RT-CPA detection primer and kit for bovine parainfluenza virus type 3

Abstract

The invention belongs to the technical field of virus detection reagents, and particularly relates to RT-CPA detection primers and a kit for detecting bovine parainfluenza virus 3. Comprising a stripping primer, a cross primer and a detection primer, the stripping primer comprises NP-F and NP-R, the nucleotide sequence of the NP-F is as shown in SEQ ID NO: 1, and the nucleotide sequence of the NP-R is as shown in SEQ ID NO: 2; the cross primer comprises NP-CPF and NP-CPR, the nucleotide sequence of the NP-CPF is as shown in SEQ ID NO: 3, and the nucleotide sequence of the NP-CPR is as shown in SEQ ID NO: 4; the detection primer comprises NP-DF and NP-DR, the nucleotide sequence of the NP-DF is as shown in SEQ ID NO: 5, and the nucleotide sequence of the NP-DR is as shown in SEQ ID NO: 6; by adopting the detection primer and the kit provided by the invention, the bovine parainfluenza virus type 3 can be accurately, rapidly and highly sensitively detected.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection reagents, and particularly relates to an RT-CPA detection primer and a kit for detecting bovine parainfluenza virus type 3. Background Art

[0002] Bovine parainfluenza virus type 3 (BPIV3) is a single-stranded negative-sense RNA virus of the genus Respirovirus in the subfamily Paramyxovirinae. It can cause an acute, highly contagious respiratory disease characterized by high fever, dyspnea and coughing caused by attacking the respiratory organs. Cattle of all ages are susceptible, and the mortality rate of infected nursing calves is as high as 80% to 100%. The disease is prevalent worldwide, especially in Japan, South Korea and China. The disease can cause a large number of deaths in sick calves, sick fattening cattle become increasingly thin, and even if they recover, they grow and develop slowly or even become stiff cattle. At the same time, sick cattle are likely to be infected with secondary infections, which increases the risk of breeding and significantly reduces the rate of cattle being slaughtered. The disease seriously harms the cattle industry and causes serious economic losses.

[0003] The first task to control the spread of BPIV3 is to do a good job in the detection and monitoring of BPI. At present, the conventional detection methods of BPI include electron microscopy observation of virus particles, ELISA, indirect immunofluorescence, enzyme-linked immunosorbent assay, immunocolloidal gold, reverse transcription PCR, fluorescent real-time quantitative PCR and other methods. Electron microscopy observation of virus particles first requires the separation of the virus, and then electron microscopy observation, which is time-consuming and complicated. ELISA, indirect immunofluorescence, enzyme-linked immunosorbent assay, reverse transcription PCR, and fluorescent real-time quantitative PCR have the advantages of high sensitivity and strong specificity, but require higher experimental conditions, expensive instruments and professional technicians, complex operations and long time, high detection costs, and are difficult to carry out in general farms and grassroots units. The above methods cannot meet the requirements of simple, rapid, and highly sensitive detection due to their own characteristics. Early detection, early diagnosis, and molecular epidemiological investigation of BPI are important means to control the prevalence of BPI and reduce economic losses caused by the onset of BPI. Therefore, it is very important to establish a simple, rapid, and highly sensitive detection method and develop a BPIV3 detection kit suitable for field application.

[0004] Compared with ordinary PCR, RT-CPA has more stringent requirements on primer design and cannot be fully implemented according to software design. Screening for effective specific amplification primers and reaction conditions is a difficult problem in realizing RT-CPA detection. Summary of the invention

[0005] In order to solve the above-mentioned problems, the purpose of the present invention is to provide a RT-CPA detection primer and a kit for bovine parainfluenza virus type 3. The detection primer and the kit provided by the present invention can accurately, rapidly and highly sensitively detect bovine parainfluenza virus type 3.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The first aspect of the present invention discloses an RT-CPA detection primer for detecting bovine parainfluenza virus type 3, comprising a stripping primer, a cross primer, and a detection primer; The stripping primers include NP-F and NP-R, the nucleotide sequence of NP-F is shown in SEQ ID NO: 1, and the nucleotide sequence of NP-R is shown in SEQ ID NO: 2; The cross primers include NP-CPF and NP-CPR, the nucleotide sequence of the NP-CPF is shown in SEQ ID NO: 3, and the nucleotide sequence of the NP-CPR is shown in SEQ ID NO: 4; The detection primers include NP-DF and NP-DR. The nucleotide sequence of NP-DF is shown in SEQ ID NO: 5, and the nucleotide sequence of NP-DR is shown in SEQ ID NO: 6.

[0007] The detection primer also includes a marker, biotin BIOTIN is added to the 5' end of the NP-DF, and fluorescein FITC is added to the 5' end of the NP-DR.

[0008] The second aspect of the present invention discloses an RT-CPA detection kit for bovine parainfluenza virus type 3, comprising the above-mentioned RT-CPA detection primers.

[0009] The kit further comprises Bst III DNA / RNA polymerase, dNTPs, Reaction Buffer, MgSO4 and Betaine. The present invention has no special limitation on the source of the reagents in the kit, and conventional commercial products can be used. The present invention has no special limitation on the amount of the reagents placed in the kit, and the amount of the reagents placed in the conventional kit can be used.

[0010] The kit also includes a nucleic acid detection test strip.

[0011] The method of using the kit is to perform amplification under a set amplification system and amplification conditions to obtain an amplification product; The amplification system includes, per 20 μL, 2.0 μL of reaction buffer, 0.8 μM each of NP-CPF and NP-CPR, 0.2 to 0.8 μM each of NP-F and NP-R, 0.2 to 0.8 μM each of NP-DF and NP-DR, 0.2 to 0.8 μM each of MgSO4 0.2 to 1.2 mM, dNTPs 0.6 to 1.4 mM, Betaine 0.6 to 1.6 mM, Bst Ⅲ DNA / RNA polymerase 0.4 to 2.4 U, 1 μL of template RNA, and ddH2O to make up to 20 μL.

[0012] Preferably, the amplification system includes, per 20 μL, 2.0 μL of reaction buffer, 0.8 μM each of NP-CPF and NP-CPR, 0.2 μM each of NP-F and NP-R, 0.2 μM each of NP-DF and NP-DR, 0.6 mM of MgSO4, 1.2 mM of dNTPs, 1.0 mM of Betaine, 1.6 U of Bst Ⅲ DNA / RNA polymerase, 1 μL of template RNA, and ddH2O to make up to 20 μL.

[0013] The amplification conditions include: reacting at a temperature of 55 to 65° C. for 20 to 70 minutes, and then inactivating at a temperature of 85° C. for 2 minutes.

[0014] Preferably, the amplification conditions include: reacting at a temperature of 63°C for 60 minutes and then inactivating at a temperature of 85°C for 2 minutes.

[0015] The third aspect of the present invention discloses a detection method of the above kit. When the nucleic acid detection test strip is not used for detection, the amplified product is taken, subjected to 1.0% (W / V) agarose gel electrophoresis, and then placed in a gel imaging system for imaging. If the electrophoresis image shows characteristic ladder-like bands of RT-CPA, the result is positive; if there are no bands, the result is negative. When using nucleic acid test strips for testing, take the amplified product and test it with the nucleic acid test strips. If only one red line appears in the quality control area C, it means that the sample test result is negative; if two red lines appear, one test line and one quality control line, it means that the sample test result is positive; if no red lines appear in both the quality control area C and the test area T, it means that the nucleic acid test strips are invalid and the test results are invalid.

[0016] Compared with the prior art, the present invention has the following advantages: 1. Good specificity, can effectively detect bovine parainfluenza virus type 3; negative control pathogens such as bovine viral diarrhea virus (BVDV) and bovine respiratory syncytial virus (BRSV) have no positive results, and the operation is simple and the instrument requirements are low; the present invention utilizes the detection primer set combined with the reaction system optimization to obtain clearer product bands in nucleic acid electrophoresis, reducing the impact of the degradation of the amplification product during the reaction on the detection result; 2. Accurate and fast, it can detect BPIV3 down to 10μM, and the detection time can be shortened to less than one hour; 3. The test results are easy to judge, simple and intuitive. (The nucleic acid test strip has a quality control line and a detection line. If red lines appear on both the quality control line and the detection line, the result is positive.) The RT-CPA detection primers and kit for detecting bovine parainfluenza virus type 3 provided by the present invention have good application prospects and can be applied to prevention and control units at all levels and various types of farms and breeders in my country. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the existing methods and experiments, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 This is the optimization of different primer concentrations and ratios in the bovine parainfluenza virus type 3 RT-CPA detection kit. The pictures from left to right are Marker, 1), 2), 3), 4) samples with different primer concentrations. 1) NP-CPF / R: 0.8 μM each, NP-F / R: 0.2 μM each, NP-DF / R: 0.2 μM each, 2) NP-CPF / R: 0.8 μM each, NP-F / R: 0.4 μM each, NP-DF / R: 0.4 μM each, 3) NP-CPF / R: 0.8 μM each, NP-F / R: 0.6 μM each, NP-DF / R: 0.6 μM each, 4) NP-CPF / R: 0.8 μM each, NP-F / R: 0.8 μM each, NP-DF / R: 0.8 μM each; Figure 2 This is the optimization of different concentrations of MgSO4 in the bovine parainfluenza virus type 3 RT-CPA detection kit. From left to right, they are Marker and 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mM MgSO4 samples; Figure 3 This is the optimization of different concentrations of dNTPs in the bovine parainfluenza virus type 3 RT-CPA detection kit. From right to left are the marker and 0.6, 0.8, 1.0, 1.2, and 1.4 mM dNTPs samples; Figure 4 This is the optimization of different concentrations of Betaine in the bovine parainfluenza virus type 3 RT-CPA detection kit. From left to right, they are Marker and 0.6, 0.8, 1.0, 1.2, 1.4, and 1.6 mM Betaine samples; Figure 5 This is the optimization of different concentrations of Bst Ⅲ DNA / RNA polymerase in the bovine parainfluenza virus type 3 RT-CPA detection kit. From left to right are the marker and 0.4, 0.8, 1.2, 1.6, 2.0, and 2.4U Bst Ⅲ DNA / RNA polymerase samples; Figure 6 This is the optimization of different reaction temperatures in the bovine parainfluenza virus type 3 RT-CPA detection kit. From left to right are the marker and the reaction temperatures of 55°C, 57°C, 59°C, 61°C, 63°C, and 65°C; Figure 7 This is the optimization of different reaction times in the RT-CPA detection kit for bovine parainfluenza virus type 3. From left to right are the marker and the reaction times of 20min, 30min, 40min, 50min, 60min, and 70min. Figure 8 Schematic diagram of the specificity of the bovine parainfluenza virus type 3 RT-CPA detection kit and the test results. The samples from left to right are BPIV3, BVDV, BRSV and blank control (H2O); Fig. 9 This is the detection sensitivity of the bovine parainfluenza virus type 3 RT-CPA detection kit. The virus standard plasmid concentrations in the samples from left to right are 100 μM, 50 μM, 25 μM, 16.7 μM, 12.5 μM, 10 μM, and 8.3 μM. DETAILED DESCRIPTION

[0019] The technical scheme of the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but the present invention is not limited to the scope of the embodiments. The experimental methods and techniques in the following embodiments without specifying specific conditions are usually carried out according to conventional conditions in the field or according to the conditions recommended by the manufacturer.

[0020] In the present invention, the NP-CPF and NP-CPR are cross primers, the NP-F and NP-R are stripping primers, and the NP-DF and NP-DR are detection primers. In the present invention, the RT-CPA detection primer is a conservative region (205bp) in the NP gene (JX406145.1) sequence of the BPIV3 strain published by GenBank as a template, and the RT-CPA primer is preferably designed. The specific region of the target gene is amplified by the RT-CPA technology, and the bovine parainfluenza virus type 3 is rapidly detected at the molecular level, which is simple, rapid, highly specific and sensitive.

[0021] Primer combination 1: NP-F: 5' TGATCCTCAGTCATCCAT 3' (SEQ ID NO: 1); NP-R: 5'TCAGTCTGATCAGCATT 3' (SEQ ID NO: 2); NP-CPF: 5' AGTTGATTTTGATTCATTCT ATGCATGGGCAGATGAGGTA 3' (SEQ ID NO: 3); NP-CPR: 5' ATGCATGGGCAGATGAGGTA AGTTGATTTTGATTCATTCT 3' (SEQ ID NO: 4); NP-DF: 5' BIOTIN- GCAACAAAAACCAAGCAGGG 3' (SEQ ID NO: 5); NP-DR: 5' FITC-TTCTTTTTTCGTTAAGCCTT 3' (SEQ ID NO: 6).

[0022] Primer combination 2: NP-F: 5'ATAGACGAGGAGATAGAACAAC 3' (SEQ ID NO: 7); NP-R: 5'TCAGTTACTTCCGAATGCG3' (SEQ ID NO: 8); NP-CPF: 5' ATCTATCTCAGTCTGATCAGC AGAGGAGACCAGGATCAAAC 3' (SEQ ID NO: 9); NP-CPR: 5' AGAGGAGACCAGGATCAAACATCTATCTCAGTCTGATCAGC 3' (SEQID NO: 10); NP-DF: 5' BIOTIN- TCATCCATAATCCCCTATGC 3' (SEQ ID NO: 11); NP-DR: 5'FITC-TCAGTTGATTTTGATTCATTCT 3' (SEQ ID NO: 12).

[0023] Primer combination 3: NP-F: 5'ATCCAGAGGAGACCAGGATC3' (SEQ ID NO: 13); NP-R: 5'TGAACAGGTCATCTATCTCAGT3' (SEQ ID NO: 14); NP-CPF: 5' TTATTTGTTATGTCAGTTGATTCCTCAGTCATCCATAATC 3' (SEQID NO: 15); NP-CPR: 5'TCCTCAGTCATCCATAATCTTATTTGTTATGTCAGTTGAT 3' (SEQID NO: 16); NP-DF: 5' BIOTIN-AACCAAGCAGGGTCAACC 3' (SEQ ID NO: 17); NP-DR: 5' FITC - AGCCTTTTGTTCAATCTATCTC 3' (SEQ ID NO: 18).

[0024] The above three primer combinations were verified, and primer combination 1 had good specificity. Primer combination 1 was selected as the best and verified as follows.

[0025] Example 1 A bovine parainfluenza virus type 3 RT-CPA detection kit comprises: reaction buffer; BstⅢ DNA / RNA polymerase (Beijing Quanshijin); dNTPs; MgSO4; Betaine; cross primers NP-CPF and NP-CPR; stripping primers NP-F and NP-R; detection primers NP-DF and NP-DR; and nucleic acid detection test strips.

[0026] NP-F: 5' TGATCCTCAGTCATCCAT 3' (SEQ ID NO: 1); NP-R: 5'TCAGTCTGATCAGCATT 3' (SEQ ID NO: 2); NP-CPF: 5' AGTTGATTTTGATTCATTCT ATGCATGGGCAGATGAGGTA 3' (SEQ ID NO: 3); NP-CPR: 5' ATGCATGGGCAGATGAGGTA AGTTGATTTTGATTCATTCT 3' (SEQ ID NO: 4); NP-DF: 5' BIOTIN- GCAACAAAAACCAAGCAGGG 3' (SEQ ID NO: 5); NP-DR: 5' FITC-TTCTTTTTTCGTTAAGCCTT 3' (SEQ ID NO: 6).

[0027] Example 2 Optimization of different primer concentrations and ratios in a RT-CPA detection kit for bovine parainfluenza virus type 3 1. Extraction of total RNA from bovine parainfluenza virus type 3 The cytotoxic fluid of bovine parainfluenza virus type 3 was collected and centrifuged at 5000 r / min and 4°C for 30 min, and the supernatant was collected. Bovine parainfluenza virus type 3 RNA was extracted from the collected supernatant using the Total Gold DNA / RNA Extraction Kit. The specific operation steps were carried out according to the instructions of the kit, and the extracted RNA was stored at -20°C for later use.

[0028] 2. Configure RT-CPA Amplification Reaction System The reaction solution was prepared according to the 20μL RT-CPA amplification reaction system, as follows: 1μL viral RNA template, 2.0μL Reaction Buffer, 0.6mM MgSO4, 1.2mM dNTPs, 0.6mM Betaine, 1.6U Bst Ⅲ DNA / RNA polymerase, NP-CPF / R, NP-F / R, NP-DF / R, and nuclease-free water to 20μL. The cross primers (NP-CPF, NP-CPR), stripping primers (NP-F, NP-R), and detection primers (NP-DF, NP-DR) were used in different concentration ratios: 1) NP-CPF / R: 0.8 μM each, NP-F / R: 0.2 μM each, NP-DF / R: 0.2 μM each 2) NP-CPF / R: 0.8 μM each, NP-F / R: 0.4 μM each, NP-DF / R: 0.4 μM each 3) NP-CPF / R: 0.8 μM each, NP-F / R: 0.6 μM each, NP-DF / R: 0.6 μM each 4) NP-CPF / R: 0.8 μM each, NP-F / R: 0.8 μM each, NP-DF / R: 0.8 μM each 3. Reaction conditions for RT-CPA amplification The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0029] 4. Determination of test results Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 1 ) shows the primer concentrations. Combination 1 has the best amplification effect, namely: NP-CPF / R: 0.8μM each, NP-F / R: 0.2μM each, NP-DF / R: 0.2μM each.

[0030] Example 3 Optimization of different concentrations of MgSO4 in a RT-CPA detection kit for bovine parainfluenza virus type 3 1. Extraction of total RNA from bovine parainfluenza virus type 3 The method is the same as Example 2.

[0031] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM each NP-CPF / R, 0.2 μM each NP-F / R, 0.2 μM each NP-DF / R, MgSO4, 1.2 mM dNTPs, 1.0 mM Betaine, 1.6 U Bst Ⅲ DNA / RNA polymerase, and nuclease-free water to make up to 20 μL.

[0032] The concentrations of MgSO4 are 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mM respectively.

[0033] 3. Reaction conditions for RT-CPA amplification The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0034] 4. Determination of test results Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 2 ) showed that the best effect was achieved when the concentration of MgSO4 was 0.6 mM.

[0035] Example 4 Optimization of different concentrations of dNTPs in a RT-CPA detection kit for bovine parainfluenza virus type 3 1. Extraction of total RNA from bovine parainfluenza virus type 3 The method is the same as Example 2.

[0036] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.0 mM dNTPs, 1.6 U Bst Ⅲ DNA / RNA polymerase, and nuclease-free water to make up to 20 μL.

[0037] The concentrations of dNTPs are 0.6, 0.8, 1.0, 1.2, and 1.4 mM respectively.

[0038] 3. Reaction conditions for RT-CPA amplification: The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0039] 4. Determination of test results: Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 3 ) showed that the best effect was achieved when the dNTPs concentration was 1.2 mM.

[0040] Example 5 Optimization of different concentrations of Betaine in a RT-CPA detection kit for bovine parainfluenza virus type 3 1. Extraction of total RNA from bovine parainfluenza virus type 3 The method is the same as Example 2.

[0041] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.2 mM dNTPs, Betaine, 1.6 U Bst Ⅲ DNA / RNA polymerase, and nuclease-free water to make up to 20 μL.

[0042] The concentrations of Betaine are 0.6, 0.8, 1.0, 1.2, 1.4, and 1.6 mM samples respectively.

[0043] 3. Reaction conditions for RT-CPA amplification The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0044] 4. Determination of test results Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 4 ) showed that the best effect was achieved when the Betaine concentration was 1.0 mM.

[0045] Example 6 Optimization of different concentrations of Bst Ⅲ DNA / RNA polymerase in a bovine parainfluenza virus type 3 RT-CPA detection kit 1. Extraction of total RNA from bovine parainfluenza virus type 3 The method is the same as Example 2.

[0046] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.2 mM dNTPs, 1.0 mM Betaine, Bst Ⅲ DNA / RNA polymerase, and nuclease-free water to make up to 20 μL.

[0047] The concentrations of Bst Ⅲ DNA / RNA polymerase were 0.4, 0.8, 1.2, 1.6, 2.0, and 2.4 U, respectively.

[0048] 3. Reaction conditions for RT-CPA amplification: The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0049] 4. Determination of test results: Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 5 ) showed that the best effect was achieved when the concentration of Bst Ⅲ DNA / RNA polymerase was 1.6U.

[0050] Example 7 Optimization of different reaction temperatures in a RT-CPA detection kit for bovine parainfluenza virus type 3 1. Extraction of total RNA from bovine parainfluenza virus type 3 The method is the same as Example 2.

[0051] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.2 mM dNTPs, 1.0 mM Betaine, 1.6 U Bst Ⅲ DNA / RNA polymerase, and the volume was filled to 20 μL with nuclease-free water.

[0052] 3. Reaction conditions for RT-CPA amplification The reaction tubes were incubated at 55°C, 57°C, 59°C, 61°C, 63°C, and 65°C for 60 min, respectively, and then inactivated at 85°C for 2 min.

[0053] 4. Determination of test results Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 6 ) showed that the best effect was achieved when the reaction temperature was 63°C.

[0054] Example 8 Optimization of different reaction times in a RT-CPA detection kit for bovine parainfluenza virus type 3 1. Extraction of total RNA from bovine parainfluenza virus type 3 The method is the same as Example 2.

[0055] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.2 mM dNTPs, 1.0 mM Betaine, 1.6 U Bst Ⅲ DNA / RNA polymerase, and the volume was filled to 20 μL with nuclease-free water.

[0056] 3. Reaction conditions for RT-CPA amplification: The reaction tube was placed at 63°C and incubated for 20 min, 30 min, 40 min, 50 min, 60 min, and 70 min, respectively, and then inactivated at 85°C for 2 min.

[0057] 4. Determination of test results: Take 10 μL of the amplified product, run it through 1.0% agarose gel electrophoresis, and place it in a gel imaging system for imaging. The electrophoresis picture ( Figure 7 ) showed that the best effect was achieved when the reaction time was 60 min.

[0058] Example 9 Specificity test of a RT-CPA detection kit for bovine parainfluenza virus type 3 BPIV3, BVDV and BRSV were detected according to the optimized bovine parainfluenza virus type 3 RT-CPA detection kit according to Examples 2, 3, 4, 5, 6, 7 and 8, and a blank control was set.

[0059] Extraction of total viral RNA The cytotoxic fluid of BPIV3, BVDV, and BRSV was collected and repeatedly frozen and thawed three times from -80°C to room temperature, centrifuged at 5000r / min for 30min, and the supernatant was collected. The total viral RNA was extracted from the collected supernatant using the TransGen Biotech DNA / RNA extraction kit. The specific operation steps were carried out according to the instructions of the kit, and the extracted total viral RNA was stored at -20°C for later use.

[0060] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.2 mM dNTPs, 1.0 mM Betaine, 1.6 U Bst Ⅲ DNA / RNA polymerase, and the volume was filled to 20 μL with nuclease-free water.

[0061] 3. Reaction conditions for RT-CPA amplification The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0062] 4. Determination of test results The nucleic acid test strips were used for testing. 5 to 8 μL of the amplified product was dripped onto the bottom of the test strips, and then 100 μL of buffer (Hangzhou Ustar Company) was dripped. The results can be observed after 15 to 30 minutes. The nucleic acid test strips showed that the specific RT-CPA primer set designed for BPIV3 can ensure the specific detection of BPIV3, and only BPIV3 was detected as positive, while BPIV3, BVDV, BRSV, and blank control (water) were all negative ( Figure 8 ).

[0063] Example 10 Sensitivity test of RT-CPA detection kit for bovine parainfluenza virus type 3 1. Construction of standard recombinant plasmid Total RNA of BPIV3 was extracted, and the full-length sequence of BPIV3 NP gene (JX406145.1) was amplified by reverse transcription PCR, cloned into pMD19-T plasmid, and verified. The verified recombinant plasmid was named pMD19-T-NP. The recombinant plasmid was purified, the plasmid concentration was measured, and the standard plasmid concentration was adjusted to 100μM with pure water. For sensitivity determination, the standard plasmid was diluted 2, 4, 6, 8, 10, 12, and 14 times with pure water, so that the plasmid concentration range was 100μM, 50μM, 25μM, 16.7μM, 12.5μM, 10μM, and 8.3μM, which was used as a template for CPA reaction.

[0064] 2. Configure the reaction system for RT-CPA amplification The reaction solution was prepared according to the 20 μL RT-CPA amplification reaction system, as follows: 1 μL viral RNA template, 2.0 μL Reaction Buffer, 0.8 μM NP-CPF / R, 0.2 μM NP-F / R, 0.2 μM NP-DF / R, 0.6 mM MgSO4, 1.2 mM dNTPs, 1.0 mM Betaine, 1.6 U Bst Ⅲ DNA / RNA polymerase, and the volume was filled to 20 μL with nuclease-free water.

[0065] 3. Reaction conditions for RT-CPA amplification The reaction tube was incubated at 63°C for 60 min and inactivated at 85°C for 2 min.

[0066] 4. Determination of test results Use nucleic acid test strips for testing, take 5-8μL of the amplified product and drop it to the bottom of the test strip, then add 100μL of buffer (Hangzhou Ustar Company), and observe the results after 15-30 minutes. The nucleic acid test strips show that 10μM of standard recombinant plasmid ( Fig. 9 ).

[0067] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An RT-CPA detection primer for detecting bovine parainfluenza virus type 3, characterized in that: Including stripping primers, cross primers, and detection primers; The stripping primers include NP-F and NP-R, the nucleotide sequence of NP-F is shown in SEQ ID NO: 1, and the nucleotide sequence of NP-R is shown in SEQ ID NO: 2; The cross primers include NP-CPF and NP-CPR, the nucleotide sequence of the NP-CPF is shown in SEQ ID NO: 3, and the nucleotide sequence of the NP-CPR is shown in SEQ ID NO: 4; The detection primers include NP-DF and NP-DR. The nucleotide sequence of NP-DF is shown in SEQ ID NO:5, and the nucleotide sequence of NP-DR is shown in SEQ ID NO:

6.

2. The RT-CPA detection primer for detecting bovine parainfluenza virus type 3 according to claim 1, characterized in that: The detection primer also includes a marker. Biotin BIOTIN is added to the 5' end of the primer NP-DF, and fluorescein FITC is added to the 5' end of the primer NP-DR.

3. An RT-CPA detection kit for bovine parainfluenza virus type 3, characterized in that: The invention comprises the RT-CPA detection primer according to any one of claims 1 to 2.

4. The RT-CPA detection kit for bovine parainfluenza virus type 3 according to claim 3, characterized in that: The kit also includes Bst Ⅲ DNA / RNA polymerase, dNTPs, Reaction Buffer, MgSO4 and Betaine.

5. The RT-CPA detection kit for bovine parainfluenza virus type 3 according to claim 3, characterized in that: The kit also includes a nucleic acid detection test strip.

6. The RT-CPA detection kit for bovine parainfluenza virus type 3 according to claim 4, characterized in that: The method of using the kit is to perform amplification under a set amplification system and amplification conditions to obtain an amplification product; The amplification system includes, per 20 μL, 2.0 μL of reaction buffer, 0.8 μM each of NP-CPF and NP-CPR, 0.2 to 0.8 μM each of NP-F and NP-R, 0.2 to 0.8 μM each of NP-DF and NP-DR, 0.2 to 1.2 mM of MgSO4, 0.6 to 1.4 mM of dNTPs, 0.6 to 1.6 mM of Betaine, 0.4 to 2.4 U of Bst Ⅲ DNA / RNA polymerase, 1 μL of template RNA, and ddH2O to make up to 20 μL.

7. The RT-CPA detection kit for bovine parainfluenza virus type 3 according to claim 6, characterized in that: Each 20 μL of the amplification system includes: Reaction Buffer 2.0μL, NP-CPF, NP-CPR 0.8μM each, NP-F, NP-R 0.2μM each, NP-DF, NP-DR 0.2μM each, MgSO4 0.6mM, dNTPs 1.2mM, Betaine 1.0mM, Bst Ⅲ DNA / RNA polymerase 1.6U, template RNA 1μL, ddH2O to 20μL.

8. The RT-CPA detection kit for bovine parainfluenza virus type 3 according to claim 6 or 7, characterized in that: The amplification conditions include: reacting at a temperature of 55 to 65° C. for 20 to 70 minutes, and then inactivating at a temperature of 85° C. for 2 minutes.

9. The RT-CPA detection kit for bovine parainfluenza virus type 3 according to claim 8, characterized in that: The amplification conditions include: reacting at a temperature of 63° C. for 60 minutes and then inactivating at a temperature of 85° C. for 2 minutes.

Images