Multiplex PCR primer probe combination, kit and detection method for human red blood cell RHCE genotyping detection

Abstract

The invention relates to a multiplex PCR (Polymerase Chain Reaction) primer probe combination, a kit and a detection method for human red blood cell RHCE genetic typing detection, and belongs to the field of biomedicine clinical molecular detection. The invention provides a multiplex PCR (Polymerase Chain Reaction) primer probe combination for human red blood cell RHCE genetic typing detection, and further provides a kit containing the multiplex PCR primer probe combination. The method has the technical advantages that the RHCE gene variation site specific primer and probe are designed through an improved ARMS technology and a homologous sequence specific base method, so that higher specificity and accuracy are realized; only four-hole reaction is needed, detection of RHC, RHc, RHE, RHe, CW- / CW +, CX- / CX +, V-VS- / V + VS + and V + / V-can be completed at a time, and higher flux and efficiency are achieved; according to the method, multiple fluorescent PCR is combined with a Taqman probe technology, qualitative typing detection is carried out on the human red blood cell RHCE gene, and compared with a traditional method, higher sensitivity, higher experiment speed, higher accuracy and a wider application range are shown.

Description

Technical Field

[0001] The invention relates to a multiplex PCR primer probe combination, a kit and a detection method for human red blood cell RHCE gene typing detection, and belongs to the field of biomedical clinical molecular detection. Background Art

[0002] The RHCE gene and the RHD gene are located on chromosome 1 and have highly similar sequence structures. The RHCE gene is mainly composed of 10 exons, and the protein it encodes is part of a protein complex on the red blood cell membrane, responsible for transporting and maintaining ion balance. Variations in the RHCE protein can lead to different expressions of antigens such as C / c and E / e. The RHCE gene has a high degree of polymorphism, which is one of the important reasons for the complexity of the Rh blood group system. Common forms of polymorphism include SNP (single nucleotide polymorphism) and gene rearrangement. The allele frequency of the RHCE gene in different populations varies significantly, which leads to different expression patterns of antigens such as C / c and E / e.

[0003] In recent years, there have been many studies on the structure of RHD genes in China, but few studies on the genotyping characteristics of RHCE. Since RHCE antigen incompatibility can cause hemolytic transfusion reactions and hemolytic disease of the newborn, the study of RHCE genes has important clinical significance. In RHCE detection, C / c and E / e genotypes are the focus of attention. This is because the antigenicity of C, c, E, and e antigens in the Rh blood group system is strong, and they are easy to induce immune responses in clinical blood transfusions and maternal-fetal blood group incompatibility. For example, C antigen and c antigen are products encoded by a pair of alleles. If the recipient of blood itself is of cc genotype (no C antigen on the surface of red blood cells), blood containing C antigen (such as Ce genotype blood) is transfused, anti-C antibodies may be produced. Similarly, the same is true for E and e antigens. For individuals with ee genotype, transfusion of blood containing E antigen may induce the production of anti-E antibodies.

[0004] Real-time PCR is an advanced technology that quantitatively detects and analyzes DNA, RNA or genotypes by monitoring the fluorescent signal generated during the PCR reaction in real time. Its working principle is as follows: First, a pair of specific primers are designed for a specific DNA or RNA sequence. These primers will bind to both ends of the target sequence and amplify it in the PCR reaction. In addition, a fluorescently labeled probe that specifically binds to the target sequence is designed, and the probe contains a fluorescent group and a fluorescent signal inhibition group. During the PCR reaction, the probe binds to the PCR product and is recognized by the enzymatic activity of a 3'-5' exonuclease (such as Taq polymerase). This causes the fluorescent signal inhibition group on the probe to be removed, releasing the fluorescent group, thereby generating a fluorescent signal.

[0005] Real-time fluorescence PCR technology has significant advantages over other methods in the field of genotyping. First, it exhibits high sensitivity and specificity, and can detect extremely low concentrations of DNA and accurately distinguish different alleles. Secondly, the technology has a fast analysis speed, and a batch of samples can usually be analyzed within a few hours, effectively saving time and cost. In addition, it also has the ability of quantitative analysis, which can quantitatively analyze the target DNA, which is crucial for genetic research on genetic diseases. Real-time fluorescence PCR technology can be used in combination with automated equipment to make the analysis process more efficient and accurate, and reduce human errors in experiments. In addition, this technology also has the ability of multiple analysis, which can detect multiple genes or multiple sites at the same time, obtain more relevant information in one experiment, and help to conduct comprehensive genotyping analysis. Finally, real-time fluorescence PCR technology has a wide range of applications and can be applied to various sample types, including blood, tissue, saliva, etc., and has broad application prospects in clinical and scientific research fields. In summary, real-time fluorescence PCR technology has higher sensitivity, faster analysis speed, higher degree of automation and more information acquisition capabilities in genotyping, making it one of the preferred methods for genotyping at present.

[0006] Amplification Refractory Mutation System (ARMS) is a molecular biology technology used to detect single nucleotide polymorphisms (SNPs) or specific DNA mutations. Its principle is based on PCR amplification technology, and highly specific detection of base variations at specific sites is achieved through specific primer design. In the ARMS system, two pairs of primers are designed, one pair is used to amplify normal alleles, and the other pair is used to amplify mutant alleles. These primers are specific and can selectively bind to normal alleles or mutant alleles. In the PCR reaction, the DNA of the sample to be tested is placed in the reaction system together with the two pairs of primers, and then PCR amplification is performed. By analyzing the PCR amplification product, it is possible to directly determine whether a specific mutation exists in the sample. The ARMS system is highly specific and sensitive, and can quickly and accurately detect specific single nucleotide polymorphisms or DNA mutations, so it has been widely used in molecular diagnosis, research and clinical testing.

[0007] In summary, given the limitations of existing technologies, there is an urgent need for a faster, more accurate, and simpler human red blood cell RHCE genotyping detection method to meet clinical needs, improve accuracy, simplify operating procedures, reduce costs, and be able to adapt to the needs of different fields. Summary of the invention

[0008] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a multiplex PCR primer-probe combination, a kit and a detection method for human red blood cell RHCE genotyping detection.

[0009] The principle of the present invention is to use the amplification hindered mutation system (ARMS) analysis method combined with Taqman fluorescent PCR technology to perform qualitative typing detection on the RHCE gene. According to the RHCE gene sequence of the Chinese population published in the database, the ARMS analysis method combined with the homologous sequence specific base method was used to design RHC, RHc, RHE, RHe, C W - / C W +、C X - / C X +, V-VS- / V+VS+, V+ / V-, 12 pairs of specific primers and probes are labeled with FAM / HEX / ROX / and distributed in 4 reaction wells in sequence. Four wells are reacted each time. Each tube is designed to amplify the primer set of the internal standard gene, which is labeled with CY5 to monitor false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample. The probe is an oligonucleotide including a 5'-end reporter group and a 3'-end quencher group. During the PCR amplification process, when the probe is intact, the fluorescence emitted by the reporter group is absorbed by the quencher group because the quencher group is close to the reporter group, and no fluorescence signal is emitted. During primer extension, the probe bound to the template is cut by the Taq enzyme (5'→3' exonuclease activity), and the reporter group is separated from the quencher group to generate a fluorescence signal. The fluorescence quantitative PCR instrument automatically draws a real-time amplification curve based on the detected fluorescence signal, thereby realizing the qualitative typing detection of the RHCE gene.

[0010] Since the RHCE gene is highly polymorphic and highly similar to the RHD sequence, the sequences of various RHCE gene variants are highly similar, most of which differ by only one base. In actual detection, false positives are very likely to occur. In order to detect more accurately and avoid false positives, the inventors used the ARMS primer design method and improved it on the basis of traditional ARMS. ARMS was combined with the homologous sequence-specific base method to design RHCE gene variant site-specific primers and probes, which increased the specificity of the amplification primers and improved the accuracy of detection.

[0011] Compared with other traditional PCR methods, the real-time fluorescence PCR technology adopted in the present invention has high sensitivity and specificity, can quickly and accurately perform RHCE gene typing, can provide an important molecular biological detection tool for clinical blood type identification and blood transfusion matching, and has broad application prospects in clinical transfusion and genetic research.

[0012] The inventor's main technical ideas are as follows:

[0013] The innovative ARMS combined with the homologous sequence specific base method was used to design the specific primers and probes for the RHCE gene mutation site. One primer was designed using the identification position of RHCE and RHD, and bases with different degrees of mismatch were added based on the preliminary test results; the other primer used the identification position bases of each subtype of RHCE, and bases with different degrees of mismatch were added based on the preliminary test results; the test showed that the primers close to the 3' end were strong mismatch primers, and the primers close to the 5' end were weak mismatch primers; the Taqman probe was designed to be universal, which is suitable for both normal RHCE gene detection and variant RHCE gene detection. By combining specific primers with Taqman probes, the accuracy and sensitivity are improved while the cost is significantly reduced, making it more suitable for large-scale detection needs and has broad application prospects.

[0014] The present invention uses innovative ARMS combined with homologous sequence specific base method to design RHCE gene mutation site specific primers and probes, combined with Taqman probe technology, and for the first time uses multiple probe method fluorescent PCR technology to identify RHCE gene mutations. Only 4 wells are needed to detect RHC / RHc (307T>C), RHE / RHe (676C>G), C W - / C W +(122A>G), C X - / C X The multiplex PCR primer probe combination and kit of V-VS- / V+VS+(106G>A), V-VS- / V+VS+(733C>G), V+ / V-(1006G>T) have higher sensitivity, faster experimental speed, higher accuracy and wider applicability compared with traditional methods, and have broad application prospects and clinical reference value.

[0015] In addition, the present invention adopts an innovative simple and fast drying technology to perform vacuum centrifugation concentration on the primer-probe mixture at the bottom of an 8-tube or 96-well plate, so that it dries at the bottom of each well, which significantly enhances the stability of the primer-probe. Compared with the previous freeze-drying technology, it is simpler, faster, and less costly, and has a higher practical application value.

[0016] The technical solution of the present invention is as follows:

[0017] In the first aspect of the present invention, a multiplex PCR primer-probe combination for human red blood cell RHCE genotyping detection is provided, wherein the combination comprises 12 pairs of specific primers and corresponding probes, and the 12 pairs of specific primers and corresponding probes are distributed in 4 reaction wells, and the nucleotide sequences of the primer pairs and corresponding probes contained in each reaction well are shown in the following table:

[0018]

[0019] The nucleotide sequences of the 12 pairs of specific primers and the corresponding probes, as well as the amplification sites targeted by the 12 pairs of specific primers and the corresponding probes are specifically shown in the following table:

[0020]

[0021] Each of the four reaction wells further comprises a pair of internal control primers and a corresponding probe, the nucleotide sequences of which are shown in SEQ ID Nos. 25 to 27, for monitoring false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample;

[0022] The nucleotide sequences of SEQ ID No.25 to 27 are as follows:

[0023] SEQ ID No Sequence 5'→3' 25 GCATCTGGACATGCTTGCT 26 ACACACATGGAAGACCACAGA 27 CY55'-CTGTGTTAAAGCTCTGAATAATGGTA-3'BHQ2 .

[0024] In the second aspect of the present invention, a kit containing the multiplex PCR primer-probe combination as described in the first aspect is provided. The kit contains 12 pairs of specific primers and corresponding probes for 12 amplification sites, and these primer pairs and probes are distributed in 4 reaction wells, and each well can simultaneously amplify 3 different sites. The kit can be used to detect RHC, RHc, RHE, RHe, C W - / C W +、C X - / C X +, V-VS- / V+VS+, V+ / V-. Each reaction well of the kit also contains an internal standard CY5 for internal quality control to monitor false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample.

[0025] Preferably, the kit further comprises a PCR reaction mixture, Taq enzyme and an optical sealing film or an 8-tube cap.

[0026] Preferably, the PCR reaction mixture comprises: 0.18 mM deoxynucleotide dNTP, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM Tris-HCl, 0.6% v / v glycerol, 5% v / v dimethyl sulfoxide and 2.5% v / v formamide, wherein DMSO and formamide serve as PCR reaction enhancers and stabilizers at the same time.

[0027] Preferably, the kit comprises an 8-well tube or a 96-well plate, wherein an 8-well tube can simultaneously detect the RHCE genotyping of 2 samples, and a 96-well plate can simultaneously detect the RHCE genotyping of 24 samples, and the PCR amplification primer set and Taqman probe are dried at the bottom of each well.

[0028] In a third aspect of the present invention, a method for identifying RHCE genotyping for non-disease diagnosis purposes using the multiplex PCR primer-probe combination as described in the first aspect or the kit as described in the second aspect is provided, characterized in that it comprises the following steps:

[0029] S1. Obtaining a nucleic acid sample of a sample to be tested;

[0030] S2. Using the nucleic acid sample obtained in step S1 as a template, using primers having nucleotide sequences shown in SEQ ID No.01 to SEQ ID No.27, a fluorescent quantitative PCR reaction is performed, and the PCR reaction conditions are 94°C 2min30sec; 94°C 15sec, 65°C 55sec, 35cycles.

[0031] S3. Performing fluorescence quantitative analysis on the PCR reaction of step S2, the fluorescence PCR instrument draws an amplification curve based on the generated fluorescence signal results.

[0032] The technical effects of the present invention are as follows:

[0033] 1) The present invention adopts innovative ARMS combined with homologous sequence specific base method to design RHCE gene mutation site specific primers and probes, which have higher specificity and accuracy; only 4 reaction wells are needed in one experiment to detect RHC, RHc, RHE, RHe, C W - / C W +、C X - / C X +, V-VS- / V+VS+, V+ / V- types.

[0034] 2) Multiplex fluorescence PCR combined with Taqman probe technology is used to perform qualitative typing detection on human red blood cell RHCE gene. Compared with traditional methods, it has higher sensitivity, faster experimental speed, higher accuracy and wider applicability, and has broad application prospects and clinical reference value. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1-1 to Figure 1-4 These are the amplification curves of wells 1 to 4, respectively.

[0036] Figure 2 This is the S1 sequencing map.

[0037] Figure 3 S2 is the sequencing map.

[0038] Figure 4 This is the S3 sequencing map.

[0039] Figure 5 S4 is the sequencing map.

[0040] Figure 6 This is the S5 sequencing map.

[0041] Figure 7 This is the S6 sequencing map. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. The raw materials used in the present invention are all commercially available products unless otherwise specified.

[0043] Example 1

[0044] 1. Raw materials and equipment

[0045] 1.1 Preparation of PCR reaction mixture: 0.18 mM deoxyribonucleotide (dNTP), 1.8 mM magnesium chloride (MgCl2), 60.3 mM potassium chloride (KCl), 18.9 mM tris-HCl, 0.6% (v / v) glycerol, 5% (v / v) dimethyl sulfoxide (DMSO) and 2.5% (v / v) formamide. Prepare 50 mL of 6*PCR reaction mixture according to the above proportions and store it at -20°C for long-term storage or at 4°C for temporary use.

[0046] Taq enzyme: The Taq enzyme used in this kit is purchased from Acori Biotechnology. It is used for the synthesis of DNA chains in the 5' to 3' direction guided by specific paired primers with the target sequence as a template, as well as 5'→3' exonuclease activity, which can cut off the fluorescent probe bound to the target DNA during PCR amplification, causing the fluorescent molecules of the fluorescent probe to emit fluorescence.

[0047] 1.2 Preparation of reaction plate:

[0048] 1.2.1 Preparation of primer-probe mixture: 0.54 OD / mL primer and 1.05 μM probe to make a 6*primer-probe mixture.

[0049] 1.2.2 Click the board according to the table below:

[0050]

[0051] The nucleotide sequences of the 12 pairs of specific primers and the corresponding probes, as well as the amplification sites targeted by the 12 pairs of specific primers and the corresponding probes are specifically shown in the following table:

[0052]

[0053]

[0054] Each of the four reaction wells further comprises a pair of internal control primers and a corresponding probe, the nucleotide sequences of which are shown in SEQ ID Nos. 25 to 27, for monitoring false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample;

[0055] The nucleotide sequences of SEQ ID No.25 to 27 are as follows:

[0056]

[0057] 1.2.3 Drying of 8-tube concatenation: Centrifuge and concentrate the 8-tube concatenation to dryness according to the following procedure. Centrifuge conditions: 30°C, vacuum degree below -100kpa, speed above 1400rpm, time 60 minutes. Then seal into light-proof tin foil bag. Package in light-proof tin foil bag and store at -20°C.

[0058] 1.3 Source of samples

[0059] 1) Blood sample collection

[0060] When collecting blood samples, blood collection tubes containing anticoagulants such as sodium citrate, ethylenediaminetetraacetic acid (EDTA) or heparin should be used. In order to ensure the accuracy and reliability of the experimental results, it is recommended to use fresh or frozen whole blood samples that have not been repeatedly frozen and thawed as experimental samples.

[0061] 2) Nucleic acid sample extraction

[0062] Nucleic acid can be extracted from samples containing nuclear cells such as whole blood or buffy coat by precipitation, column or magnetic bead methods to obtain sufficient nucleic acid of qualified quality for polymerase chain reaction.

[0063] 3) Quantification of nucleic acid samples

[0064] The extracted nucleic acid sample needs to be dissolved in sterile water or other appropriate solution (such as TE Buffer) as the dissolution medium, and the concentration should be controlled within the range of 10-40ng / μl.

[0065] 4) Nucleic acid sample quality standards

[0066] The A260 / A280 ratio of nucleic acid samples should be between 1.6 and 2.1.

[0067] 1.4 Required experimental equipment

[0068] Fluorescence quantitative PCR instrument, pipettes of different ranges, small desktop centrifuge, 96-well plate centrifuge.

[0069] 2. Genotyping Process

[0070] 2.1 Configuration of the reaction system: Each sample needs to undergo 4 independent real-time fluorescence PCR reactions at the same time. You can use 8-well tubes or 96-well plates. One 8-well tube can be used to test 2 samples, and one 96-well plate can be used to test 24 samples. This experiment uses 3 8-well tubes to test 6 samples. Prepare the mixed master solution according to the following table:

[0071] Table 1: PCR reaction system

[0072] Component name Add μL / well PCR reaction solution 3 Taq enzyme 0.4 DNA to be tested 2 Sterilized water 12.6 Total volume 18

[0073] Take 18 μL of the prepared mixed solution and dispense it into each well of the reaction plate, affix an optical sealing film, centrifuge briefly, and place it in the fluorescent PCR instrument.

[0074] 2.2 PCR reaction procedure: as shown in Table 2:

[0075] Table 2: PCR reaction program

[0076]

[0077] Please set the program according to the operating manual of each model of automatic cycle temperature controller. Set the fluorescence signal collection point at 65℃; set the fluorescence signal collection wavelength to FAM, HEX, ROX, CY5.

[0078] 2.3 Experimental results analysis:

[0079] If the Ct values ​​of the internal standard gene CY5 in all wells of the test sample are less than 35 and the amplification curve is normal, the result interpretation can continue. Output the ABI 7500 original result file as an Excel file and import it into the interpretation software. The software can directly analyze the RHCE genotype of the sample to be tested. The result example is as follows:

[0080]

[0081]

[0082] Conclusion: The entire experimental process only takes about 2 hours, the experimental results are accurate, and the kit of the present invention can accurately determine the RHCE genotype of the experimental sample.

[0083] Figure 1-1 to Figure 1-4 They are the amplification curves of wells 1 to 4. If the amplification curve of the labeled probe is normal and Ct < 35, the labeled probe is judged to be a positive reaction; if there is no amplification curve rise or Ct ≥ 35, the labeled probe is judged to be a negative reaction.

[0084] Figure 2 This is the S1 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0085] Figure 3 This is the S2 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0086] Figure 4 This is the S3 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0087] Figure 5 This is the S4 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0088] Figure 6 This is the S5 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0089] Figure 7 This is the S6 sequencing map, and the sequencing results are consistent with the detection results of this method.

[0090] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent modifications or changes made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A multiplex PCR primer-probe combination for detecting genotyping of human red blood cells RHCE, characterized in that: The combination comprises 12 pairs of specific primers and corresponding probes, and the 12 pairs of specific primers and corresponding probes are distributed in 4 reaction wells. The nucleotide sequences of the primer pairs and corresponding probes contained in each reaction well are shown in the following table: The nucleotide sequences of the 12 pairs of specific primers and the corresponding probes, as well as the amplification sites targeted by the 12 pairs of specific primers and the corresponding probes are specifically shown in the following table: Each of the four reaction wells further comprises a pair of internal control primers and a corresponding probe, the nucleotide sequences of which are shown in SEQ ID Nos. 25 to 27, for monitoring false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample; The nucleotide sequences of SEQ ID No.25 to 27 are as follows: 。 2. A kit comprising the multiplex PCR primer-probe combination for human red blood cell RHCE genotyping detection as claimed in claim 1.

3. The kit according to claim 2, characterized in that The test kit also includes a PCR reaction mixture, Taq enzyme and an optical sealing film or an 8-tube cap.

4. The kit according to claim 3, characterized in that The PCR reaction mixture comprises: 0.18 mM deoxynucleotide dNTP, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM tris-hydroxymethylaminomethane hydrochloride Tris-HCl, 0.6% v / v glycerol, 5% v / v dimethyl sulfoxide and 2.5% v / v formamide, wherein DMSO and formamide are simultaneously used as PCR reaction enhancers and stabilizers.

5. The kit according to claim 2, characterized in that The kit contains 8-well tubes or 96-well plates. One 8-well tube can detect the RHCE genotyping of 2 samples at the same time, and one 96-well plate can detect the RHCE genotyping of 24 samples at the same time. The PCR amplification primer set and Taqman probe are dried at the bottom of each well.

6. A method for identifying RHCE genotyping for non-disease diagnosis purposes using the multiplex PCR primer-probe combination of claim 1 or the kit of any one of claims 2 to 5, characterized in that: The following steps are involved: S1. Obtaining a nucleic acid sample of a sample to be tested; S2. Using the nucleic acid sample obtained in step S1 as a template, using primers having nucleotide sequences shown in SEQ ID No.01 to SEQ ID No.27, a fluorescent quantitative PCR reaction is performed; S3. Performing fluorescence quantitative analysis on the PCR reaction of step S2, the fluorescence PCR instrument draws an amplification curve based on the generated fluorescence signal results.

7. The method according to claim 6, characterized in that In step S2, the PCR reaction conditions are 94°C for 2 min and 30 sec; 94°C for 15 sec, 65°C for 55 sec, and 35 cycles.

Images