An RNA mRNA probe based on antibody-coupled DNA nanocluster probes 6 A modified single-cell multimodal analysis method
Through antibody-coupled DNA nanocluster probes, multimodal analysis of m6A RNA was achieved, solving the problem of missing information at the single-cell level in existing technologies and providing comprehensive analysis capabilities of transcriptional components, spatial positioning and quantification.
Patent Information
- Application Number
- CN202411686070.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-24
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2044-11-24
AI Technical Summary
Existing technologies make it difficult to achieve multimodal analysis of m6A RNA modifications at the single-cell level and are unable to simultaneously provide transcriptional components, spatial localization, and quantitative information.
By coupling monoclonal antibodies with DNA nanoclusters, a multi-signal integrated nanoprobe was constructed. The fluorescence properties of metal nanoclusters were used for in situ imaging, and quantitative and high-resolution imaging was performed by combining laser ablation inductively coupled plasma mass spectrometry and synchrotron radiation soft X-ray spectroscopy microscopy beamline.
The specific identification, subcellular localization, single-cell quantification and high-resolution imaging of m6A RNA were achieved, providing information on the spatial location and expression level of m6A RNA.
Smart Images

Figure CN119595603B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of nucleic acid detection, and in particular to an RNA mRNA detection method based on antibody-coupled DNA nanocluster probes. 6 A modified single-cell multimodal analysis method. Background Art
[0002] m 6 A (N6-methyladenosine) modification is the most common post-transcriptional modification of eukaryotic mRNA and can affect a variety of biological processes at the cellular level.
[0003] The most commonly used high-throughput sequencing-based technologies, such as MERIP-seq and m 6 A-seq technology can analyze mRNAs at the transcriptome level. 6 Although A modification can provide information on RNA methylation levels, it cannot obtain single-cell and spatial location information. It also has problems such as high cost, the need to input a large number of samples, and inaccurate quantification. Later, PCR quantification technologies that rely on enzyme-assisted recognition were developed, such as T3 ligase-PCR and SELECT technology, which can achieve accurate quantification of methylation at specific sites. However, most of these technologies are limited to the level of population cells, ignoring the analysis of intercellular variability and rare cell populations with biological significance, and losing spatial positioning information. The existing m 6 A RNA imaging technology can achieve quantitative analysis at the single-molecule and single-cell level, but it is difficult to perform in situ analysis and cannot obtain spatial position information; the currently developed m 6 A. In situ imaging technology is still very limited. For example, MR-FISH is a technology that uses in situ hybridization to detect rRNA methylation in single cells. This work successfully obtained the spatial location information of methylated bases in RNA at the single cell level and achieved spatial imaging, but it is also difficult to m 6 A precise quantification, but difficult to perform high-resolution three-dimensional imaging. Therefore, existing methods can provide transcriptional components, spatial positioning and quantitative information separately, but it is difficult to take into account multiple information dimensions. It is necessary to develop multimodal analysis of single cell m 6 A's technology.
[0004] The present invention couples monoclonal antibodies with DNA nanoclusters to construct a multi-signal integrated nanoprobe targeting m 6 A modification. The fluorescent properties of metal nanoclusters can be used to modify m 6 In situ imaging of RNA in a single cell was achieved by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) using the precise molecular formula of the cluster. 6A quantitative analysis of RNA can also be combined with synchrotron radiation soft X-ray spectroscopy microscopy beamline station for high-resolution imaging. Summary of the Invention
[0005] In view of the above problems, the present invention aims to propose an RNAm 6 A modified single-cell multimodal analysis method, specifically adding an azide group to the Fc region 6 A monoclonal antibody is linked to the cluster-targeted DNA sequence through a click chemistry reaction, and then connected to the DNA nanocluster through base complementary pairing, which can target m 6 ARNA is specifically recognized and m 6 A RNA is fluorescently labeled. Taking advantage of the precise molecular formula of the probe, single-cell mRNA is detected by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). 6 A. RNA quantitative analysis. High-resolution imaging is also performed in conjunction with the synchrotron radiation soft X-ray spectroscopy microscopy beamline.
[0006] An RNA mRNA probe based on antibody-coupled DNA nanocluster probes 6 A modified single-cell multimodal analysis method, the specific protocol is as follows:
[0007] (1) Using hairpin DNA as a template, add silver nitrate solution, stir thoroughly, and then add sodium borohydride solution to reduce it to form DNA nanoclusters, which produce red fluorescence.
[0008] (2) Construction of mRNA with specific addition of azide group to Fc region 6 A monoclonal antibody was prepared and alkyne-PEG-active ester (ALK-PEG-NHS) was linked to the antibody via click chemistry.
[0009] (3) Through the coupling reaction of n-hydroxysuccinimide (NHS) and amino groups, a DNA nanocluster targeting sequence (NH2-DNA) was modified on the monoclonal antibody, and the DNA nanocluster was hybridized with the targeting sequence to construct an antibody-coupled DNA nanocluster probe.
[0010] (4) NaAsO2 treatment induced ACE2-HEK293T cells to produce a large number of stress granules in the cytoplasm. Using stress granule core protein G3BP1 as a marker, m 6 A. Colocalization signals of modified RNA and G3BP1.
[0011] (5) The constructed DNA nanocluster probe was introduced into cells induced by NaAsO2 treatment, and m 6ARNA was accurately identified and single-cell mRNA was observed in situ under laser confocal microscopy. 6 A RNA.
[0012] (6) Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to quantify the concentration of silver atoms in a single cell, and then the m 6 A RNA expression level.
[0013] (7) In combination with the synchrotron radiation soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline can be used to perform high-resolution scanning transmission imaging of the spatial structure of cells.
[0014] The following content is a supplement to the technical route in the above solution:
[0015] 1. The hairpin DNA designed in the present invention is an oligonucleotide molecule with a specific structure, comprising a cytosine-rich silver atom / ion binding region and a nucleic acid targeting region. Its sequence (5'-3') is: TATCCGTCCTCCTTCCTCCACGGATAAATAAATAAATAAATAAATAA (47 nt). The NH2-DNA sequence is: NH2-CAAATAGTCATTATTTATTTATTTATTTATTT (32 nt).
[0016] 2. The synthesis process of the DNA-silver nanocluster probe described in the present invention is as follows: 368 μL of 25 μM hairpin DNA solution and 100 μL of 150 μM silver nitrate solution are mixed evenly and stirred for 4 minutes. Then, 110 μL of 50 μM sodium borohydride solution is added to the solution and stirred at 4°C for 6 hours to reduce the silver nitrate to obtain silver nanoclusters.
[0017] 3. Monoclonal antibodies specifically add azide groups to the Fc region 6 A monoclonal antibody. This antibody was obtained from Thermo Fisher Scientific SiteClick TM Antibody Azide Modification Kit modifications were performed according to the kit instructions. After modification, the modified antibodies were stored at -20°C.
[0018] 4. Click chemistry reaction conditions are as follows: 8 μL of 1 mg / ml monoclonal antibody solution, 20 μL of 25 mM ALK-PEG-NHS solution, 10 μL of 1 mM CuSO4 solution, 10 μL of 5 mM sodium ascorbate solution, and 5 μL of 2 mM BTTAA solution were added to a 200 μL EP tube, respectively. Stir at 40°C overnight under nitrogen atmosphere.
[0019] 5. The coupling reaction conditions are as follows: 2 μL of the solution in step (2), 2 μL of 25 μM NH2-DNA solution, 10 μL of DMSO, 2 μL of 300 mM Na2CO3 solution, and 4 μL of DEPC water. The reaction temperature is 28°C and the reaction time is 30 min.
[0020] 6. The NaAsO2 solution of the present invention was diluted to a final concentration of 0.5 mM with a DMEM medium solution containing 10% (v / v) serum, stored in the dark, and incubated with ACE2-HEK293T cells at 37°C for 1 h.
[0021] 7. The antibody and target were incubated for 1.5 h. During confocal laser imaging, a 60x oil objective lens was used, and four channels, DAPI, GFP, RFP, and TD, were selected for imaging and image storage.
[0022] 8. Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to quantify the concentration of silver atoms within single cells. The spot size was set to 35 μm to ensure that the cell boundaries were completely covered and there was no overlap with adjacent cells.
[0023] 9. 2-7×10 4 ACE2-HEK293T cells were seeded on silicon nitride windows and incubated with antibody-conjugated DNA nanocluster probes in a cell culture incubator at 37°C for 1 hour. The cells were then dehydrated using a gradient of ethanol solutions at the following concentrations: 15% (v / v), 35% (v / v), 55% (v / v), 75% (v / v), 85% (v / v), and 95% (v / v), with dehydration taking place for 5 minutes at each concentration.
[0024] An RNA mRNA probe based on antibody-coupled DNA nanocluster probes 6 The technical principle of the A modified single cell multimodal analysis method is as follows: 6 A monoclonal antibody Fc region specifically adds an azide group, using the antibody to specifically recognize m 6 ARNA. Then, the target DNA of the DNA nanocluster is coupled by click chemistry reaction, and the DNA clusters are connected by nucleic acid complementary pairing. The fluorescence properties of metal nanoclusters can be used to achieve m 6 In situ imaging of RNA in a single cell was achieved by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) using the property of clusters with precise molecular formula. 6 A. Quantitative analysis of RNA. High-resolution imaging is performed using a synchrotron radiation soft X-ray spectroscopy microscopy beamline.
[0025] An RNAm probe based on antibody-coupled DNA nanocluster 6Compared with existing technologies, the A-modified single-cell multimodal analysis method has the following advantages:
[0026] (1) For m 6 A-modified RNA is specifically recognized. Specific addition of an azide group to the Fc region of a monoclonal antibody minimizes the destruction of the antigen binding site and preserves binding affinity compared to non-site-specific labeling.
[0027] (2) For m 6 The antibody-coupled DNA nanocluster probe is introduced into fixed cells, and the fluorescent properties of the cluster are used to image the target in situ. The spatial location of methylated transcripts in cells can be visualized, which is helpful for understanding m 6 How A regulates various physiological processes spatially.
[0028] (3) For m 6 A single-cell quantification of RNA modified by A was performed. Red fluorescent silver nanoclusters with precise molecular composition were designed and synthesized using DNA as a template, with the molecular formula (Ag)8(DNA)1. Combined with laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), single-cell RNAm 6 Quantitative analysis of A modifications.
[0029] (4) High-resolution single-cell imaging. Combined with the synchrotron radiation soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline can perform scanning transmission imaging of spatial structures with a resolution of 30nm and high-resolution imaging of specific elements in the material and dual-energy contrast imaging of their content. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1A 、 1B Optimization diagram of the synthesis time and concentration of (Ag)8(DNA)1 silver nanoclusters in Example 1 of the present invention
[0031] Figure 2 This is the fluorescence spectrum of the (Ag)8(DNA)1 silver nanoclusters of Example 1 of the present invention.
[0032] Figure 3 This is a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) diagram of the (Ag)8(DNA)1 silver nanoclusters of Example 1 of the present invention.
[0033] Figure 4 DLS particle size distribution diagram of (Ag)8(DNA)1 silver nanoclusters in Example 1 of the present invention
[0034] Figure 5Example 2 of the present invention is a flow chart for preparing antibody-coupled DNA nanocluster probes
[0035] Figure 6 This is the polyacrylamide gel electrophoresis image of the antibody-coupled DNA nanocluster probe of Example 2 of the present invention
[0036] Figure 7 This is a laser confocal microscopy image of the antibody-coupled DNA nanocluster probe in Example 3 of the present invention on ACE2-HEK293T cells
[0037] Figure 8A 、 8B This is the laser ablation inductive coupling standard curve and standard sample point diagram of the antibody-coupled DNA nanocluster probe of Example 4 of the present invention
[0038] Figure 9A 、 9B 9C is the laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) signal diagram of Example 4 of the present invention with and without NaAsO2 stimulation, and 9C is the difference analysis diagram of the two cases.
[0039] Figure 10 This is a scanning transmission imaging diagram of a high-resolution spatial structure using scanning transmission X-ray microscopy (STXM) according to Example 5 of the present invention. DETAILED DESCRIPTION
[0040] The following embodiments are intended to facilitate a better understanding of the present invention and provide a clear and complete description of the technical solutions in the embodiments of the present invention. They are not to be construed as limiting the scope of protection of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.
[0041] Unless otherwise specified, all experimental materials, reagents, and equipment in the examples can be obtained through conventional purchasing channels.
[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0043] The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0044] Example 1: Preparation of Silver Nanoclusters (Ag)8(DNA)1 with Precise DNA Molecular Count
[0045] 368 μL of 25 μM hairpin DNA solution with the sequence TATCCGTCCTCCTTCCTCCACGGATAAATAAATAAATAAATAAATAA (47 nt) and 100 μL AgNO3 (150 μM) solution were mixed evenly and stirred for 4 min. Subsequently, 110 μL of NaBH4 (50 μM) solution was added to the above mixed solution and stirred at 4 ° C for 6 h to reduce AgNO3. The synthesized silver nanoclusters were separated and purified by centrifugal filters (Millipore, 50 kDa and 3 kDa MWCO membranes) to cut off the aggregated nanoclusters and free ions. Then, the silver nanoclusters were purified by HPLC system (Agilent 1260 Infinity, USA), and the HPLC column was C18 column ( Silver nanoclusters were purified and collected using a 30×4.6 mm (30×4.6 mm) mobile phase consisting of 0.01 M trimethylamine acetate buffer and acetonitrile as a modifier. The UV detection wavelength was set at 260 nm. The silver nanoclusters were stored at 4°C in the dark before further use. The synthesized silver nanoclusters exhibited pink fluorescence under visible light and red fluorescence under UV light. Figure 1A 、 1B As shown in the figure, the optimization diagram of the synthesis time and concentration of silver nanoclusters shows that the optimal synthesis time is 6h and the optimal DNA concentration is 50μM.
[0046] like Figure 2 As shown, the fluorescence spectrum shows that the optimal fluorescence excitation peak of silver nanoclusters is 540nm, and the optimal fluorescence emission peak is at 630nm.
[0047] like Figure 3 As shown, the results of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) showed that 8 silver atoms were bound to one DNA chain, and it was concluded that the composition of the silver nanocluster was (Ag)8(DNA)1.
[0048] like Figure 4 As shown, the hydrated particle size of (Ag)8(DNA)1 measured by DLS is 3.22 nm.
[0049] Example 2: Preparation of antibody-coupled DNA nanocluster probes
[0050] The preparation process of antibody-coupled DNA nanoclusters is as follows Figure 5 As shown, 40 μL of 1 mg / ml m 6 A monoclonal antibody solution using Thermo Fisher SiteClick TM The antibody azide modification kit was used to modify the Fc region to specifically add an azide group. 6A monoclonal antibody. Then it was purified by HPLC system (Agilent 1260 Infinity, USA), and the HPLC column was C18 column ( 30×4.6mm), the mobile phase was 0.01M trimethylamine acetate buffer, acetonitrile was the modifier, and the modified antibody solution was purified and collected at 260nm. The antibody solution was concentrated to 1mg / ml by a centrifugal filter (Millipore, 50kDa MWCO membrane). OD280 = 1.4 was measured using an enzyme-labeled absorbance detection system. Subsequently, a click chemistry reaction between azide and alkyne groups was performed. 8μL of 1mg / ml monoclonal antibody solution, 20μL of 25mM ALK-PEG-NHS solution, 10μL of 1mM CuSO4 solution, 10μL of 5mM sodium ascorbate solution, and 5μL of 2mM BTTAA solution were added to a 200μL EP tube, and stirred overnight at 40°C under a nitrogen atmosphere. Next, the NHS-amino group coupling reaction was performed by adding 2 μL of the solution from the previous step, 2 μL of the 25 μM NH₂-DNA solution, 10 μL of DMSO, 2 μL of the 300 mM Na₂CO₃ solution, and 4 μL of DEPC water. The reaction temperature was 28°C for 30 minutes. Finally, 10 μL of the solution from the previous step and 10 μL of the 20 μM silver nanocluster solution were added and reacted at 37°C for 1 hour. The coupled antibody probe was separated and purified using a centrifugal filter (Millipore, 50 kDa MWCO membrane).
[0051] like Figure 6 As shown, polyacrylamide gel electrophoresis characterized the molecular weight of the heavy chain before and after modification. The molecular weight of the heavy chain after modification increased by 10KD compared with that before modification. The increased molecular weight is the molecular weight of the NH2-DNA sequence.
[0052] Example 3: Confocal laser scanning microscopy localization study of antibody-coupled DNA nanoclusters on ACE2-HEK293T cells
[0053] The density is 2-7×10 4ACE2-positive HEK293T cells were seeded on glass slides and divided into two groups. Each group was cultured in a 37°C cell culture incubator for 1 hour in the presence or absence of NaAsO2. NaAsO2 was diluted to a final concentration of 0.5 mM in DMEM medium containing 10% (v / v) serum. The cells were then washed with PBS and fixed with 4% (v / v) paraformaldehyde for 15 minutes, followed by washing with PBS. The cells were treated with 0.5% (v / v) Triton X-100 for 5 minutes, then washed with PBS. The cells were incubated with 5% (v / v) BSA at 37°C for 1 hour. Hybridization of the antibody-conjugated DNA nanocluster probe with the target mRNA was performed in a 20 μL system. 10 μL of the purified probe solution from Example 2 was mixed with 10 μL of 1% (v / v) G3BP1 antibody solution and incubated with the ACE2-positive HEK293T cells seeded on the glass slide in a 37°C cell culture incubator for 1.5 hours. Then, the cells were washed with PBS-T solution [DEPC-PBS solution containing 0.05% (v / v) Tween-20] for 3 min. 2% (v / v) (Alexa Fluor 488) goat anti-mouse antibody solution (20 μL) was incubated with the cells on the glass slides in a cell culture incubator at 37°C for 1 hour. Fluoromount-G (containing 4',6-diamidino-2-phenylindole (DAPI)) was then added to counterstain the cell nuclei, and the coverslips were mounted for imaging. Finally, the cells were imaged using an UltraVIEW Vox confocal laser scanning system accessory (PerkinElmer) and a Nikon microscope.
[0054] The results are as follows Figure 7 As shown in the figure, under confocal microscopy, the synthesized probe has a good imaging effect in ACE2-HEK293T cells in situ, and the red fluorescence is the intracellular m 6 A-modified RNA. The green fluorescence represents G3BP1 protein in stress granules within single cells. As can be seen from the figure, the two proteins clearly co-localize.
[0055] Example 4: Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to analyze the mRNA expression of ACE2 in single HEK293T cells. 6 A. RNA quantitative analysis.
[0056] LA-ICP-MS measurements were performed using an NWR 213 laser ablation system and a Nexion 300D ICP-MS instrument (PerkinElmer, Norwalk, CT, USA). Helium was used as the ablation gas. The flow rate of helium was 0.6 L min -1After cell ablation, argon gas was injected through the Y-shaped tube. During the ablation process, the 115In signal intensity was adjusted to the maximum value. The signal intensity was recorded as a function of time (counts per second (CPS)). We seeded ACE2-HEK293T cells (2-7×10 4 10 μL of the purified probe solution from Example 2 was co-incubated with seeded ACE2-HEK293T cells in a 37°C cell culture incubator for 1.5 hours. To ensure complete laser ablation of individual cells, a 35 μm diameter region was ablated at the corresponding cell location. This diameter was selected to ensure that the cell boundaries were completely covered by the laser and that there was no overlap with adjacent cells.
[0057] like Figure 8A 、 8B This is the standard curve and standard sample points of silver in LA-ICP-MS.
[0058] like Figure 9A 、 9B , 9C, compared with no NaAsO2 stimulation, the single cell m 6 A concentration decreased significantly. A single signal intensity peak is the m 6 A RNA.
[0059] Example 5: In combination with the synchrotron radiation soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline can be used to perform high-resolution scanning transmission imaging of spatial structures.
[0060] ACE2-HEK293T (2-7×10 4Cells were seeded on silicon nitride windows and divided into two groups. They were incubated in a 37°C cell culture incubator for 1 hour in the presence or absence of NaAsO2, where NaAsO2 was diluted to a final concentration of 0.5 mM in DMEM medium containing 10% (v / v) serum. The cells were then washed with PBS and fixed with 4% (v / v) paraformaldehyde solution for 15 minutes and washed with PBS. They were treated with 0.5% (v / v) Triton X-100 solution for 5 minutes and then washed with PBS. They were incubated with 5% (v / v) BSA solution at 37°C for 1 hour. Subsequently, the antibody-coupled DNA nanocluster probe was hybridized with the target mRNA. 20 μL of the antibody coupled and purified in Example 2 was taken and incubated with ACE2-HEK293T cells in a 37°C cell culture incubator for 1.5 hours. The sample was then washed for 3 minutes using PBS-T solution [DEPC-PBS solution containing 0.05% (v / v) Tween-20] and dehydrated using a gradient of ethanol concentrations: 15% (v / v), 35% (v / v), 55% (v / v), 75% (v / v), 85% (v / v), and 95% (v / v), with each concentration dehydrating for 5 minutes. The radiation energy was set to 642 eV, and the step size was 0.05 μm for scanning. Figure 10 As shown in the figure, there are obvious stress granules in cells after NaAsO2 stimulation compared with those without NaAsO2 stimulation. The three-dimensional image also successfully shows that m 6 Spatial distribution of A sites.
Claims
1. An RNAm based on antibody-coupled DNA nanocluster probe 6 A modified single cell multimodal analysis method, characterized in that The following steps are involved: Using hairpin DNA as a template, silver nitrate solution was added, stirred thoroughly, and then sodium borohydride solution was added to reduce it to form DNA nanoclusters, which emitted red fluorescence. Constructing m-type Fc region-specific addition of azide groups 6 A monoclonal antibody, and alkyne-PEG-active ester ALK-PEG-NHS was linked to the antibody via click chemistry reaction; Through the coupling reaction of n-hydroxysuccinimide NHS with amino groups, a DNA nanocluster targeting sequence NH2-DNA is added to the monoclonal antibody, and the DNA nanocluster and the targeting sequence are hybridized to construct an antibody-coupled DNA nanocluster probe; Treatment with NaAsO2 induced the production of stress granules in the cytoplasm of ACE2-HEK293T cells. Using stress granule core protein G3BP1 as a marker, m 6 A. Colocalization signal of modified RNA and G3BP1; The constructed antibody-coupled DNA nanocluster probe was introduced into cells induced by NaAsO2 treatment, and the antibody was used to bind to the m 6 ARNA was identified and mRNA in single cells was observed in situ under laser confocal microscopy. 6 ARNA; At the same time, laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to quantify the concentration of silver atoms in single cells, and then the m 6 ARNA expression level; And combined with the synchrotron radiation soft X-ray spectroscopy microscopy beamline station, the scanning transmission X-ray microscopy (STXM) of the beamline station was used to perform scanning transmission imaging of cells; The hairpin DNA sequence is: TATCCGCTCCTCCTTCCTCCACGGATAAATAAATAAATAAATAAATAA; the NH2-DNA sequence is: NH2-CAAATAGTCATTATTTATTTATTTATTTATTT; In step (2), the click chemistry reaction conditions are as follows: 8 μL of 1 mg / ml monoclonal antibody solution, 20 μL of 25 mM ALK-PEG-NHS solution, 10 μL of 1 mM CuSO4 solution, 10 μL of 5 mM sodium ascorbate solution, and 5 μL of 2 mM BTTAA solution were added, and stirred at 40°C under a nitrogen atmosphere; In step (3), the coupling reaction conditions are as follows: 2 μL of the solution in step (2), 2 μL of 25 μM NH2-DNA solution, 10 μL of DMSO, 2 μL of 300 mM Na2CO3 solution, and 4 μL of DEPC water, the reaction temperature is 28°C, and the reaction time is 30 min.
2. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that In step (1), the synthesis process of the DNA nanoclusters is as follows: 368 μL of 25 μM hairpin DNA solution and 100 μL of 150 μM silver nitrate solution are mixed evenly, stirred for 4 min, and then 110 μL of 50 μM sodium borohydride solution is added to the mixed solution, and the mixture is stirred at 4°C for 6 h to reduce the silver nitrate to obtain DNA nanoclusters.
3. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that In step (2), the monoclonal antibody is an Fc region-specific azide group added to the 6 A monoclonal antibody.
4. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that In step (4), the final concentration of the NaAsO2 solution was 0.5 mM and the solution was incubated with ACE2-HEK293T cells at 37°C for 1 h.
5. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that In step (5), the antibody was co-incubated with ACE2-HEK293T cells at 37°C for 1.5 h. During the laser confocal imaging operation, a 60x oil objective lens was selected, and four channels, DAPI, GFP, RFP, and TD, were selected for photographing and image storage.
6. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that In step (6), 2-7×10 ACE2-HEK293T cells were seeded on the coverslip. 4 The cells were co-incubated with antibody-coupled DAN nanocluster probes at 37°C for 1.5 h. To completely ablate a single cell, an area with a diameter of 35 μm was ablated at the corresponding cell position. The diameter was selected to ensure that the cell boundary was completely covered and there was no overlap with adjacent cells.
7. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that In step (7), 2-7×10 4 ACE2-HEK293T cells were seeded on a silicon nitride window and incubated with the constructed probe at 37°C for 1.5 h, followed by dehydration with gradient ethanol concentrations. The concentrations of the ethanol solutions were: 15% v / v, 35% v / v, 55% v / v, 75% v / v, 85% v / v, and 95% v / v, and dehydration was performed for 5 min at each concentration.