CRISPR / Cas12a-based protease detection kit and application thereof

Abstract

The invention discloses a protease detection kit based on CRISPR / Cas12a and application thereof, the kit comprises a polypeptide tag system, a CRISPR / Cas12a system and a DNA reporter probe, the polypeptide tag system comprises magnetic beads, polypeptide and a DNA detection probe, and the CRISPR / Cas12a system comprises Cas12a protein and crRNA; the polypeptide tag system is used for releasing a DNA (Deoxyribose Nucleic Acid) detection probe which can be complementary with crRNA of the CRISPR / Cas12a system as a DNA activation sequence after being cut by protease to be detected, so as to activate the trans-cleavage activity of Cas12a protein; crRNA of the CRISPR / Cas12a system can be specifically combined with a DNA activation sequence released by the polypeptide tag system, so that activated Cas12a is formed; the DNA reporter probe is labeled with a fluorophore and a quenching group and is used for cutting activated Cas12a to be degraded, so that a fluorescence signal is generated. The kit disclosed by the invention has the advantages of ultrasensitivity, simplicity and high specificity, particularly has potential application in MMP2 related biomedical research, clinical diagnosis and MMP2 drug or prodrug screening, and is expected to become a practical tool and a universal platform for clinical diagnosis.

Description

Technical Field

[0001] The present invention relates to the technical field of protease detection, and in particular to a CRISPR / Cas12a-based protease detection kit and applications thereof. Background Art

[0002] Proteases play key roles in many biological processes, such as digestion, cell growth and proliferation, apoptosis, and immune responses. This makes proteases closely related to many diseases, including infectious diseases, autoimmunity, and cancer. The main function of proteases is to catalyze specific cleavage events, and many pathogens carry proteases that are essential for their viability and infectivity. In recent years, proteases have become one of the most attractive targets in the field of drug discovery, and several protease inhibitors have been used clinically. Matrix metalloproteinases (MMPs) belong to zinc-dependent endopeptidases and play important roles in a variety of biological processes, including cell migration, embryonic development, and tissue repair. Among them, matrix metalloproteinase-2 (MMP2), as an important class of MMPs, has been found to be overexpressed in many cancers, such as breast cancer, pancreatic cancer, gastric cancer, and lung cancer, and is closely related to cancer invasion, angiogenesis, metastasis, and treatment effects. In addition, abnormal expression of MMP2 is also associated with human leukemia and myelodysplasia. Therefore, MMP2 may become a potential biomarker and therapeutic target, and accurate detection of its expression is helpful for the study of tumor metastasis. However, due to the low abundance of MMP2 in human blood and the high complexity of clinical samples, the sensitive detection of MMP2 still faces great challenges. Therefore, it is crucial to develop a simple, sensitive and selective MMP2 activity detection strategy.

[0003] Traditional methods for detecting MMP2 activity include enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance (SPR), gas chromatography / mass spectrometry (GC / MS), gelatin zymography based on gel electrophoresis, etc. These methods are standard methods for detecting MMP2 activity and have the advantages of sensitivity and specificity. However, these laboratory-based methods are time-consuming, technically demanding and expensive, which greatly limits their application. In recent years, in order to overcome these limitations, some alternative new methods have emerged, such as nanoparticle-based separation, magnetic resonance imaging, colorimetric assay, fluorescence resonance energy transfer (FRET), bioluminescence resonance energy transfer, fluorescence measurement, etc. These methods have high enzyme cleavage specificity, but their sensitivity cannot surpass the specific activity of the enzyme to its substrate peptide. At the same time, these methods also have many limitations, such as complex nanomaterial synthesis systems, high cost and time-consuming. Therefore, the development of a simple, rapid and highly sensitive MMP2 detection method remains a challenging and urgent task.

[0004] The CRISPR / Cas system is a clustered regularly interspaced short palindromic repeats-associated protein system originally discovered in bacteria and archaea, and is now widely used in gene editing and expression regulation. Studies in recent years have shown that a variety of CRISPR / Cas systems can be used as highly sensitive and selective nucleic acid detection tools, including CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas13a or CRISPR / Cas14a systems. Among them, CRISPR / Cas12a (cpf1) can specifically recognize double-stranded DNA (dsDNA) or single-stranded DNA (ssDNA), and activate its reverse cleavage activity by guiding the designed crRNA, thereby degrading ssDNA. The system shows obvious advantages in the selective and sensitive detection of pathogens, viruses, enzymes, metal ions and other nucleic acid or non-nucleic acid targets. However, the simple, rapid, highly sensitive and highly specific MMP2 detection based on the CRISPR / Cas system is still blank.

[0005] It should be noted that the information disclosed in the above background technology section is only used for understanding the background of the present application, and therefore may include information that does not constitute prior art known to ordinary technicians in the field. Summary of the invention

[0006] In order to make up for the deficiencies of the prior art, the present invention provides a protease detection kit based on CRISPR / Cas12a and its application.

[0007] The present invention adopts the following technical solution:

[0008] In the first aspect, a CRISPR / Cas12a-based protease detection kit is provided, which includes a polypeptide tag system, a CRISPR / Cas12a system and a DNA reporter probe, wherein the polypeptide tag system includes magnetic beads, polypeptides and DNA detection probes, and the CRISPR / Cas12a system includes Cas12a protein and crRNA, wherein: the polypeptide tag system is used to release a DNA detection probe complementary to the crRNA of the CRISPR / Cas12a system as a DNA activation sequence after being cut by the protease to be tested, so as to activate the trans-cutting activity of the Cas12a protein; the crRNA of the CRISPR / Cas12a system can specifically bind to the DNA activation sequence released by the polypeptide tag system to form an activated Cas12a; the DNA reporter probe is labeled with a fluorescent group and a quenching group, and is used to be cut and degraded by the activated Cas12a, thereby generating a fluorescent signal.

[0009] In a second aspect, a method for preparing a protease detection kit based on CRISPR / Cas12a according to the first aspect is provided, comprising the following steps:

[0010] (1) preparing a polypeptide labeling system: a polypeptide and a DNA detection probe are placed in a phosphate buffer to form a polypeptide-DNA probe, and then the polypeptide-DNA probe and magnetic beads are placed in a phosphate buffer to form the polypeptide labeling system;

[0011] (2) Preparing a CRISPR / Cas12a system: mixing Cas12a protein, crRNA and NEBuffer 2.1 buffer to form the CRISPR / Cas12a system;

[0012] (3) The DNA reporter probe, polypeptide labeling system and CRISPR / Cas12a system are combined into a kit.

[0013] In a third aspect, a method for detecting a protease for non-diagnostic purposes is provided, comprising the following steps:

[0014] (1) mixing and incubating the sample to be tested and the polypeptide tag system in the CRISPR / Cas12a-based protease detection kit described in the first aspect in TCNB buffer, magnetically separating, and collecting the supernatant;

[0015] (2) After incubating the supernatant, the DNA reporter probe and the CRISPR / Cas12a system, the fluorescence intensity is used to determine whether the protease to be tested exists in the sample to be tested and / or to calculate the concentration of the protease to be tested.

[0016] In a fourth aspect, a CRISPR / Cas12a-based protease detection kit according to the first aspect is provided for use in the screening of protease inhibitors.

[0017] The present invention has the following beneficial effects: after being cleaved by the protease to be tested, the polypeptide tag system in the CRISPR / Cas12a-based protease detection kit of the present invention will release a DNA activation sequence that is complementary to the crRNA of the CRISPR / Cas12a system to activate the trans-cleavage activity of the Cas12a protein, and the crRNA of the CRISPR / Cas12a system can specifically bind to the DNA activation sequence released by the polypeptide tag system, and generate a fluorescent signal by cleaving the DNA reporter probe to detect the protease to be tested. The kit has the advantages of ultra-sensitivity, simplicity, and high specificity, and has potential applications in MMP2-related biomedical research, clinical diagnosis, and MMP2 drug or prodrug screening, and is expected to become a practical tool and universal platform for clinical diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the detection principle of the kit in the embodiment of the present invention.

[0019] Figure 2A-2C This is a characterization diagram of the successful preparation of the polypeptide-DNA probe in Example 2.

[0020] Figure 3 This is a diagram verifying the feasibility of the kit (Peptide-Cas) in Example 3 for detecting MMP2.

[0021] Figure 4 This is the result of optimizing the detection conditions of the kit in Example 4.

[0022] Figure 5A-5B This is the result of the sensitivity analysis of the kit in Example 5.

[0023] Figure 6 This is the result of the specific analysis of the kit in Example 5.

[0024] Figure 7 This is the result of detecting the MMP2 inhibitor using the kit in Example 6.

[0025] Figure 8 This is the result of the test kit in Example 7 detecting the serum spiked sample.

[0026] FIG. 9 is the result of the kit in Example 8 detecting the cell lysate sample. DETAILED DESCRIPTION

[0027] The following is a detailed description of the embodiments of the present invention. It should be emphasized that the following description is only exemplary and is not intended to limit the scope and application of the present invention. In the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other.

[0028] A specific embodiment of the present invention provides a protease detection kit based on CRISPR / Cas12a, which comprises:

[0029] (1) A polypeptide tag system, which is used to release a DNA detection probe complementary to the crRNA of the CRISPR / Cas12a system as a DNA activation sequence after being cleaved by the protease to be tested, so as to activate the trans-cleavage activity of the Cas12a protein, including magnetic beads, polypeptides and DNA detection probes.

[0030] (2) CRISPR / Cas12a system, including Cas12a protein and CRISPR RNA (crRNA), crRNA can specifically bind to the DNA activation sequence released by the polypeptide tag system to form activated Cas12a;

[0031] (3) A DNA reporter probe, which is labeled with a fluorescent group and a quenching group, and is used to be cut and degraded by the activated Cas12a, thereby generating a fluorescent signal. In some embodiments, the amino acid sequence of the polypeptide in the polypeptide tag system is shown in SEQ ID NO: 1, which is: KKGPLGVRGK, the N-terminus of the polypeptide is modified with maleimido alanine, and the C-terminus is modified with biotin, that is, the sequence of the polypeptide is Mal-KKGPLGVRGK (Biotin).

[0032] In some embodiments, the base sequence of the DNA detection probe in the polypeptide tag system is shown in SEQ ID NO: 2, which is: TTTTTGTTGTAGTATGGGCTTTGAT; wherein the 5' end of the sequence of the DNA detection probe has an SH-C6 modification, that is, the sequence of the DNA detection probe is SH-C6-TTTTTGTTGTAGTATGGGCTTTGAT.

[0033] In some embodiments, the magnetic beads are streptavidin-coated magnetic beads.

[0034] In some embodiments, the protease to be detected is a matrix metalloproteinase, preferably, the protease to be detected is matrix metalloproteinase-2.

[0035] In some embodiments, the base sequence of the crRNA in the CRISPR / Cas12a system is as shown in SEQ ID NO: 3, which is: UAAUUUCUACUAAGUGUAGAUAUCAAAGCCCAUACUACAAC (expressed in the sequence table as: TAATTTCTACTAAGTGTAGATATCAAAGCCCATACTACAAC).

[0036] In some embodiments, the base sequence of the DNA reporter probe is: TTATTA, preferably, the fluorescent group is FAM, and the quenching group is BHQ1.

[0037] The specific embodiment of the present invention also provides a method for preparing the CRISPR / Cas12a-based protease detection kit, comprising the following steps:

[0038] (1) Preparation of polypeptide labeling system: The polypeptide and the DNA detection probe form a conjugate (i.e., polypeptide-DNA probe) in phosphate buffered saline (PBS), and then the polypeptide-DNA probe and magnetic beads are added to PBS to form a magnetic bead-polypeptide-DNA detection probe complex, i.e., polypeptide labeling system.

[0039] The phosphate buffer is 0.1M phosphate buffer (pH 6.8-7.4, 0.1M NaCl); in the polypeptide labeling system, the final concentration of the polypeptide-DNA probe is 1 μM, and the final concentration of the magnetic beads is 1 mg / mL;

[0040] (2) Preparation of CRISPR / Cas12a system: Cas12a protein and crRNA are reacted in a buffer named NEBuffer2.1 to form a Cas12a / crRNA complex, i.e., the CRISPR / Cas12a system.

[0041] The composition of the NEBuffer 2.1 buffer is 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9.

[0042] (3) The DNA reporter probe, polypeptide labeling system and CRISPR / Cas12a system are combined into a kit.

[0043] The specific embodiment of the present invention also provides a method for detecting a protease for non-diagnostic purposes, which comprises the following steps:

[0044] (1) The sample to be tested and the polypeptide tag system in the CRISPR / Cas12a-based protease detection kit are mixed and incubated in TCNB buffer, magnetically separated, and the supernatant is collected.

[0045] Preferably, the composition of the TCNB buffer is: 50 mM Tris, 10 mM CaCl2, 150 mM NaCl, 0.05% (w / v) Brij 35, pH 7.5; preferably, the incubation time of step (1) (i.e., the cleavage time of the protease) is 2.5 h, and in the incubation system of step (1), the concentration of the polypeptide-DNA probe in the polypeptide labeling system is preferably 1 μM, and the concentration of the magnetic beads is preferably 1 mg / mL.

[0046] (2) After incubating the supernatant, the DNA reporter probe and the CRISPR / Cas12a system, the fluorescence intensity is used to determine whether the test sample contains the test protease and / or calculate the concentration of the test protease, wherein a microplate reader is used to record the fluorescence data (λex=480nm) to obtain the fluorescence intensity.

[0047] Preferably, the incubation time in step (2) (i.e., the cleavage time of Cas12a protein) is 40 min;

[0048] A specific embodiment of the present invention also provides an application of the CRISPR / Cas12a-based protease detection kit in the screening of protease inhibitors.

[0049] The following further describes specific embodiments of the present invention. The experimental methods in the following embodiments, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial sources. The quantitative tests in the following embodiments are all set up for at least three repeated experiments, and the results are averaged.

[0050] Marimastat: Shanghai MCE Company.

[0051] Human blood samples were obtained from Shenzhen Second People's Hospital according to a clinical research protocol approved by the Institutional Review Board (IRB, No. 2020014).

[0052] Herein, room temperature refers to 20-30°C.

[0053] Example 1. Preparation of a kit (hereinafter referred to as "Peptide-Cas") and construction of a biosensor system for detecting MMP2

[0054] 1. Preparation of the kit

[0055] The kit provided in this embodiment includes a polypeptide tag system, a CRISPR / Cas12a system and a DNA reporter probe, as follows:

[0056] 1) Peptide tag system: used to release a DNA activation sequence complementary to the CRISPR RNA (crRNA) of the CRISPR / Cas12a system after being cut by MMP2 to activate the trans-cutting activity of the Cas12a protein.

[0057] The polypeptide labeling system is a complex of magnetic beads, polypeptides and DNA detection probes, and its preparation process is as follows: first, the DNA detection probe, polypeptide and phosphate buffer (PBS) (pH=6.8-7.4, 0.1M NaCl) are mixed to obtain a polypeptide-DNA probe. Then, the polypeptide-DNA probe, magnetic beads and PBS are mixed, wherein the final concentrations of the polypeptide-DNA probe and the magnetic beads are 1μM and 1mg / mL respectively, and the obtained system is rotated and reacted at room temperature for 30min, and the obtained complex is the polypeptide labeling system. The magnetic beads are streptavidin-coated magnetic beads (purchased from Thermo Fisher Scientific). The sequence of the polypeptide is: Mal-KKGPLGVRGK (Biotin) (SEQ ID NO: 1), and the polypeptide sequence is synthesized by Shanghai Chupeptide Biotechnology Co., Ltd. The sequence of the DNA detection probe is: SH-C6-TTTTTGTTGTAGTATGGGCTTTGAT (SEQ ID NO: 2).

[0058] 2) CRISPR / Cas12a system: including Cas12a protein (NEB (Beijing) Company, Catalog No.: M0653T) and crRNA. The CRISPR / Cas12a system is formed by Cas12a protein and crRNA in NEBuffer 2.1 buffer (10mM Tris-HCl, 50mM NaCl, 10mM MgCl2 and 100μg / mL BSA, pH 7.9). Among them, the sequence of crRNA is: UAAUUUCUACUAAGUGUAGAUAUCAAAGCCCAUACUACAAC (SEQ ID NO: 3).

[0059] 3) DNA reporter probe: Its base sequence is TTATTA, and it is labeled with a fluorescent group FAM and a quenching group BHQ1. The peptide labeling system, CRISPR / Cas12a system and DNA reporter probe are combined into a kit.

[0060] 2. Construction of MMP2 Detection Biosensor System

[0061] In order to detect MMP2, an MMP2 detection biosensor system was constructed, which includes the above-mentioned kit, TCNB buffer and MMP2. The detection process of the MMP2 detection biosensor system is as follows: first mix MMP2, polypeptide label system and TCNB buffer (50mM Tris, 10mM CaCl2, 150mM NaCl, 0.05% (w / v) Brij 35, pH7.5), and incubate at 37°C for 2.5h. After magnetic separation, take the supernatant, and then add the DNA reporter probe and Cas12a / crRNA complex (ie, CRISPR / Cas12a system), and incubate at 37°C for 40min. Finally, use a microplate reader to record the fluorescence data (λex=480nm). The detection principle is as follows Figure 1 As shown (described in detail in Example 5 below).

[0062] Example 2: Successful Verification of Synthesis of Peptide-DNA Probe and Feasibility Verification of MMP2 Cleavage of Peptide-DNA Probe

[0063] 1. High performance liquid chromatography-mass spectrometry and polyacrylamide gel electrophoresis analysis

[0064] The polypeptide-DNA probe obtained in Example 1 was subjected to high performance liquid chromatography-mass spectrometry and polyacrylamide gel electrophoresis analysis, and a pure DNA detection probe was set as a control, and a polypeptide-DNA probe containing MMP2 was set as a control. Among them, the polypeptide-DNA probe containing MMP2 was prepared by mixing MMP2, the polypeptide-DNA probe and TCNB buffer (50mM Tris, 10mM CaCl2, 150mM NaCl, 0.05% (w / v) Brij 35, pH 7.5), and incubating at 37°C for 2.5h.

[0065] High performance liquid chromatography-mass spectrometry (HPLC-MS): The polypeptide-DNA probe obtained above was subjected to chromatography-mass spectrometry detection in a high performance liquid chromatography-mass spectrometer. The results are as follows: Figure 2A-2C The molecular weight of the pure DNA probe is about 8128 ( Figure 2A ), which is consistent with the expected result. After the pure DNA probe is coupled with the polypeptide sequence, a larger molecular weight spectrum can be observed ( Figure 2B ), which is consistent with the expected molecular weight of the peptide-DNA probe, indicating that the peptide-DNA probe has been successfully prepared.

[0066] Polyacrylamide gel electrophoresis (PAGE) analysis: The polypeptide-DNA probe obtained above was subjected to polyacrylamide gel electrophoresis (PAGE) analysis. Figure 2CAs shown. The molecular weight of pure DNA is about 25 nt (lane 1), which is consistent with the expected sequence (TTTTTGTTGTAGTATGGGCTTTGAT). After the peptide was connected, a new band with a larger molecular weight appeared in lane 2. The PAGE analysis results showed that the peptide-DNA probe was successfully synthesized ( Figure 2C After adding MMP2, the migration speed of the peptide-DNA probe band accelerated, but was slightly higher than the pure DNA sequence in the control lane 1, indicating that the peptide-DNA probe had been cleaved by MMP2, proving that MMP2 can significantly cleave the synthetic peptide-DNA probe.

[0067] Example 3: Feasibility verification of MMP2 detection biosensor system

[0068] In order to verify the feasibility of Peptide-Cas, the MMP2 detection biosensor system constructed in Example 1 was used for detection, and the detection process was the same as in Example 1. No addition of MMP2 was set as a control.

[0069] The results are as follows Figure 3 As shown, in the absence of MMP2 ( Figure 3 The fluorescence signal was almost invisible, indicating that no free DNA activation sequence was generated. However, compared with the case without target, when the target MMP2 was present ( Figure 3 The fluorescence signal is significantly enhanced, indicating that the free DNA activation sequence after MMP2 cleavage triggers the trans-cleavage activity of Cas12a, causing the degradation of the DNA reporter probe labeled with the fluorescent group / quencher group, thereby generating a fluorescent signal. The above results fully demonstrate the feasibility of Peptide-Cas and are suitable for detecting MMP2. This is a potential universal platform for MMP2 detection.

[0070] Example 4: Optimization of conditions to improve Peptide-Cas detection performance

[0071] In order to optimize the detection performance of the proposed kit, this embodiment optimizes the detection conditions of MMP2, including the concentration of the polypeptide-DNA probe, the concentration of the magnetic beads, the MMP2 cleavage time, and the Cas12a cleavage time.

[0072] 1. The effect of different concentrations of peptide-DNA probes on signal intensity was explored. The concentration of magnetic beads was 1 mg / mL, the cutting time of MMP2 was 2.5 h, and the cutting time of Cas12a was 40 min. The concentrations of peptide-DNA probes were set to 0.25, 0.5, 1, 2, and 3 μM for experiments. It was found that when 1 μM peptide-DNA probe was used, the fluorescence value ratio (F / F0) of positive and negative samples in the detection of MMP2 was the highest, and the discrimination between positive and negative samples was the greatest ( Figure 4 Figure A).

[0073] 2. The effect of different magnetic bead concentrations on signal intensity was tested. According to the concentration of the peptide-DNA probe of 1 μM, the cutting time of MMP2 was 2.5 h, and the cutting time of Cas12a was 40 min. The concentrations of magnetic beads in the system were set to 0.4, 0.6, 0.8, 1, and 2 mg / mL, respectively. It was found that when 1 mg / mL magnetic beads were used, the F / F0 value in MMP2 detection was the highest, and the discrimination between positive and negative samples was the greatest ( Figure 4 Figure B).

[0074] 3. The effect of MMP2 cleavage time on signal intensity was studied. According to the concentration of peptide-DNA probe of 1 μM, the concentration of magnetic beads of 1 mg / mL, and the cleavage time of Cas12a of 40 min, the cleavage time of MMP2 in the reaction system was set to 0.5, 1, 1.5, 2, 2.5, and 3 h, respectively. It was found that with the increase of MMP2 cleavage time, the fluorescence value ratio F / F0 of positive and negative samples gradually increased and then stabilized. When the cleavage time of MMP2 was 2.5 h, the F / F0 value in MMP2 detection was the highest, and the discrimination between positive and negative samples was the greatest ( Figure 4 Figure C).

[0075] 4. The effect of Cas12a cutting time on signal intensity was tested. According to the concentration of peptide-DNA probe of 1μM, the concentration of magnetic beads of 1mg / mL, and the cutting time of MMP2 of 2.5h, the cutting time of Cas12a was set to 2-90min, with a time interval of 2min. It was found that with the increase of time, the fluorescence signal of the positive sample gradually increased and then stabilized, while the fluorescence signal of the negative sample only increased slightly. Comprehensively considered, when the cutting time of Cas12a was 40min, the fluorescence value F / F0 value in MMP2 detection was the highest, and the discrimination between positive and negative samples was the greatest ( Figure 4 Figure D).

[0076] Based on the above results, 1 μM polypeptide-DNA probe, 1 mg / mL magnetic beads, 2.5 hMMP2 cleavage time and 40 min Cas12a cleavage time were used in subsequent experiments.

[0077] Example 5: Kit for MMP2 Detection and Analysis

[0078] Matrix metalloproteinase-2 (MMP2), as an important class of MMPs, has been found to be overexpressed in many cancers, such as breast cancer, pancreatic cancer, gastric cancer and lung cancer, and is closely related to cancer invasion, angiogenesis, metastasis and treatment effects. In addition, abnormal expression of MMP2 is also associated with human leukemia and myelodysplasia. Therefore, MMP2 may become a potential biomarker and therapeutic target, and accurate detection of its expression will help in the study of tumor metastasis. However, due to the low abundance of MMP2 in human blood and the high complexity of clinical samples, sensitive detection of MMP2 still faces great challenges. Therefore, for the application of the kit to the detection of non-nucleic acid targets, MMP2 is used as a model target, and the schematic diagram of the detection principle is shown in the following figure. Figure 1 shown.

[0079] 1. Detection of MMP2

[0080] According to the method of step 2 of Example 1, MMP2 was detected.

[0081] The polypeptide tag system carries a free region complementary to the CRISPR RNA (crRNA) of the CRISPR / Cas12a system, i.e., a DNA activation sequence, by MMP2 to the cutting of the polypeptide-DNA probe in the polypeptide tag system, after magnetic separation, the cut DNA activation sequence will eventually activate the trans-cutting activity of Cas12a, so that the DNA reporter probe labeled with a fluorescent group / quenching group is degraded, thereby generating a fluorescent signal. Specifically, the biotinylated DNA-polypeptide coupling probe (i.e., the polypeptide-DNA probe obtained in Example 1) includes two functional domains, i.e., a peptide chain domain (KKGPLG-VRGK) with an MMP2 specific substrate effect and a DNA activation sequence domain interacting with Cas12a protein, and a DNA activation sequence (i.e., a DNA detection probe) is complementary to the CRISPR RNA (crRNA) in the CRISPR / Cas12a system. This biotinylated DNA-polypeptide coupling probe can be self-assembled on streptavidin-coated magnetic beads (MB), and is realized by specific streptavidin-biotin interactions. In the case of MMP2 in the sample to be tested, MMP2 will cut the polypeptide sequence, and the DNA activation sequence will be released through magnetic separation. Subsequently, the released DNA activation sequence acts on the CRISPR / Cas12a system, and the trans-cutting activity of Cas12a will be activated, that is, the DNA activation sequence and the crRNA of the CRISPR / Cas12a system are specifically combined to form activated Cas12a, and when the activated Cas12a cuts the DNA reporter probe with a fluorescent group (such as FAM) and a quencher group (such as BHQ1), the DNA reporter probe labeled with a fluorescent group / quencher group is degraded, thereby generating a fluorescent signal. On the contrary, if there is no MMP2 in the sample to be tested, the DNA activation sequence will not be released, and after magnetic separation, the supernatant will not contain the DNA activation sequence. Therefore, Cas12a will not be activated, resulting in no fluorescent signal being generated in the system. In this way, it is possible to judge whether MMP2 exists by monitoring the fluorescence intensity of the system (fluorescence intensity is higher than that of the blank group).

[0082] Since the concentration of MMP2 in real samples is usually very small, excellent sensitivity is essential for detecting trace amounts of MMP2 in real samples. Therefore, the present invention uses different concentrations of MMP2 under optimal conditions to evaluate the sensitivity of the proposed method, and the concentration of MMP2 is set to 0, 5pM, 10pM, 20pM, 50pM, 100pM, 200pM, 500pM, 1nM, 2nM, and 5nM. The fluorescence spectra of these experiments show that as the concentration of MMP2 increases, the fluorescence intensity gradually increases ( Figure 5A shown).

[0083] Next, a standard curve was plotted based on different concentrations of MMP2 and its corresponding fluorescence intensity at 520 nm ( Figure 5B The standard curve showed that there was a linear relationship between fluorescence intensity and MMP2 concentration in the range of 5-500 pM. According to the 3σ rule (calculated as the concentration response of the negative control sample plus three times the standard deviation), the limit of detection (LOD) was determined to be 2.62 pM.

[0084] 2. Specificity detection

[0085] In addition, selectivity was verified using samples with different interfering substances, including BSA, MMP7, MMP9, actin, IgG, urea, Mg, etc. at a concentration of 30 nM. 2+ and S-adenosylmethionine (SAM) and 2 U / μL of phi29 DNA polymerase, DNA ligase, and human purine / pyrimidine endonuclease 1 (APE1).

[0086] The results are as follows Figure 6 As shown, the MMP2 group (containing 5 nM MMP2 and no interfering substances) and the MMP2-containing mixture group (containing 5 nM MMP2 and 30 nM BSA, MMP7, MMP9, actin, IgG, urea, Mg 2+ The fluorescence signals of the two groups containing interfering substances (SAM and 2U / μL of phi29 DNA polymerase, DNA ligase, and human purine / pyrimidine endonuclease 1 (APE1)) were significantly higher, while only weak fluorescence reactions were observed in samples with other interfering substances, even when the concentration of the interfering substances was higher than that of MMP2. This indicates that the system has almost no cross-reaction with other targets, indicating that Peptide-Cas is highly selective.

[0087] Example 6: Kit for the detection and analysis of MMP2 inhibitors

[0088] It has been reported that MMP2 overexpression has been detected in patients with a variety of tumors. Therefore, screening potential MMP2 small molecule inhibitors is of great significance for the discovery of anticancer drugs, and sensitive MMP2 inhibitor detection and quantification methods are urgently needed. Here, an effective MMP2 small molecule inhibitor, Marimastat (BB-2516), was selected as a model inhibitor.

[0089] The present invention studies the relative activity of MMP2 at different concentrations of BB-2516 under optimal conditions. It is found that the relative activity of MMP2 gradually decreases with the increase of BB-2516 concentration ( Figure 7), indicating that BB-2516 effectively inhibited MMP2 activity. The half-inhibition value (IC50) of BB-2516 was 6.72nM, which is consistent with previous reports. These results strongly prove that Peptide-Cas is trustworthy in the screening of MMP2 inhibitors.

[0090] Example 7: Kit for testing and analyzing serum spiked samples

[0091] In order to further study the applicability of Peptide-Cas in complex samples, the present invention added different concentrations of MMP2 into inactivated 0.1% normal human serum to prepare spiked samples.

[0092] The present invention uses the optimized conditions described in Example 4 to perform analysis and calculates the recovery of serum spiked samples ( Figure 8 ). In addition, the present invention also studied the repeatability of the determination method (as shown in Table 1 below). It was found that when different concentrations of MMP2 were added alone to a 1000-fold diluted serum sample, the recovery rate was between 93.0% and 105.7%, and the relative standard deviation was less than 10%, indicating that Peptide-Cas has excellent accuracy. These results show that Peptide-Cas performs well in anti-interference performance and is suitable for clinical sample application.

[0093] Table 10. Recovery experiment for detection of MMP2 in 1% human serum

[0094]

[0095] Note: a. The results are expressed as mean ± standard deviation (n = 3). b. Recovery rate (%) = recovery amount / spiked amount × 100%. c. Relative standard deviation CV (%) = SD / mean × 100%.

[0096] Example 8: Kit for cell lysate detection and analysis

[0097] The present invention evaluated the MMP2 activity in five cancer cell lines, HeLa, MCF-7, HepG-2, HCT116 and MDA-MB-231, and two normal cell lines, HEK293T and MCF-10A.

[0098] The results are as follows Figures 9A-9B As shown, the fluorescence signals of the five cancer cell lines were found to be significantly stronger than those of the two normal cell lines (e.g. Fig. 9AIn addition, the fluorescence signals generated by HCT116 and MDA-MB-231 cells were significantly stronger than those of MCF-7 and HeLa cells, indicating that the overexpression level of MMP2 was higher in the more malignant cell lines compared with the less malignant cell lines (as shown in Figure 2A). Fig. 9A shown).

[0099] In addition, the fluorescence intensity associated with different numbers of HCT-116 cells was evaluated (e.g. Fig. 9B It was found that the fluorescence intensity (y) was linearly correlated with the logarithm of the number of HCT116 cells (C) in the range of 1 to 10,000 cells, as represented by the equation y = 158.9lgC + 212.4 (R 2 =0.9807). The limit of detection (LOD) was determined to be 1 cell. These findings demonstrate the potential of the proposed method in clinical applications.

[0100] The above content is a further detailed description of the present invention in combination with specific / preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, without departing from the concept of the present invention, it can also make several substitutions or modifications to these described embodiments, and these substitutions or modifications should be regarded as belonging to the protection scope of the present invention. In the description of this specification, the description of the reference terms "an embodiment", "some embodiments", "preferred embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in combination with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily target the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In the absence of mutual contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples. Although the embodiments of the present invention and their advantages have been described in detail, it should be understood that various changes, substitutions and modifications can be made herein without departing from the scope of protection of the patent application.

Claims

1. A protease detection kit based on CRISPR / Cas12a, characterized in that: It includes a polypeptide labeling system, a CRISPR / Cas12a system and a DNA reporter probe, wherein the polypeptide labeling system includes magnetic beads, polypeptides and DNA detection probes, and the CRISPR / Cas12a system includes Cas12a protein and crRNA, wherein: The polypeptide tag system is used to release a DNA detection probe complementary to the crRNA of the CRISPR / Cas12a system as a DNA activation sequence after being cleaved by the protease to be tested, so as to activate the trans-cleavage activity of the Cas12a protein; The crRNA of the CRISPR / Cas12a system can specifically bind to the DNA activation sequence released by the polypeptide tag system to form an activated Cas12a; The DNA reporter probe is labeled with a fluorescent group and a quenching group for being cut and degraded by the activated Cas12a, thereby generating a fluorescent signal.

2. The CRISPR / Cas12a-based protease detection kit according to claim 1, characterized in that The amino acid sequence of the polypeptide in the polypeptide tag system is shown in SEQ ID NO: 1, which is: KKGPLGVRGK; preferably, the N-terminus of the polypeptide is modified with maleimido alanine, and the C-terminus of the polypeptide is modified with biotin.

3. The CRISPR / Cas12a-based protease detection kit according to claim 1, characterized in that The base sequence of the DNA detection probe in the polypeptide tag system is shown in SEQ ID NO: 2, which is: TTTTTGTTGTAGTATGGGCTTTGAT; preferably, the 5' end of the sequence of the DNA detection probe has SH-C6 modification.

4. The CRISPR / Cas12a-based protease detection kit according to claim 1, characterized in that The magnetic beads are streptavidin-coated magnetic beads; preferably, the base sequence of the DNA reporter probe is: TTATTA, preferably, the fluorescent group is FAM, and the quenching group is BHQ1.

5. The CRISPR / Cas12a-based protease detection kit according to claim 1, characterized in that The protease to be detected is a matrix metalloproteinase, preferably, the protease to be detected is matrix metalloproteinase-2.

6. The CRISPR / Cas12a-based protease detection kit according to claim 1, characterized in that The base sequence of the crRNA in the CRISPR / Cas12a system is shown in SEQ ID NO: 3, which is: UAAUUUCUACUAAGUGUAGAUAUCAAAGCCCAUACUACAAC.

7. A method for preparing a CRISPR / Cas12a-based protease detection kit according to any one of claims 1 to 6, characterized in that: The steps include: (1) Preparing a polypeptide labeling system: a polypeptide and a DNA detection probe are placed in a phosphate buffer to form a polypeptide-DNA probe, and then the polypeptide-DNA probe and magnetic beads are placed in a phosphate buffer to form the polypeptide labeling system; preferably, the phosphate buffer is a 0.1 M phosphate buffer containing 0.1 M NaCl and a pH of 6.8-7.4; preferably, in the polypeptide labeling system, the final concentration of the polypeptide-DNA probe is 1 μM, and the final concentration of the magnetic beads is 1 mg / mL; (2) Preparing a CRISPR / Cas12a system: mixing Cas12a protein, crRNA and NEBuffer 2.1 buffer to form the CRISPR / Cas12a system; preferably, the composition of the NEBuffer 2.1 buffer is: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9; (3) The DNA reporter probe, polypeptide labeling system and CRISPR / Cas12a system are combined into a kit.

8. A method for detecting a protease for non-diagnostic purposes, characterized in that: The steps include: (1) Mixing and incubating the sample to be tested and the polypeptide tag system in the CRISPR / Cas12a-based protease detection kit according to any one of claims 1 to 6 in TCNB buffer, magnetically separating, and collecting the supernatant; preferably, the composition of the TCNB buffer is: 50mM Tris, 10mM CaCl2, 150mM NaCl, 0.05% (w / v) Brij 35, pH 7.5; (2) After incubating the supernatant, the DNA reporter probe and the CRISPR / Cas12a system, the fluorescence intensity is used to determine whether the test sample contains the test protease and / or to calculate the concentration of the test protease; preferably, a microplate reader is used to record the fluorescence data under an excitation light with a wavelength of 480 nm to obtain the fluorescence intensity.

9. The detection method according to claim 8, characterized in that: The incubation time in step (1) is 2.5 h; the incubation time in step (2) is 40 min; in the incubation system of step (1), the concentration of the polypeptide-DNA probe in the polypeptide labeling system is preferably 1 μM, and the concentration of the magnetic beads is preferably 1 mg / mL.

10. Use of the CRISPR / Cas12a-based protease detection kit according to any one of claims 1 to 6 in the screening of protease inhibitors.

Images