCTCAGGGCCCTCCGAACAAAGCAGCGCTCGGTGCCGGAC CTGCAGCTCTCCCCACCCGGCAGCAGCGCCCTCAGCACGCCCGGGAACCCCCGACCCCTGAGCCCGGGGTACTGCGCCCGGGTCTCCACGCCCAGAGATGCTCCCCGGTCTCCACCGTCGGGCAAGCCCCAAGCGCAGCAGCGCAGAGTCCTGGGGTCACCAGAGCTCGTACTAGGACATCGTCTCCCCATTTAACACCGCCTCCGGTCCCA TCTGAGTTGCAAGTGGTGGGGATGTGGGGCTCCGGATCAAAGTCCCCGAAACCGAGCACTTCCCGAAGCCTCCTTGGCCTCGAAACAAAACAATAACGCCCAAGCGACCTACTGCCTTGGAGATTCCCAGCCTGAGCTCCCCAGGTCCCTCAGAGGACCCGAGAGGAACATCTTACTGCTTCTCTTCATAAATTGAGAGGAAGGAGGCCACAAA.

[0035] The detailed sequence information of the super enhancer RNA BOB1-seRNA can be viewed directly at the following website: http: / / www.noncode.org / show_rna.php?id=NONHSAT133803&version=2&utd=1#.

[0036] 1. Cell culture

[0037] The THP-1 cell line is a human monocytic leukemia cell that grows in suspension. The cells are cultured in sterile 1640 complete medium containing 10% fetal bovine serum and supplemented with 1% penicillin-streptomycin to prevent contamination. The cell culture flask is placed in an incubator with appropriate humidity, temperature of 37°C, and CO2 concentration of 5%. When the cells reach the logarithmic growth phase, they can be passaged for subsequent experiments.

[0038] 2. Plasmid construction

[0039] Using human cDNA as a template, the full-length sequence of BOB1-seRNA was amplified by PCR. In order to clone the corresponding PCR into the pcDNA3.1 vector, Kpn I / MLu I restriction site sequences were introduced into the forward and reverse primers for full-length amplification. Identification of recombinant plasmids: The obtained recombinant plasmid solution and positive clone bacterial solution were sent to Wuhan Aoke Company for identification as recombinant plasmids by Sanger sequencing.

[0040] 3. Cell transfection

[0041] ① Passaging: After digesting the cells, inoculate them into a 24-well cell culture plate. When the cells grow to 50%-70%, transfection can be performed.

[0042] ②Mix 9ul transfection reagent, 200ul serum-free culture medium, and 10ul of the vector plasmid to be transfected together, mix well and let stand at room temperature for later use.

[0043] ③ Remove the old culture medium from the cells that need to be transfected and replace it with new culture medium.

[0044] ④Add the mixed solution prepared in step ② into the cells that need to be transfected.

[0045] ⑤After 3 days, replace the culture medium. At this time, the cells are successfully transfected and subsequent experiments can be carried out.

[0046] 4. qPCR experiment

[0047] (1) Cell RNA extraction

[0048] ① About 100 μL of cells were treated with 1 mL of Trizol solution (resuspended cells, vortexed for 10 seconds, allowed to stand at room temperature for 5 minutes, then 1 / 5 volume (200 μl) of chloroform (i.e., chloroform) was added, vortexed to mix, and allowed to stand for 15 minutes; then centrifuged at 4°C, 12,000 rpm for 10 minutes, and the upper aqueous phase was carefully pipetted into a new EP tube; 2.5 times the volume of anhydrous ethanol or an equal volume of isopropanol (RNA is insoluble in anhydrous ethanol / isopropanol, so RNA can be precipitated) was added, mixed, and placed in -20°C / -80°C for precipitation for more than 1 hour.

[0049] ② Centrifuge the precipitated sample at 4°C, 12000rpm for 15min, discard the supernatant and keep the precipitate; then wash the precipitate once with pre-cooled 75% ethanol and discard the supernatant. For the last time, try to completely remove the supernatant (use a 10μL small pipette to dry), and let it dry at room temperature for about 5min.

[0050] (2) Reverse transcription: cDNA synthesis

[0051] ① Take 10ul of RNA extracted from step (1), add the reverse transcription reagent of Novozymes, and use the reverse transcription program of the PCR instrument to perform the reverse transcription process to synthesize cDNA.

[0052] (3) qPCR

[0053] ① Take the cDNA obtained in step (2), add the qPCR reagent of Novozymes and the corresponding qPCR primers, mix them, and use a qPCR instrument to perform a qPCR experiment to obtain the results.

[0054] qPCR results showed that overexpression of super enhancer RNA BOB1-seRNA could significantly upregulate the expression of BOB1 ( Figure 1 (A).

[0055] 5. Immunofluorescence staining

[0056] ① THP-1 cells overexpressing BOB1-seRNA and THP-1 cells without intervention were inoculated into 24-well plates containing sterile cell slides, and then induced to differentiate into adherent cells with 100 nM PMA.

[0057] ② Add ox-LDL to the cell culture medium to a final concentration of 50 ng / mL and intervene for 24 hours to allow the cells to foam. No ox-LDL was added to the control group.

[0058] ③After the ox-LDL incubation, the cells were washed three times with 1×PBS, and then 500 μL of 10% neutral buffered formalin (NBF) was added to each well and fixed for 30 minutes.

[0059] ④Discard the fixative, add APOA1 staining solution, and stain for 30 minutes in the dark.

[0060] ⑤ Rinse and decolorize with 60% isopropanol 3 times.

[0061] ⑥ Stain the cell nucleus with fluorescent dye for 30 seconds, then wash the cells three times with 1× PBS (optional).

[0062] ⑦ Place the cell slides on a glass slide and seal them with glycerol gelatin. Finally, observe and photograph them under a fluorescence microscope.

[0063] The results of immunofluorescence staining experiments showed that overexpression of BOB1-seRNA significantly reduced intracellular lipid aggregation (see Figure 1 (middle B).

[0064] 6. Cholesterol efflux experiment

[0065] The cholesterol efflux assay is the most commonly used method to detect the cholesterol efflux rate.

[0066] ① The untreated THP-1 cells were used as the control group and inoculated into a 24-well cell culture plate with a cell density of 2.5×10 5 The cells were placed in a cell culture incubator at 37°C, 5% CO2 and appropriate humidity.

[0067] ②After 24 hours, THP-1 cells were treated with 100 nM PMA for 48 hours to induce their differentiation into adherent cells.

[0068] ③Discard the waste liquid, wash the cells twice with 1×PBS, then add 500 μL of 5 μM NBD cholesterol culture medium without phenol red to each well and incubate in an incubator overnight.

[0069] ④ The next day, discard the waste liquid, wash the cells twice with 1×PBS, then add 500 μL of HDL, ApoA-1, standard serum induced efflux solution and synchronization solution to each well, and continue culturing in the incubator for 4 hours.

[0070] ⑤ After the incubation, collect the cell supernatant into a new brown light-proof 1.5 mL EP tube. Then add 100 μL of cell supernatant to each well of a black 96-well ELISA plate and detect the fluorescence intensity using a fluorescence ELISA reader (excitation wavelength 469 nm, emission wavelength 537 nm).

[0071] ⑥ After washing the cells twice with 1×PBS, add 500μL 0.1% Triton X-100 to lyse the cells and shake on a horizontal shaker for 10 minutes. Use a pipette to blow the cell lysate evenly, then transfer it to a new brown light-proof 1.5ml EP tube and centrifuge it at 12,000g for 10 minutes. Then add the cell lysate to a black 96-well ELISA plate at 100μl / well, and then use a fluorescence ELISA reader to detect the fluorescence intensity of the sample.

[0072] ⑦ Calculate the cholesterol efflux rate by the following formula:

[0073] Cholesterol efflux rate = cell supernatant fluorescence value / (cell supernatant fluorescence value+cell lysate fluorescence value)×100%.

[0074] BOB1-seRNA was constructed in the pcDNA3.1 plasmid vector and the above steps were repeated. The specific steps were as follows:

[0075] ① THP-1 cells transfected with the plasmid vector pcDNA3.1 containing BOB1-seRNA were used as the experimental group and inoculated into a 24-well cell culture plate with a cell density of 2.5×10 per well. 5 The cells were placed in a cell culture incubator at 37°C, 5% CO2 and appropriate humidity.

[0076] ②After 24 hours, THP-1 cells were treated with 100 nM PMA for 48 hours to induce their differentiation into adherent cells.

[0077] ③Discard the waste liquid, wash the cells twice with 1×PBS, then add 500 μL of 5 μM NBD cholesterol culture medium without phenol red to each well and incubate in an incubator overnight.

[0078] ④ The next day, discard the waste liquid, wash the cells twice with 1×PBS, then add 500 μL of HDL, ApoA-1, standard serum induced efflux solution and synchronization solution to each well, and continue culturing in the incubator for 4 hours.

[0079] ⑤ After the incubation, collect the cell supernatant into a new brown light-proof 1.5 mL EP tube. Then add 100 μL of cell supernatant to each well of a black 96-well ELISA plate and detect the fluorescence intensity using a fluorescence ELISA reader (excitation wavelength 469 nm, emission wavelength 537 nm).

[0080] ⑥ After washing the cells twice with 1×PBS, add 500μL 0.1% Triton X-100 to lyse the cells and shake on a horizontal shaker for 10 minutes. Use a pipette to blow the cell lysate evenly, then transfer it to a new brown light-proof 1.5ml EP tube and centrifuge it at 12,000g for 10 minutes. Then add the cell lysate to a black 96-well ELISA plate at 100μl / well, and then use a fluorescence ELISA reader to detect the fluorescence intensity of the sample.

[0081] ⑦ Calculate the cholesterol efflux rate by the following formula:

[0082] Cholesterol efflux rate = cell supernatant fluorescence value / (cell supernatant fluorescence value+cell lysate fluorescence value)×100%.

[0083] Cholesterol efflux experiments showed that overexpression of BOB1-seRNA significantly enhanced the ability of cellular cholesterol reverse transport (see Figure 1 Middle C).

[0084] 7. ELISA

[0085] The enzyme-linked immunosorbent assay (ELISA) was performed using a kit provided by Xinbosheng to detect the inflammatory indicators of THP-1 cells overexpressing BOB1-seRNA and the inflammatory indicators of THP-1 cells without intervention: IL-1β, IL-6, MCP-1 and TNF-α. The specific steps are as follows:

[0086] ① According to the instructions of the kit, dilute the standard with the universal diluent for standard and specimen into 8 recommended concentration gradients, including the blank well. Add 100 μl of the sample to be tested and the diluted standard to each well, and only add the diluent to the blank control well. Seal the ELISA plate with a sealing film and incubate at 37°C in the dark for 90 minutes.

[0087] ②After the incubation, shake off and pat dry the waste liquid in the ELISA plate, add 350 μL 1× washing solution to each well, let it stand for 30 seconds, then shake off and pat dry the waste liquid.

[0088] ③Repeat step 2 for a total of 5 washes.

[0089] ④ Add 100 μL of diluent without biotinylated antibody to the control wells, and add 100 μL of working solution containing 1× biotinylated antibody to the remaining wells. After sealing the plate, incubate at 37°C in the dark for 60 minutes.

[0090] ⑤After incubation, shake off and pat dry the waste liquid, add 350μL 1× washing solution to each well, let it stand for 30 seconds, then shake off and pat dry.

[0091] ⑥ Repeat step 5, washing 5 times in total.

[0092] ⑦ Add 100 μL of enzyme conjugate diluent to the negative control wells and 100 μL of 1× enzyme conjugate working solution to the remaining wells. Seal the plate and incubate at 37°C in the dark for 30 minutes.

[0093] ⑧After incubation, shake off and pat dry the waste liquid, add 350μL 1× washing solution to each well, let it stand for 30 seconds, then shake off and pat dry.

[0094] ⑨Repeat step 8 for a total of 5 washes.

[0095] ⑩ Add 100 μL of colorimetric substrate to each well and incubate at 37°C in the dark for 15 minutes.

[0096] After incubation, shake off and pat dry the waste liquid, add 350 μL 1× washing solution to each well, let it stand for 30 seconds, then shake off and pat dry.

[0097] Repeat step 11 for a total of 5 washes.

[0098] Add 100 μL of stop solution to each well, mix well and measure the absorbance (OD value) at 450 nm using a microplate reader. To ensure the accuracy of the results, please measure within 3 minutes after adding the stop solution.

[0099] A standard curve was drawn using standards with different concentration gradients to calculate the specific concentration of each sample to be tested.

[0100] The results are as follows Figure 3 As shown in A, the values ​​of inflammatory indicators including IL-1β, IL-6, MCP-1, and TNF-α in THP-1 cells overexpressing BOB1-seRNA were significantly lower than those in the control group.

[0101] 8. Paraffin embedding and sectioning of liver tissue

[0102] ① After the model was established, the rats were anesthetized by intraperitoneal injection, and the thoracic aorta and abdominal aorta tissues were taken and placed in paraformaldehyde fixative and fixed at room temperature for 48 hours.

[0103] ② Dehydration. Dehydrate the fixed aorta tissue according to the following operating procedures: 50% ethanol solution for 1 hour → 70% ethanol solution for 1 hour → 80% ethanol solution for 1 hour → 90% ethanol solution for 0.5 hour → 95% ethanol solution for 0.5 hour → anhydrous ethanol for 0.5 hour → anhydrous ethanol for 0.5 hour.

[0104] ③ Transparent. Xylene solution 0.5h → Xylene solution 0.5h

[0105] ④ Penetration: 100% paraffin for 0.5h → 100% paraffin for 0.5h, in a 60℃ oven.

[0106] ⑤ Embedding. Place the tissue processed in the previous step into a mold filled with paraffin, fix the position of the aorta, and place it on the cold table of the embedding machine to cool.

[0107] ⑥ Slice. Place the fixed and embedded tissue block in the card slot of the slicer, slice it into 5μm thickness, then fix the sliced ​​tissue slices on a glass slide and dry them in a 60℃ oven for half an hour.

[0108] 9. HE staining of sections

[0109] ① Dewaxing. Place the slices in an oven at 75°C for 2 hours. Then perform dewaxing in the following order: xylene solution for 15 minutes → xylene solution for 15 minutes → xylene solution for 15 minutes → anhydrous ethanol for 5 minutes → anhydrous ethanol for 5 minutes → 95% ethanol solution for 120 seconds → 85% ethanol solution for 120 seconds → 70% ethanol solution for 120 seconds.

[0110] ② Staining. Staining was carried out according to the following steps: rinsing with tap water for 1 min → hematoxylin for 5 min → rinsing with tap water for 5 min → differentiation with hydrochloric acid ethanol solution for 3 s → blueing with tap water for 15 min → eosin for 30 s.

[0111] ③ Dehydration and sealing. Dehydration is carried out according to the following steps: 80% ethanol solution 120sec → 90% ethanol solution 120sec → 95% ethanol solution 120sec → 95% ethanol solution 120sec → anhydrous ethanol 120sec → anhydrous ethanol 120sec → xylene solution 10min → xylene solution 5min → use glycerol resin to seal the slide.

[0112] ④Subsequent analysis was performed using an optical microscope and ImageJ software. HE staining results showed that overexpression of BOB1-seRNA improved liver lipid deposition in C57BL / 6 mice (see Figure 2 Middle B)

[0113] 10. Oil Red O staining

[0114] ① Slice fixation: Place the frozen slices in the fixative and fix them at room temperature for 20 to 30 minutes. The fixation time can be adjusted according to the sample type and experimental requirements.

[0115] ② Washing: Use washing solution (such as 70% ethanol solution) to wash the slices to remove the residual fixative. The washing time should be moderate to avoid damage to the slices.

[0116] ③ Oil Red O staining: Place the slices in the Oil Red O staining solution and stain for 5 to 15 minutes. During the staining process, the slices should be gently shaken to ensure that the dye is evenly distributed.

[0117] ④ After dyeing, use detergent (such as 70% ethanol solution) to wash away excess dye, and then rinse with running water for 30 seconds.

[0118] ⑤Hematoxylin counterstaining: Place the sections in the hematoxylin staining solution and counterstain for 2 minutes. The counterstaining time should not be too long to avoid too dark staining of the cell nucleus.

[0119] ⑥After restaining, rinse the sections with running water to remove excess dye.

[0120] ⑦ Sealing: Use sealing medium (such as glycerol gelatin) to seal the slices to avoid fading caused by air contact. During the sealing process, ensure that the slices are flat and free of bubbles.

[0121] ⑧Observation and analysis: Observe the slices under a microscope and record the staining results. Fat usually appears dark orange-red or bright red, and the nucleus appears bluish-purple. Perform data analysis based on the experimental results to evaluate the lipid content and distribution.

[0122] 11. AAV8 virus packaging and gene delivery

[0123] The full-length BOB1-seRNA was cloned into the pAV-FH vector and sequenced to ensure the accuracy of the sequence. Adeno-associated virus serotype 8 (AAV8) was packaged, produced, purified, and titered by Shandong Weizhen Biotechnology. A single intravenous injection of the virus loaded with the BOB1-seRNA gene (1×10 11 8-week-old male C57BL / 6 mice were purchased from Beijing Huafukang Biotechnology Co., Ltd. and were adaptively fed for 1 week before the start of the experiment. ApoE- / - mice were fed a Western diet for 8 weeks before AAV8 injection for subsequent experiments. This study was approved by the Institutional Animal Research Committee of Tongji Medical College. The experimental animals were housed in the animal care facility of Tongji Medical College at 25°C with a light / dark cycle of 12 / 12 h, and mice were allowed free access to food and water throughout the study.

[0124] C57BL / 6 mice (n=12 per group) or ApoE- / - mice (n=10 per group) were randomly divided into rAAV8-Ctrl group and rAAV8-BOB1-seRNA group, and fed with Western diet (20 kcal% protein, 20 kcal% carbohydrate, 60 kcal% fat) for 16 weeks. No animals were culled during the experiment.

[0125] After the mice were treated, the above-mentioned related experiments were performed.

[0126] The specific experiments and experimental results are as follows: 1. Through enzyme-linked immunosorbent assay: In C57BL / 6 mice, BOB1-seRNA was overexpressed by recombinant viral vector to determine its effect of reducing plasma triglyceride and cholesterol levels (see Figure 2 2. Using liver weight and HE staining, overexpression of BOB1-seRNA in C57BL / 6 mice improved liver lipid deposition (see Figure 2 3. Overexpression of BOB1-seRNA by recombinant viral vector and ELISA assay showed that in APOE- / - mice, overexpression of BOB1-seRNA by recombinant viral vector could reduce the release of inflammatory factors (IL-1β, IL-6, MCP-1, TNF-α) in plasma (see Figure 3 4. Oil red O staining of aortic vessels showed that overexpression of BOB1-seRNA in APOE- / - mice improved atherosclerosis (see Figure 3 5. Oil red O staining of aortic valve showed that overexpression of BOB1-seRNA reduced the area of ​​atherosclerotic plaques (see Figure 3 Middle C).

[0127] 12. Isolation of human peripheral blood mononuclear cells

[0128] In this example, Ficoll separation solution was used to separate peripheral blood mononuclear cells (PBMCs) from patients diagnosed with coronary heart disease in a tertiary hospital in Wuhan, Hubei Province by density gradient centrifugation. The specific steps are as follows:

[0129] ① Dilute whole blood with an equal volume of 1× PBS and mix gently using a Pasteur pipette.

[0130] ② Add 15 mL of Ficoll separation solution to a 50 mL centrifuge tube.

[0131] ③ Slowly add the diluted whole blood into the centrifuge tube along the wall of the tube so that the blood cell suspension is superimposed on the Ficoll separation solution.

[0132] ④ Place the centrifuge tube in a horizontal centrifuge and centrifuge at 300g for 30 minutes. Pay attention to adjusting the centrifuge speed-up time. It is recommended to increase to the maximum speed within 2 minutes and set a slow deceleration to obtain the best gradient centrifugation effect.

[0133] ⑤After centrifugation, the liquid was observed to be divided into four layers: the upper layer was the plasma and PBS layer, the middle layer was the white cloudy mononuclear cell layer, the Ficoll separation liquid layer, and the bottom layer was the neutrophil and blood cell layer.

[0134] ⑥Use a Pasteur pipette to carefully aspirate the white cloudy mononuclear cell layer and transfer it to a new 15mL centrifuge tube.

[0135] ⑦ Add 1×PBS solution 3 times the volume of mononuclear cells to a new centrifuge tube to wash the cells, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.

[0136] ⑧ Repeat step 7 once. The resulting precipitate is peripheral blood mononuclear cells, which can be used for subsequent experiments.

[0137] In the coronary heart disease population, qPCR experiments were used to study the relationship between BOB1-seRNA expression levels and Genisin scores and SYNTAX scores, and it was found that it was significantly negatively correlated with the risk of coronary heart disease, that is, the higher the BOB1-seRNA expression level, the lower the risk of coronary artery disease in patients (see Figure 4 A and B)

[0138] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A super enhancer RNA BOB1-seRNA, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the super enhancer RNA BOB1-seRNA as claimed in claim 1 in the preparation of a drug for preventing, alleviating and / or treating atherosclerosis.

3. A drug for preventing, alleviating and / or treating atherosclerosis, characterized in that: The active pharmaceutical ingredient comprises a substance that promotes the expression of super enhancer RNA BOB1-seRNA.

4. The drug according to claim 3, characterized in that The substance promoting the expression of super enhancer RNA BOB1-seRNA includes a recombinant expression vector, an overexpression vector, an interference vector, a recombinant virus or a recombinant gene expression cassette that overexpresses BOB1-seRNA.

5. The drug according to claim 3, characterized in that The drug also includes pharmaceutically acceptable excipients.

6. The drug according to claim 3, characterized in that The dosage form of the drug includes oral preparations, external preparations, injection preparations or molecular kits.

7. Use of the super enhancer RNA BOB1-seRNA as claimed in claim 1 in preparing a product for predicting the risk of coronary heart disease.

Images