Application of Lemon CiKNOX I Gene in Regulating Fruit Ripening

Abstract

This invention provides lemon CiKNOX I The gene and its application in regulating the ripening of tomato and citrus fruits belong to KNOX Family Class 1 ( KNOX I The gene is a member whose CDS sequence is shown in SED ID NO.1 and whose encoded amino acid sequence is shown in SED ID NO.2. Overexpression or silencing vectors of this gene were constructed, and then transfected into tomatoes and citrus fruits using an Agrobacterium-mediated genetic transformation system. Phenotypic observation and analysis validated the results. CiKNOX I Genes have the function of significantly regulating the fruit ripening process, and this invention provides new gene resources for designing breeding based on the fruit ripening process.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to lemons. CiKNOX Ⅰ The application of genes in regulating fruit ripening. Background Technology

[0002] Citrus fruits are the world's largest fruit producer, belonging to the perennial woody fruit tree family, and play an indispensable and crucial role in my country's horticultural economy. Fresh consumption dominates the consumption structure of citrus products in my country. Currently, the main ripening period for citrus fruits in my country is from November to February of the following year. However, the quantity of extra-early and late-maturing high-quality citrus varieties remains relatively scarce. This situation means that my country's fresh fruit supply is still significantly less than the ideal goal of achieving a year-round balanced supply. This unbalanced market supply pattern cannot fully meet consumers' continuous demand for fresh citrus fruits, thus having a very negative impact on the economic benefits of the citrus planting industry.

[0003] Similarly, tomatoes, as a widely cultivated and popular fruit and vegetable globally, occupy a pivotal position in the vegetable industry. Tomatoes have diverse consumption channels; however, in my country, the harvest season for land-grown tomatoes is currently concentrated in the summer months of June to August. The relative scarcity of early-maturing and late-maturing high-quality tomato varieties makes it difficult to fully meet the diverse market demands at different times. This unbalanced supply pattern not only hinders the maintenance of stable market prices but also negatively impacts the overall economic benefits of the tomato industry.

[0004] Based on this, the systematic analysis of the regulatory mechanisms in the process of crop fruit ripening and the in-depth exploration of key genes involved in ripening regulation are of great economic value for promoting the scientific breeding of new varieties of crops with different ripening periods and optimizing the ripening structure of the industry. Summary of the Invention

[0005] In view of this, the present invention provides lemon CiKNOX Ⅰ The application of genes in regulating fruit ripening can lay the foundation for a systematic analysis of the regulatory mechanisms in the process of crop fruit ripening.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] One of the objectives of this invention is to provide lemons CiKNOX Ⅰ The application of genes in regulating fruit ripening, the aforementioned CiKNOX Ⅰ The CDS sequence of the gene is shown in SED ID NO.1.

[0008] The second objective of this invention is to provide the above-mentioned lemon. CiKNOX ⅠA gene-encoded protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] Furthermore, the above applications are specifically manifested as follows:

[0010] When overexpression CiKNOX Ⅰ In the genetically modified form, the fruit matures earlier than the wild type;

[0011] when CiKNOX Ⅰ When the gene is suppressed, the fruit matures later than the wild type;

[0012] The fruits include tomatoes and citrus fruits.

[0013] The third objective of this invention is to provide the above-mentioned lemon. CiKNOX Ⅰ Recombinant gene expression vectors.

[0014] In some specific embodiments, preferably, when the recombinant expression vector is an overexpression vector, pBI121 is used as the expression vector, and the target gene fragment is fused with the vector using homologous recombination to construct the expression vector.

[0015] When the recombinant expression vector is a silencing vector, pTRV2 is used as the expression vector, and the target gene fragment is fused with the vector using homologous recombination.

[0016] In some specific embodiments, preferably, lemon is used when constructing the recombinant expression vector. CiKNOX Ⅰ The forward primer sequence used for gene cloning is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4.

[0017] In some specific embodiments, preferably, the forward primer sequence used for amplification when constructing the overexpression vector is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.6;

[0018] The forward primer sequence used for amplification when constructing the silencing vector is shown in SEQ ID NO.7, and the reverse primer sequence is shown in SEQ ID NO.8.

[0019] The fourth objective of this invention is to provide an engineered bacterium containing the above-mentioned recombinant expression vector.

[0020] The fifth objective of this invention is to provide a method for regulating the fruit ripening cycle, comprising the following steps:

[0021] By infecting plants or fruits with the aforementioned engineered bacteria and identifying them as transgenic, the fruit ripening cycle can be regulated.

[0022] Furthermore, when the engineered bacteria contain an overexpression vector, early fruit ripening can be achieved; when the engineered bacteria contain a silencing vector, delayed fruit ripening can be achieved.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] This invention utilizes gene cloning technology to isolate and clone the lemon fruit ripening gene from lemons. CiKNOX Ⅰ Furthermore, by constructing overexpression and silencing vectors, the gene was transformed into Citrus reticulata and tomato using an Agrobacterium-mediated genetic transformation system, revealing its function in regulating fruit ripening. Specifically, overexpression in tomato... CiKNOX Ⅰ The gene causes the fruit to ripen significantly earlier in tomatoes compared to the wild type; it is overexpressed in four-season oranges. CiKNOX Ⅰ Genetics also cause the fruit to ripen earlier than the wild type; silent in the evergreen mandarin orange. CiKNOX Ⅰ The genes cause the fruit to ripen later than the wild type. This finding provides excellent genetic resources for the subsequent breeding of crops with controllable ripening time. Attached Figure Description

[0025] Figure 1 for CiKNOX Ⅰ A diagram illustrating the genetic transformation process of TS-82 tomatoes and a gel image showing the DNA positivity of transgenic seedlings.

[0026] Figure 2 For overexpression CiKNOX Ⅰ The results of the statistical analysis of the fruit images (AC) of the gene-modified tomatoes and the control group, as well as the number of days for fruit color change (D), firmness (E), soluble solids (F), and fruit shape index (G).

[0027] Figure 3 for CiKNOX Ⅰ Phenotypic observation after transient overexpression of the gene in Citrus aurantiaca.

[0028] Figure 4 The results of transient transformation of four-season oranges with engineered bacteria containing overexpression vectors, including color index (A), soluble solids content (B), titratable acid content (C), solids-acid ratio (D), lutein content (E), chlorophyll content (FG), and gene expression level (H), are shown in the figure.

[0029] Figure 5 for CiKNOX Ⅰ Phenotypic observation after transient silencing of genes in Citrus aurantiaca.

[0030] Figure 6The results of transient transformation of four-season oranges with engineered bacteria containing silencing vectors, including color index (A), soluble solids (B), titratable acid (C), solid-acid ratio (D), lutein (E), chlorophyll content (FG), and gene expression level (H), are shown in the figure. Detailed Implementation

[0031] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.

[0032] Key experimental material sources and physicochemical parameters:

[0033] Example 1

[0034] This embodiment provides fruit ripening regulation. CiKNOX Ⅰ Methods for cloning genes, which belong to KNOX Family Class 1 ( KNOX Ⅰ For members, the specific steps are as follows:

[0035] (1) RNA extraction from lemon leaves

[0036] Take fresh plant tissue (lemon leaves) and grind it thoroughly in liquid nitrogen, or cut the plant tissue into small pieces and grind it rapidly in TRIPURE. Add 1 mL of TRIPURE for every 50-100 mg of plant tissue, mix well, and perform the entire process on ice. Add 0.2 mL of pre-chilled chloroform to every 1 mL of TRIPURE. Tightly cap the tube, shake vigorously for 15 seconds, and let stand for 2-3 minutes. Centrifuge at 12000 rpm at 4°C for 15 minutes. Transfer the supernatant (approximately 500 μL) to a clean 1.5 mL RNAase-free centrifuge tube, add an equal volume of pre-chilled isopropanol, invert and mix well, and place at -20°C for 30 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes and discard the supernatant. Wash the precipitate with 1 mL of pre-chilled 75% ethanol, centrifuge at 12000 rpm at 4°C for 5 minutes, and discard the supernatant. The remaining small amount of liquid can be briefly centrifuged and then aspirated with a pipette tip, being careful not to aspirate the precipitate. Place on ice for 2-3 minutes to air dry. Add 30 μL of RNase-free water to fully dissolve the RNA. Take 3 μL of the RNA solution for electrophoresis to check the extraction quality. The remaining RNA can be used directly for reverse transcription or stored at -80℃ to prevent degradation.

[0037] (2) Reverse transcription

[0038] The HiScript reverse transcription kit from Nanjing Novizan Biotechnology Co., Ltd. was used. ®II. Reverse transcription was performed using QRT SuperMix for qPCR (+gDNA wiper). All procedures were conducted in a clean bench, and the reaction steps are as follows:

[0039] a) Genomic DNA removal

[0040] Prepare the following mixture in RNase-free centrifuge tubes:

[0041]

[0042] Gently mix using a pipette. React at 42°C for 2 min.

[0043] b. Preparation of the reverse transcription reaction system

[0044] Add 5×HiScript II qRT SuperMix II to the reaction tube in step a:

[0045]

[0046] Use a pipette to gently mix the liquid.

[0047] c. The procedure for performing the reverse transcription reaction is as follows:

[0048]

[0049] After the reaction is complete, store at 4℃ for later use, and store at -80℃ for long-term storage.

[0050] (3) CiKNOX Ⅰ Cloning of gene CDS region

[0051] Using total cDNA obtained from reverse transcription of RNA from lemon leaf tissue as a template, the high-fidelity DNA polymerase Phantadine from Nanjing Novizan Biotechnology Co., Ltd. was used. ® PCR amplification was performed using the Max Super-Fidelity DNAPolymerase kit.

[0052] The forward primer is 5'-ATGGAGGGTTACAACAGTCT-3' (SEQ ID NO.3);

[0053] The reverse primer is 5'-TCATGGTCCCAAACGGTATG-3' (SEQ ID NO.4).

[0054] All operations were performed on ice. After each group was thawed and thoroughly mixed, it was promptly returned to -20°C for storage after use. The amplification reaction system is as follows:

[0055]

[0056] The PCR amplification procedure is as follows:

[0057]

[0058] After the PCR amplification reaction was completed, the product was removed, detected by gel electrophoresis, and then stored in a 4°C refrigerator for a short period of time before the target fragment was recovered.

[0059] Example 2

[0060] This embodiment provides the construction of the overexpression vector and its transformation with Agrobacterium, as detailed below:

[0061] The overexpression vector was constructed using pBI121 as the expression vector, employing homologous recombination to fuse the target gene fragment with the vector. All reagents used were ClonExpress from Nanjing Novizan Biotechnology Co., Ltd. ® The specific experimental procedures for the IIOne StepCloning Kit are as follows:

[0062] 1) The pBI121 vector plasmid was double-digested with restriction endonucleases XbaⅠ and XhoⅠ. After digestion at 37℃ for 1 hour, the linearized vector was recovered.

[0063] 2) Design recombinant primers and utilize... CiKNOX Ⅰ The cloned product of the gene's CDS region was used as a template for PCR amplification.

[0064] The recombinant forward primer is: 5'-AGAACACGGGGGACTCTAGAGAGGGTTACAACAGTCT-3' (SEQ ID NO. 5);

[0065] The recombinant reverse primer is: 5'-GGGATCCGCGGCCGCTCGAGTCATGGTCCCAAACGGT-3' (SEQ ID NO. 6).

[0066] 3) Amplification reaction system and CiKNOX Ⅰ The gene CDS region amplification system is consistent, and the recombinant amplification products are recovered.

[0067] 4) After preparing the linearized vector and the target gene fragment, measure the recovery concentration, adjust the ratio between them, and carry out the ligation reaction at 37℃. The specific recombination ligation reaction system is as follows:

[0068]

[0069] Five minutes before the end of ligation, remove competent DH5α cells from a -80°C freezer and thaw on ice. Add all the ligation product to the DH5α competent cells and mix thoroughly with a pipette. Incubate on ice for 30 min, then heat shock at 42°C for 90 s in a mixer, followed by 1 min on ice. Add 400 μL of blank LB liquid medium and incubate at 37°C on a shaker at 220 rpm for 1 h. Centrifuge at 12000 rpm for 1 min, collect the supernatant, and retain 100 μL of the supernatant. Spread the supernatant onto LB solid culture dishes containing kanamycin and incubate upside down at 37°C overnight.

[0070] 5) Select single-clone plaques for PCR detection, send the positive bacterial solutions to the company for sequencing, and then perform sequence alignment analysis to finally confirm that the vector construction was successful.

[0071] 6) Extract plasmids from the correctly sequenced E. coli culture. Refer to the instructions for the E. coli plasmid extraction kit from Adley Biotechnology Co., Ltd. Transform the extracted plasmids into Agrobacterium competent cells GV3101. The specific steps are as follows:

[0072] After removing Agrobacterium competent cells GV3101 from the -80℃ freezer, freeze-thaw them on ice, add 0.1-1 μg of plasmid, place on ice for 5 min, flash-freeze in liquid nitrogen for 5 min, quickly remove and incubate at 37℃ for 5 min, then place on ice for 5 min. Add 800 μL of blank liquid LB medium to the competent cells and activate them on a shaker at 220 rpm for 3 h at 28℃. Centrifuge at 12000 rpm for 1 min, discard the supernatant, and keep 100 μL of bacterial culture. Mix well and spread on LB solid culture dishes containing kanamycin and rifampin, and incubate upside down in a 28℃ incubator for 2-3 days.

[0073] 7) Select single-clone plaques for PCR detection. Mix the positive clone bacterial solution with 50% glycerol at a 1:1 ratio and store it in a -80℃ refrigerator for later use. It can then be used for plant transformation after activation.

[0074] Example 3

[0075] This embodiment focuses on the genetic transformation of tomatoes using the positive clone bacterial solution obtained in Example 2. The specific steps are as follows:

[0076] 3.1 Tomato inoculation

[0077] The specific preparation steps are as follows: Soak the required seeds in water for 15 minutes, stir and wash with 75% alcohol for 1-2 minutes, wash the seeds with 50% sodium hypochlorite solution for 15 minutes, wash the seeds with sterile water 4-5 times, absorb the moisture on the surface of the seeds with sterile filter paper, inoculate them onto 1 / 2 MS medium, and culture them for one week under 16 hours of light and 25℃ until the two cotyledons unfold.

[0078] 3.2 Preparation of Agrobacterium-mediated transformation and infection solution

[0079] Before genetic transformation of tomatoes, Agrobacterium needs to be activated to ensure the bacteria are in a good active state for the preparation of the transformation infection solution. The specific steps are as follows:

[0080] Strain activation: The strain ligated with the pBI121 overexpression vector CiKNOX Ⅰ Agrobacterium genera were inoculated into solid LB medium containing kanamycin and rifampin and incubated upside down in a 28°C incubator for 2 days to perform the first activation.

[0081] Colony propagation: After confirming positive results by picking a single Agrobacterium tumefaciens clone, the colony was shaken, mixed, and then re-inoculated into solid LB medium containing kanamycin and rifampin. The colony was then incubated upside down in a 28°C incubator for 2 days to perform a second activation.

[0082] Preparation of infection solution: All bacterial cells were scraped into MS suspension medium and placed in a shaker at 220 rpm and 28°C for 1 hour to ensure complete dispersion. The concentration of the suspension was measured using a UV spectrophotometer, and the OD was adjusted accordingly. 600 When the pH value is between 0.4 and 0.6, add acetylsuccinone (AS, 50 mg / L) and place in a constant temperature incubator at 28℃ for later use.

[0083] 3.3 Infection and Co-culture Process

[0084] The tomato cotyledons were co-cultured with the prepared infection solution. The specific steps of this process are as follows:

[0085] a) Infection process: In a clean bench, tomato cotyledons that have been cultured for one week and are in good condition are cut off on sterile filter paper using a sterile scalpel, creating a trapezoidal shape approximately 0.5 cm long at the junction of the leaf blade and petiole. The cut should be as slanted as possible to increase the cut area and promote transformation. The explants are immediately placed in MS suspension medium to keep the cuts moist, preventing them from drying out and affecting transformation efficiency. All the cut explants are then immersed in the prepared Agrobacterium infection solution. The mouths of the Erlenmeyer flasks are sealed with sealing film and placed in a constant temperature shaker at 220 rpm and 28°C for 20 minutes.

[0086] b) Co-culture process: In a clean bench, discard the bacterial culture, blot dry the Agrobacterium infection solution remaining on the surface of the explant with sterile filter paper, and place the explant in a co-culture medium (MS+AS, 50mg / L) with the back of the cotyledon facing up, and co-culture for 2 days in a 21℃ incubator in the dark.

[0087] 3.4 Screening and Culture

[0088] Cotyledons cultured for 48 hours were initially screened for two weeks using a selection medium supplemented with kanamycin (MS + IAA 1 mg / L + ZR 1 mg / L + Tim 300 mg / L + Km 50 mg / L + Agar 8 g / L). During the selection culture, the cotyledons were placed with the upper surface facing upwards.

[0089] 3.5 Subculture

[0090] After two weeks of culture, the well-growing explants were transferred to subculture medium (MS + ZR 1 mg / L + Tim 300 mg / L + Km 50 mg / L + Agar 8 g / L) and subcultured for about two weeks. Well-growing callus and adventitious buds were retained and cultured for another two weeks.

[0091] 3.6 Rooting Culture

[0092] When the adventitious buds grow to 2-3 cm, cut them off from the root and transfer them to rooting medium (MS + IBA 1 mg / L + Agar 8 g / L) to induce rooting.

[0093] Example 4

[0094] This embodiment focuses on the positive identification of the transfected plants obtained in Example 3, and finally confirms the positive transgenic material. The specific steps are as follows:

[0095] DNA was extracted from the obtained tomato material, and PCR amplification was used to identify positive results, thus confirming that the target gene fragment had been successfully transferred into the plant material.

[0096] 4.1 DNA extraction from tomato leaves

[0097] Take an appropriate amount of fresh plant leaves and place them into a 2.0 mL centrifuge tube containing small steel balls. Mark the tube and quickly place it in liquid nitrogen for flash freezing. Pre-cool the adapter in the sample grinder with liquid nitrogen. Place the 2.0 mL centrifuge tube containing the sample and small steel balls symmetrically in the adapter, close the lid, set the frequency to 40 Hz, the time to 30 sec, and grind the sample twice.

[0098] After grinding, check if the sample is completely ground (no intact tissue, just uniform powder). Immediately open the centrifuge tube cap and add 1 mL of DNA extraction buffer (100 mL CTAB + 2% β-mercaptoethanol). Cover the tube and mix by inverting it 7-8 times. Incubate in a 65°C water bath for 30 minutes, mixing by inverting it 7-8 times every 10 minutes.

[0099] After the water bath is completed, the sample is temporarily stored in a fume hood and cooled to room temperature. Then, the cap is opened, 800 μL of chloroform is added, and the mixture is inverted 7-8 times. The sample is then centrifuged at 12,000 r / min for 15 min. Approximately 800 μL of the supernatant is then transferred to a new 1.5 mL centrifuge tube.

[0100] Add an equal volume of pre-cooled isopropanol to the centrifuge tube, mix thoroughly by inverting, and precipitate at -20°C for 40 minutes (or overnight).

[0101] Remove from the -20°C freezer and centrifuge at 12,000 rpm for 15 min in a pre-cooled centrifuge at 4°C. Discard the supernatant and wash twice with 75% ethanol.

[0102] Centrifuge at 12,000 rpm for 2 min in a pre-cooled centrifuge at 4°C. Remove any residual liquid with a pipette. Dry in a fume hood for 2-3 min. Add 40 μL of ddH2O. After the DNA is completely dissolved, store at -20°C for later use.

[0103] 4.2 DNA Positive Identification

[0104] Positive plants were identified using forward and reverse primers. Among the selected transgenic lines, those that could amplify fragments of the expected size were considered positive transgenic lines. Ultimately, 11 positive plants were verified.

[0105] Example 5

[0106] This embodiment further observes and analyzes the phenotypic characteristics of the positive plants obtained in Example 4, as detailed below:

[0107] (1) Fruit shape index: The transverse and longitudinal diameters are measured by vernier calipers. Fruit shape index = longitudinal diameter / transverse diameter, and the average value is calculated. The unit of measurement is mm.

[0108] (2) Fruit firmness test: The firmness test was conducted using a GY-3 fruit firmness tester. Four points were randomly selected at the top, equator, and bottom of the fruit, and the peel was removed from each point. Holding the fruit firmly with one hand, the tester plug was slowly and vertically inserted into the fruit with the other hand. Insertion was stopped when the plug reached the graduation mark, and the data was recorded (unit: kg / cm²). 2 Or N).

[0109] (3) Fruit peel color determination: A benchtop spectrophotometer was used for measurement. The fruit peel surface was wiped clean, and four points were randomly selected at the top, equator, and bottom of the fruit for measurement. The illumination geometry was 0 / d, the standard illuminator was D65, and the field of view was 10°. Recording was performed. , , value. It is a brightness variable; the larger the value, the brighter the surface of the sample being measured. It represents the red-green hue, with positive values ​​indicating redness and negative values ​​indicating greenness. It represents the yellow-blue tint; positive values ​​indicate yellowness, and negative values ​​indicate blueness.

[0110] (4) Determination of soluble solids: The soluble solids content was determined using a PAL-1 handheld refractometer (Atago, Japan). Representative ripe fresh fruits were randomly divided into 3 groups. Half of the pulp from each group of 4 fruits was longitudinally cut, juiced, filtered, and the mixed filtrate was used for determination. Before each use, the refractometer was zeroed with distilled water. Before measuring the sample, it was important to mix it thoroughly and rinse it with the test liquid. Measurements were taken at least three times until the readings stabilized, and the data were recorded.

[0111] (5) Titratable acid content determination: The total organic acid content was determined using a GMK-835F fruit acidity meter (G-WON, South Korea). The specific method is as follows: Representative fruits were divided into three groups. Three to five samples were taken from different parts of the fruit. The peel was removed, and the pulp was juiced using a juicer. The juice was then filtered through a gauze filter. The juicer cup was cleaned between each juicing process to obtain freshly squeezed juice samples for later use. For the determination, the juice was first diluted. 30 mL of distilled water was poured into a small bottle, and 0.306 mL of juice was added. After mixing, the juice was measured three times, and the average value was used as the standard. The data was recorded.

[0112] (6) Extraction method of chlorophyll and xanthophyll: The extraction was carried out by acetone grinding. 0.25g of fruit peel powder was weighed into a 10mL centrifuge tube, 5mL of acetone was added, shaken well, sealed with sealing film, and extracted in the dark environment of 4℃ for 12h. After centrifugation at 3500r for 10min, the supernatant was collected. The residue was extracted again with 2mL of acetone. The supernatants were combined and transferred to a separatory funnel. 5mL of ether was added to the separatory funnel and shaken gently. Then 10mL of ultrapure water was slowly added and shaken gently. After standing for a while, the liquid separated into layers. The lower aqueous phase was filtered off. The upper dark green ether phase was filtered again with 10mL of ultrapure water. The upper dark green ether extract was taken and concentrated to 2mL by nitrogen blowing. 1mL of the ether extract was filtered through a membrane (0.22μm) and transferred to a brown sample bottle. The bottle was sealed with sealing film and then analyzed.

[0113] Chlorophyll and xanthophyll analysis methods: The chromatographic column was a ZORBAX SB-C18 reversed-phase column (4.6 mm × 150 mm, 5.0 μm, Agilent). The injection volume was 10 μL, the detection wavelength was 450 nm, and the column temperature was set to 35℃. Mobile phase A was methanol and ultrapure water in a ratio of 3:1, and mobile phase B was ethyl acetate with a flow rate of 1 mL / min. The linear elution gradient was as follows: 0-10 min, 20%-30% B; 10-30 min, 30%-80% B; 30-35 min, 80% B; 35-40 min, 80%-20% B. Qualitative analysis of pigment components was performed by comparing with external standard, and the concentration (mg / mL) of each component was calculated based on the standard curve. The formula for calculating the chlorophyll content is as follows:

[0114] Pigment content (g / g DW) = (y×L1) / M×100

[0115] In the formula: L1 is the total volume of the extract (mL); M is the sample mass (g); y is the pigment concentration calculated from the standard curve.

[0116] The color change of the pericarp signifies the beginning of ripening and is often used to determine the onset time of fruit ripening. This applies to wild-type (WT) and overexpressing... CiKNOX Ⅰ Phenotypic observations were conducted on tomatoes, and the time required from full bloom to the onset of fruit coloring was statistically analyzed, i.e., the number of days until color breaking. The results showed that... CiKNOX Ⅰ The fruits of the overexpression strains broke color earlier compared to the wild type (WT), as shown in the fruit photos. Figure 2 Wild-type fruits begin to color around 55 days later. CiKNOX Ⅰ The fruits of the overexpression strain began to color around 44 days. The results indicate that overexpression... CiKNOX Ⅰ The genetically modified tomatoes ripen about 11 days earlier than the wild-type (WT).

[0117] Example 6

[0118] This embodiment is designed for the establishment of four-season oranges. CiKNOX Ⅰ Gene overexpression and silencing plants were observed, and the fruit ripening process of the four-season mandarin orange was also monitored, as detailed below:

[0119] 1. Construction of VIGS silencing vector

[0120] Based on the aforementioned construction CiKNOX Ⅰ Using the overexpression vector plasmid as a template, amplification was performed using VIGS recombinant primers. CiKNOX Ⅰ The specific fragment is 500bp, and uses Bam HⅠ enzyme and Sma I. Enzyme ligation into pTRV2 vector yields CiKNOX Ⅰ -pTRV2 vector plasmid. After vector construction, the plasmid was extracted and transformed into Agrobacterium competent cells GV3101.

[0121] The recombinant forward primer is: 5'-GAAGGCCTCCATGGGGATCCGCTATTAAAGCCAAGATCATC-3' (SEQ ID NO.7);

[0122] The recombinant reverse primer is: 5'-GTCTTCGGGACATGCCCGGGGGACAGTTCTTGTTTGAGGCT-3' (SEQ ID NO. 8).

[0123] 2. Instantly transforms into four-season oranges

[0124] The overexpression vector pBI121- CiKNOX Ⅰ Agrobacterium tumefaciens culture containing the empty vector pBI121 was activated on LB (Kanade) solid medium for 2 days; the culture containing the silencing vector pTRV2- CiKNOX Ⅰ Agrobacterium-mediated transient transformation of Citrus aurantium, including empty vectors pTRV1 and pTRV2, was activated on LB (Kana) fixation medium for 2 days, followed by a second activation for 1 day, for subsequent genetic transformation. The detailed steps of Agrobacterium-mediated transient transformation of Citrus aurantium are as follows:

[0125] Select pBI121, pBI121- CiKNOX Ⅰ pTRV1, pTRV2 and pTRV2- CiKNOX Ⅰ Agrobacterium single clones were activated overnight in 2 mL of LB liquid medium containing the appropriate antibiotic at 28°C and 220 rpm with shaking (50 mg / L Kan, 25 mg / L Rif). The activated Agrobacterium culture was then inoculated into fresh LB medium containing antibiotics and incubated overnight at 28°C. The cells were collected by centrifugation at 6000×g, and the cells were resuspended in invasion staining buffer (10 mmol / L MES, 10 mmol / L MgCl2, 20 mg / L LAS, pH 5.6-5.7) and the OD was adjusted. 600 To 0.8-1.0. Mix pTRV1, pTRV2 and pTRV2- in a 1:1 ratio. CiKNOX Ⅰ Bacterial resuspension. After incubation in the dark at 28°C for 2-3 hours, it can be used for infection.

[0126] Cut off part of the syringe needle, leaving about 0.1-0.3 cm, and inject 100 µL of infection solution into each fruit. The injection process should be slow and even, and the extent to which the infection solution reaches the subcutaneous layer of the fruit should be visible to the naked eye. Twenty days after infection, photograph the fruit's ripening phenotype and measure indicators such as soluble solids, titratable acid, xanthophyll, and chlorophyll.

[0127] 3. Identification of genes in transformed fruits of Citrus reticulata using qRT-PCR. CiKNOX Ⅰ expression level

[0128] RNA from successfully injected Citrus aurantiacus was extracted and reverse transcribed to synthesize cDNA (RNA extraction method is the same as in Example 1). The cDNA obtained by reverse transcription was diluted 2 times with ddH2O as a template. CiKNOX Ⅰ The quantitative primers for gene sequencing are:

[0129] CiACTIN-qPCR-F:CCGACCGTATGAGCAAGGAAA (SEQ ID NO.9);

[0130] CiACTIN-qPCR-R:TTCCTGTGGACAATGGATGGA (SEQ ID NO. 10);

[0131] CiKNOX Ⅰ -qPCR-F:AGCCTACGTGGATTGCCAAA (SEQ ID NO.11);

[0132] CiKNOX Ⅰ -qPCR-R: GCCTTGTTAGCTCTTCCCGA (SEQ ID NO. 12).

[0133] Gene identification using qRT-PCR CiKNOX Ⅰ The amount of expression can be used to determine CiKNOX Ⅰ The expression level of the gene in the transformed fruit of the four-season orange.

[0134] 4. Phenotypic observation of transgenic four-season orange fruit

[0135] The results showed that the control group and the empty control group were statistically analyzed on the day of injection and 20 days later. CiKNOX Ⅰ Fruit color changes in gene overexpression lines and silenced lines, results shown (see details). Figure 3 , 5 The overexpression lines showed earlier fruit color change than the wild type, while the silent lines showed slower fruit color change. After analyzing the xanthophyll and chlorophyll content (see details...), further analysis was conducted. Figure 4 , 6 The study found that the silencing lines had significantly lower levels of xanthophyll than the control, while the chlorophyll levels were the opposite; the overexpression lines had significantly higher levels of xanthophyll than the control, while the chlorophyll levels were the opposite.

[0136] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0137] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Lemon CiKNOX Ⅰ The application of genes in regulating fruit ripening is characterized by, The CiKNOX Ⅰ The CDS sequence of the gene is shown in SED ID NO.1; the specific application is as follows: When overexpression CiKNOX Ⅰ In genetics, tomatoes and kumquats ripen earlier than the wild type.

2. The application according to claim 1, characterized in that, The application is further specifically manifested in: when CiKNOX Ⅰ When the gene is suppressed, the fruit of the four-season mandarin orange matures later than that of the wild type.

3. A method for achieving early ripening of tomatoes and kumquats, characterized in that, Includes the following steps: By infecting plants or fruits with engineered bacteria containing overexpression vectors and identifying transgenic positive results, early ripening of tomatoes and citrus fruits can be achieved; the engineered bacteria are those containing lemon... CiKNOX Ⅰ Agrobacterium, a gene recombinant expression vector; CiKNOX Ⅰ The CDS sequence of the gene is shown in SED ID NO.

1.

4. A method for delaying the ripening of four-season orange fruits, characterized in that, Includes the following steps: Will contain silent lemons CiKNOX Ⅰ By infecting plants or fruits with engineered bacteria containing gene vectors and identifying transgenic positive results, delayed ripening of the four-season orange fruit can be achieved; the engineered bacteria are those containing silent lemons. CiKNOX Ⅰ Agrobacterium gene vector; the CiKNOX Ⅰ The CDS sequence of the gene is shown in SED ID NO.1.

Images