SSR molecular marker primer related to meat percentage character of procambarus clarkia and application of SSR molecular marker primer in assisted selection

Abstract

The invention belongs to the technical field of animal molecular marker screening and application. In particular to an SSR molecular marker primer related to the meat percentage character of procambarus clarkii and application of the SSR molecular marker primer in auxiliary selection. The method comprises the following steps: performing correlation analysis on meat content related character phenotypes of two full-sib families, four natural populations and four rice-shrimp co-culture populations of procambarus clarkii by using SSR markers to perform PCR (Polymerase Chain Reaction) amplification on collected samples to obtain target fragments and using genotypes detected by polyacrylamide gel electrophoresis; and identifying a QTL (Quantitative Trait Loci) associated with the meat percentage character. By screening the dominant genotype of the SSR marker, the procambarus clarkii strain with high meat content is bred in an assisted manner. The molecular marker primer disclosed by the invention can be used for rapidly screening out a group with a high meat content character; the repeatability in different groups is high; meanwhile, the dominant genotype identified by the application corresponds to the high meat percentage character, and the effect is remarkable.

Description

Technical Field

[0001] The invention belongs to the technical field of animal molecular marker screening and application, and specifically relates to SSR molecular marker primers related to the meat content trait of Procambarus clarkii and their application in auxiliary selection. Background Art

[0002] Procambarus clakii, commonly known as crayfish, belongs to the phylum Arthropoda, class Crustacea, order Decapoda, family Cambaridae, genus Procambarus (Hobbs, 1974). It was introduced from Japan to Nanjing, my country in 1929 and gradually spread to major water systems in southern my country (Li Yanhe et al., 2013).

[0003] At present, the development of the crayfish industry is facing the difficulties of germplasm innovation and new variety breeding. Molecular breeding has a series of advantages such as genetic stability and high breeding efficiency. The use of molecular markers will be more conducive to the selection of new crayfish varieties with advantageous economic traits. Meat content is a quantitative trait controlled by multiple genes, namely quantitative trait loci (QTLs). The genetic analysis of important economic traits of crayfish is still relatively lagging, and the analysis of the genetic basis controlling the meat content trait is still in its infancy. Simple sequence repeat markers (SSR) are widely used in genetic diversity analysis, genetic map construction, QTL positioning and other studies due to their advantages such as wide distribution throughout the genome, co-dominant inheritance, and easy polymerase chain reaction (PCR) detection (Kuleung et al., 2004).

[0004] The SSR markers of the present invention can be used for genetic diversity analysis of Procambarus clarkii populations, QTL positioning using full-sib families or natural populations combined with phenotypic data, and provide gene resources and functional markers for molecular breeding of Procambarus clarkii. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the prior art, screen a batch of SSR molecular marker primers related to the meat content trait of Procambarus clarkii, and use the marker primers to perform assisted selection of Procambarus clarkii strains. The present invention overcomes the difficulties of long traditional selection and breeding cycle and poor genetic stability of Procambarus clarkii, and uses SSR markers and full-sib families, natural random populations, and rice-shrimp co-cultivation populations to identify molecular markers associated with the meat content trait through association analysis to improve the efficiency of assisted selection.

[0006] The technical solution of the present invention is as follows:

[0007] The SSR molecular marker primer pair associated with the meat content-related traits of Procambarus clarkii, the DNA sequence of the molecular marker primer pair is as follows, and the sequence direction is 5'-3':

[0008] PCM 2092 forward primer (SEQ ID NO: 1): CCCTCGCTCCCTCTCTTATC,

[0009] PCM 2092 reverse primer (SEQ ID NO: 2): TGGGTAACCCGACCTGTCTA;

[0010] PCM 2717 forward primer (SEQ ID NO: 3): CGGTTTTGTTGCTGCTGTTA,

[0011] PCM 2717 reverse primer (SEQ ID NO: 4): AACGACAACATTACCGTCTTCA;

[0012] PCM 687 forward primer (SEQ ID NO: 5): AAAGGATTAATGCCCAACCA,

[0013] PCM 687 reverse primer (SEQ ID NO: 6): TCCTCATCAGATCTCCCACTTT;

[0014] PCM 126 forward primer (SEQ ID NO: 7): CAAATGAGCTTTGCAGAACTTT,

[0015] PCM 126 reverse primer (SEQ ID NO: 8): ATGTGATGGTGAACGAGCTG;

[0016] PCM 850 forward primer (SEQ ID NO: 9): TCAACAGCTTCCATCAGCAT,

[0017] PCM 850 reverse primer (SEQ ID NO: 10): CTTCCCTACAGAAGCGTTGC;

[0018] PCM 210 forward primer (SEQ ID NO: 11): TGCTTGACAAGAAGGTGTGG,

[0019] PCM 210 reverse primer (SEQ ID NO: 12): TGGTCAAGAACTTTGCTCCTT;

[0020] PCM 2578 forward primer (SEQ ID NO: 13): CCTCTTCCTGTTTCCCCTCT,

[0021] PCM 2578 reverse primer (SEQ ID NO: 14): TGACCAATTACGCAGTGAGG;

[0022] PCM 1155 forward primer (SEQ ID NO: 15): ACATGGTCCATCCTCCTTTG,

[0023] PCM 1155 reverse primer (SEQ ID NO: 16): TTCTAGCAACCAAACTTTCCAA;

[0024] PCM 2038 forward primer (SEQ ID NO: 17): TCCGTAGGTACCAACTCTTCTCA,

[0025] PCM 2038 reverse primer (SEQ ID NO: 18): CGTGTTAGTCTTGCGTTTCG.

[0026] A SSR molecular marker primer related to the meat content trait of Procambarus clarkii and its application in auxiliary selection, wherein the method comprises the following steps:

[0027] (1) A population for association analysis of Procambarus clarkii was constructed, including two full-sib families raised in indoor circulating water, four natural populations raised in pond cages, and four rice-shrimp co-cultivation populations. The number of samples in each population was at least 120, and the male-female ratio was approximately 1:1. The culture conditions of individuals in the same population were the same, including initial body length, body weight and other phenotypes, water quality conditions, and feed supply. After two to three months of culture, the phenotypes of meat content-related traits (tail muscle weight / body weight (MW / BW), claw weight / body weight (CHW / BW)) were measured and muscle DNA was collected.

[0028] (2) Based on the genome sequencing data of Procambarus clarkii, primers were designed to amplify the target fragment. Each pair of primers was used for PCR amplification separately, and the reaction system was 4 μL 10× PCR buffer, 1 μL forward primer and 1 μL reverse primer (10 μM), 2 μL genomic DNA, 0.5 μL r-Taq, 2 μL dNTP (2 mM) and 4.5 μL ddH2O in a 15 μL reaction system. The PCR reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; annealing at 58°C / 55°C for 30 s; extension at 72°C for 30 s; after 35 cycles, extension at 72°C for another 7 min; storage at 4°C.

[0029] (3) The amplified PCR products were subjected to electrophoresis using a 4% polyacrylamide gel. After the electrophoresis, they were stained with a 0.2% silver nitrate solution and then developed with a 0.5 M sodium hydroxide solution containing a 0.5% formaldehyde solution. The genotype of the population in step (1) was then read.

[0030] (4) Perform association analysis on the phenotype of meat content-related traits of the individuals in the group described in step (1) in combination with the corresponding marker genotypes in step (3). Since the meat content of male and female Procambarus clarkii is significantly different, the individuals in the group are separated by sex for association analysis. Using the one-way analysis of variance method, the molecular markers that are associated with the meat content phenotype and can be detected repeatedly are identified (P < 0.05).

[0031] (5) The genotypes identified in step (3) were divided into two categories: homozygous and heterozygous, and then association analysis was performed according to step (4) to identify molecular markers with hybrid vigor that can be repeated between populations (P < 0.05).

[0032] (6) In each population, the top 10% and bottom 10% of the individuals ranked from high to low in phenotypic value are selected to form a large group and a small group. The dominant genotype and the inferior genotype are determined by comparing the genotype distribution numbers of the markers identified in steps (4) and (5) in the large and small groups.

[0033] The present invention mainly solves the following technical problems:

[0034] The development of the crayfish industry faces the difficult problem of germplasm innovation and new variety breeding. Molecular breeding has a series of advantages such as genetic stability and high breeding efficiency. Developing molecular markers related to meat content traits and using molecular markers to assist in the selection of populations with high meat content traits can speed up breeding efficiency and be more conducive to the selection of new crayfish varieties with advantageous economic traits.

[0035] The present invention has the following advantages:

[0036] (1) The molecular markers of the present invention are easy to use and can quickly screen out a population with a high meat content trait.

[0037] (2) The molecular markers of the present invention are highly reproducible in different populations.

[0038] (3) The dominant genotype identified by the present invention corresponds to the trait of high meat content, and the effect is significant. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1-8:Comparative analysis of genotypes and phenotypes of large and small groups in the population Pop3-Pop10 of Procambarus clarkii. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii.

[0040] Figure 1 :Comparative analysis of genotypes and phenotypes of the large and small groups in the Pop3 population of Procambarus clarkii. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of the large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes in the large and small groups of Procambarus clarkii.

[0041] Figure 2 :Comparative analysis of genotypes and phenotypes of large and small groups in Pop4 of Procambarus clarkii population. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii.

[0042] Figure 3 :Comparative analysis of genotypes and phenotypes of the large and small groups in the Pop5 population of Procambarus clarkii. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of the large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes in the large and small groups of Procambarus clarkii.

[0043] Figure 4 :Comparative analysis of genotypes and phenotypes of large and small groups in Pop6 of Procambarus clarkii. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii.

[0044] Figure 5 :Comparative analysis of genotypes and phenotypes of large and small groups in Pop7 of Procambarus clarkii population. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii.

[0045] Figure 6:Comparative analysis of genotypes and phenotypes of large and small groups in Pop8 of Procambarus clarkii. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii.

[0046] Figure 7 :Comparative analysis of genotypes and phenotypes of large and small groups in Pop9 of Procambarus clarkii population. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii.

[0047] Figure 8 :Comparative analysis of genotypes and phenotypes of large and small groups in the Pop10 population of Procambarus clarkii. Figure A is the comparison of SSR marker genotypes of Procambarus clarkii; Figure B is the comparative analysis of muscle weight / body weight (MW / BW) and claw weight / body weight (CHW / BW) of large and small groups of Procambarus clarkii; Figure C is the comparative analysis of the proportion of dominant genotypes of large and small groups of Procambarus clarkii. DETAILED DESCRIPTION

[0048] Example 1 Identification of SSR markers associated with meat content using full-sib families

[0049] (1) In 2020, two full-sib families (Pop1 and Pop2) were constructed by male-female mating, with a population size of 214 and 133, respectively, and a sex ratio of approximately 1:1. After hatching, the full-sib families were cultured in single cages (12×15×15 cm) in an indoor flow-through culture system. After growing into adults, the phenotypes of meat content-related traits (muscle weight / body weight (MW / BW), claw weight / body weight (CHW / BW)) were measured and shrimp muscle DNA was collected.

[0050] (2) 300 pairs of polymorphic SSR markers developed based on the genome sequencing data of Procambarus clarkii were selected (Shi et al., 2018; Sun et al., 2021) [Note: The molecular markers in the patented SSR molecular marker primers related to growth traits of Procambarus clarkii and their application in assisted selection (Patent No.: ZL 202111680733.0) overlap with two of the nine primer sequences (PCM 2092 and PCM 2578) applied in this paper, that is, the primer sequences are consistent, and the other primer sequences have not been reported. The nine markers applied in this paper have not been reported to be related to the meat content trait]. The target fragment was amplified using muscle DNA of full-sib families. The primer sequences are shown in Table 1. Each pair of primers was used for PCR amplification separately, and the reaction system was 4 μL 10× PCR buffer, 1 μL forward primer and 1 μL reverse primer (10 μM), 2 μL genomic DNA, 0.5 μL r-Taq, 2 μL dNTP (2 mM) and 4.5 μL ddH2O in a 15 μL reaction system. The PCR reaction conditions were: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s; 58°C / 55°C annealing for 30 s; 72°C extension for 30 s; after 35 cycles, 72°C extension for another 7 min; 4°C storage.

[0051] (3) The amplified PCR products were subjected to electrophoresis using 4% polyacrylamide gel. After electrophoresis, they were first stained with 0.2% silver nitrate solution and then developed with 0.5 M sodium hydroxide solution containing 0.5% formaldehyde solution. The genotype statistical analysis of the population described in step (1) was then performed.

[0052] (4) Association analysis was performed on the phenotypes of the meat content-related traits of the individuals in the group described in step (1) in combination with the corresponding marker genotypes in step (3). Since the meat content of male and female crayfish differed significantly, the association analysis was performed separately for the male and female individuals in the group. Using the one-way analysis of variance method, molecular markers associated with the phenotypes of the meat content-related traits were identified (P < 0.05). The results are shown in Table 2.

[0053] (5) The genotypes obtained in step (4) were integrated and divided into two categories: homozygous and heterozygous. Association analysis was then performed according to the method in step (4) to identify molecular markers with hybrid vigor (P < 0.05). The results are shown in Table 3.

[0054] Example 2: Identification of SSR markers associated with meat content using natural populations

[0055] (1) From 2021 to 2023, four natural populations (Pop3, Pop4, Pop5, and Pop6) of intact crayfish of the same size (3-4 cm in length) were randomly selected from ponds each year, with a population size of 138, 288, 192, and 230, and a female-to-male ratio of approximately 1:1. After the natural populations were cultured in single cages (20×15×30 cm) in ponds for 2-3 months, the phenotypes of meat content-related traits (muscle weight / body weight (MW / BW), claw weight / body weight (CHW / BW)) were measured, and shrimp muscle DNA was collected.

[0056] (2) 300 pairs of polymorphic SSR markers developed based on the genome sequencing data of Procambarus clarkii (Shi et al., 2018; Sun et al., 2021) were selected and amplified using muscle DNA of natural populations (Pop3, Pop4, Pop5 and Pop6). The primer sequences are shown in Table 1. Each pair of primers was PCR amplified separately. The reaction system was: 4 μL 10× PCR buffer, 1 μL forward primer and 1 μL reverse primer (10 μM), 2 μL genomic DNA, 0.5 μL r-Taq, 2 μL dNTP (2 mM) and 4.5 μL ddH2O in a 15 μL reaction system. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 58℃ / 55℃ annealing for 30 s; 72℃ extension for 30 s; after 35 cycles, extend at 72℃ for another 7 min; store at 4℃.

[0057] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; annealing at 58°C / 55°C for 30 s; extension at 72°C for 30 s; after 35 cycles, extension at 72°C for another 7 min; and storage at 4°C.

[0058] (3) electrophoresing the amplified PCR products using a 4% polyacrylamide gel, staining them with a 0.2% silver nitrate solution, and then developing the color with a 0.5 M sodium hydroxide solution containing a 0.5% formaldehyde solution, and performing genotypic statistical analysis on the population described in step (1);

[0059] (4) Association analysis was performed on the phenotypes of the meat content-related traits of the individuals in the group described in step (1) in combination with the corresponding marker genotypes in step (3). Since the meat content of male and female crayfish differed significantly, the association analysis was performed separately for the male and female individuals in the group. Using the one-way analysis of variance method, molecular markers associated with the phenotypes of the meat content-related traits were identified (P < 0.05). The results are shown in Table 2.

[0060] (5) The genotypes obtained in step (4) were integrated and divided into two categories: homozygous and heterozygous. Association analysis was then performed according to the method in step (4) to identify molecular markers with hybrid vigor (P < 0.05). The results are shown in Table 3.

[0061] (6) In each population (Pop3-Pop6), the top 10% and bottom 10% of individuals ranked from high to low in phenotypic values ​​were selected to form large and small groups, respectively. The dominant and inferior genotypes were determined by comparing the number of genotype distributions of markers in the large and small groups.

[0062] (7) By comparing the proportion of dominant genotypes in the small group and the large group, it can be found that the proportion of dominant genotypes in the large group is much greater than that in the small group (MW / BW, 46%>29%). Pop3 , 55%>40% Pop4 , 44%>19% Pop5 , 43%>17% Pop6 ; CHW / BW, 46%>21% Pop3 , 50%>35% Pop4 , 39%>25% Pop5 , 40%>25% Pop6 ), corresponding to the phenotypic differences related to meat content, see Figure 1 to Figure 4 shown.

[0063] Example 3: Identification of SSR markers associated with meat content using rice-shrimp co-culture populations

[0064] (1) In 2023, 200 adult shrimps were randomly sampled from four rice-shrimp farming ponds to form four populations (Pop7, Pop8, Pop9, and Pop10), with a female-to-male ratio of approximately 1:1. The phenotypes of meat content-related traits (muscle weight / body weight (MW / BW), claw weight / body weight (CHW / BW)) were measured and shrimp muscle DNA was collected.

[0065] (2) 300 pairs of polymorphic SSR markers developed based on the genome sequencing data of Procambarus clarkii (Shi et al., 2018; Sun et al., 2021) were selected and amplified using muscle DNA of natural populations (Pop7, Pop8, Pop9 and Pop10). The primer sequences are shown in Table 1. Each pair of primers was PCR amplified separately. The reaction system was: 4 μL 10× PCR buffer, 1 μL forward primer and 1 μL reverse primer (10 μM), 2 μL genomic DNA, 0.5 μL r-Taq, 2 μL dNTP (2 mM) and 4.5 μL ddH2O in a 15 μL reaction system. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 58℃ / 55℃ annealing for 30 s; 72℃ extension for 30 s; after 35 cycles, 72℃ extension for another 7 min; 4℃ storage.

[0066] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; annealing at 58°C / 55°C for 30 s; extension at 72°C for 30 s; after 35 cycles, extension at 72°C for another 7 min; and storage at 4°C.

[0067] (3) electrophoresing the amplified PCR products using a 4% polyacrylamide gel, staining them with a 0.2% silver nitrate solution, and then developing the color with a 0.5 M sodium hydroxide solution containing a 0.5% formaldehyde solution, and performing genotypic statistical analysis on the population described in step (1);

[0068] (4) Association analysis was performed on the phenotypes of the meat content-related traits of the individuals in the group described in step (1) in combination with the corresponding marker genotypes in step (3). Since the meat content of male and female crayfish differed significantly, the association analysis was performed separately for the male and female individuals in the group. Using the one-way analysis of variance method, molecular markers associated with the phenotypes of the meat content-related traits were identified (P < 0.05). The results are shown in Table 2.

[0069] (5) The genotypes obtained in step (4) were integrated and divided into two categories: homozygous and heterozygous. Association analysis was then performed according to the method in step (4) to identify molecular markers with hybrid vigor (P < 0.05). The results are shown in Table 3.

[0070] (6) In each population (Pop7-Pop10), the top 10% and bottom 10% of individuals ranked from high to low in phenotypic values ​​were selected to form large and small groups, respectively. The dominant and inferior genotypes were determined by comparing the number of genotype distributions of markers in the large and small groups.

[0071] (7) By comparing the proportion of dominant genotypes in the small group and the large group, it can be found that the proportion of dominant genotypes in the large group is much greater than that in the small group (MW / BW, 48%>28%).Pop7 , 48%>31% Pop8 , 43%>24% Pop9 , 38%>18% Pop10 ; CHW / BW, 48%>29% Pop7 , 53%>33% Pop8 , 45%>27% Pop9 , 37%>18% Pop10 ), corresponding to the phenotypic differences related to meat content, see Figures 5 to 8 shown.

[0072] Table 1 Molecular marker primer sequences related to meat content trait screened by the present invention

[0073]

[0074] Table 2 QTL identification of meat content-related traits of Procambarus clarkii “√” indicates that the marker is associated with the meat content trait of the family / population (P < 0.05).

[0075]

[0076] Table 3 Identification of heterotic loci for traits related to meat content in Procambarus clarkii “√” indicates that the marker is associated with the meat content trait of the family / population (P < 0.05).

[0077]

Claims

1. SSR molecular marker primers associated with traits related to meat content of Procambarus clarkii, characterized in that: The DNA sequence of the molecular marker primer is as follows: PCM 2092 forward primer (5'-3'): CCCTCGCTCCCTCTCTTATC, PCM 2092 reverse primer (5′-3′): TGGGTAACCCGACCTGTCTA; PCM 2717 forward primer (5'-3'): CGGTTTTGTTGCTGCTGTTA, PCM 2717 reverse primer (5′-3′): AACGACAACATTACCGTCTTCA; PCM 687 forward primer (5'-3'): AAAGGATTAATGCCCAACCA, PCM 687 reverse primer (5′-3′): TCCTCATCAGATCTCCCACTTT; PCM 126 forward primer (5'-3'): CAAATGAGCTTTGCAGAACTTT, PCM 126 reverse primer (5′-3′): ATGTGATGGTGAACGAGCTG; PCM 850 forward primer (5'-3'): TCAACAGCTTCCATCAGCAT, PCM 850 reverse primer (5′-3′): CTTCCCTACAGAAGCGTTGC; PCM 210 forward primer (5'-3'): TGCTTGACAAGAAGGTGTGG, PCM 210 reverse primer (5′-3′): TGGTCAAGAACTTTGCTCCTT; PCM 2578 forward primer (5'-3'): CCTCTTCCTGTTTCCCCTCT, PCM 2578 reverse primer (5′-3′): TGACCAATTACGCAGTGAGG; PCM 1155 forward primer (5'-3'): ACATGGTCCATCCTCCTTTG, PCM 1155 reverse primer (5′-3′): TTCTAGCAACCAAACTTTCCAA; PCM 2038 forward primer (5'-3'): TCCGTAGGTACCAACTCTTCTCA, PCM 2038 reverse primer (5'-3'): CGTGTTAGTCTTGCGTTTCG.

2. A method for mining SSR molecular markers to assist in the selection of high meat content strains of Procambarus clarkii, characterized in that: The method comprises the following steps: (1) Two full-sib families of Procambarus clarkii, four natural populations, and four rice-shrimp co-culture populations were constructed, with the population of each population >120 and a female-to-male ratio of 1:

1. The full-sib families were cultured in single cages in an indoor flow-through culture system, and the natural populations were cultured in single cages in pond cages. After each population grew to adult shrimp or was cultured for a period of time, the meat content phenotype was measured and the muscles of Procambarus clarkii were collected for genomic DNA extraction. (2) Selecting polymorphic SSR markers developed based on the genome sequencing data of Procambarus clarkii, designing primers to amplify the target fragment, and using agarose electrophoresis to detect whether the target fragment is amplified; PCR detection conditions are as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 58℃ / 55℃ annealing for 30 s; 72℃ extension for 30 s; after 35 cycles, extend at 72℃ for another 7 min; store at 4℃; (3) electrophoresing the amplified PCR products using a 4% polyacrylamide gel, staining them with a 0.2% silver nitrate solution, and then developing the color with a 0.5 M sodium hydroxide solution containing a 0.5% formaldehyde solution, and performing genotypic statistical analysis on the population described in step (1); (4) performing association analysis on the phenotype of meat content-related traits of the individuals in the population described in step (1) in combination with the corresponding marker genotypes in step (3), separating the individuals in the population by gender and performing association analysis separately; using a one-way analysis of variance method, identifying molecular markers that are associated with the phenotype of meat content-related traits and can be repeatedly detected; (5) Integrate the genotypes obtained in step (3), divide the genotypes into two categories according to homozygotes and heterozygotes, and then perform association analysis according to the method of step (4) to identify molecular markers that can be repeated between populations and have hybrid vigor; (6) In each population, the top 10% and bottom 10% of the phenotypic values ​​are selected from high to low to form two groups, large and small. The dominant and inferior genotypes are determined by comparing the number of genotype distributions of markers in the large and small groups.

3. Application of SSR molecular marker primers related to the meat content trait of Procambarus clarkii in the assisted breeding of high meat content strains of Procambarus clarkii.

Images