Optimized NlovFz2-omega RNA editing system

Abstract

The invention discloses an optimized NlovFz2-omega RNA (Ribonucleic Acid) editing system, the optimal NlovFz2 system enNlovFz2 is obtained by modifying NlovFz2 protein and an omega RNA skeleton, and on the basis of remarkably improving the editing efficiency compared with a parent NlovFz2 system, the NlovFz2 mutant protein and T5 exonuclease are fused to obtain an enNlovFz2-T5 system with higher editing efficiency. The method has important significance and value for promoting wide application of a gene editing technology in the aspects of functional mechanism research and clinical treatment.

Description

Technical Field

[0001] The invention belongs to the technical field of gene editing and relates to the transformation and application of a eukaryotic TnpB-IS200 / IS605 transposon NlovFz2 gene editing system. Background Art

[0002] RNA-guided nuclease systems recognize target sites through complementarity between guide RNA and target DNA sequences, and cut genomic DNA to produce double-strand breaks. This system plays an important role in prokaryotes and eukaryotes, such as adaptive immune responses to foreign genetic elements. In recent years, a new type of RNA-guided nuclease system OMEGA (Obligate Mobile Element Guided Activity) has been reported. The OMEGA system belongs to the IS200 / IS605 transposon family, members of which are widely found in bacteria, archaea and even some eukaryotes. The genes carried by these transposons encode a series of enzymes, including RNA-guided DNA endonucleases. This type of enzyme can recognize and cut DNA through specific RNA molecules, thereby achieving the movement and integration of transposons, including TnpB, IscB, IsrB and IshB nucleases from prokaryotes. Among them, TnpB is the ancestor of the eukaryotic Fanzor protein in the OMEGA family, and is also the ancestor of the Cas12 protein in the CRISPR / Cas family.

[0003] Studies on Fanzor proteins, homologs of TnpB found in eukaryotes, have found that Fanzor also has a RuvC cleavage domain, which is guided by ωRNA to recognize target sites and cleave double-stranded genomic DNA. The identified Fanzor proteins are divided into two categories: (i) Fanzor1, which is related to eukaryotic transposons and exists in various eukaryotic organisms; (ii) Fanzor2, which is related to IS607-like transposons and exists in double-stranded DNA (dsDNA) viral genomes.

[0004] Adeno-associated virus (AAV) is currently a commonly used effective and safe vector for gene therapy, with a maximum packaging capacity of 4.7kb. However, the protein size of traditional nucleases such as SpCas9 and Cas12a is more than 1,000 amino acids, which is not conducive to the packaging and delivery of a single AAV vector for editing systems. They are often split through inteins and packaged separately into two AAV vectors for delivery and function, which greatly reduces their editing effect and limits their application.

[0005] NlovFz2 is derived from the species "Percolozoa Naegleria lovaniensis" and is a type of Fanzor2 protein. NlovFz2 has some advantages of the TnpB and Cas12 families, such as the activity of cutting double-stranded DNA; and the protein is small in size (490 amino acids), and has the potential to be easily packaged in an AAV vector for gene editing therapy. However, studies have shown that the known NlovFz2 protein has extremely low cutting activity in eukaryotic cells. So far, there have been no reports of mutating NlovFz2 to increase its cutting activity. Only the TnpB editing system constructed using the LrTnpB programmed nuclease with low homology to TnpB has been seen (see CN117737034A), but the characteristics of LrTnpB are quite different from those of TnpB.

[0006] In addition, CN118620868A provides an efficient base editing system based on the miniature CRISPR Cas protein IscB, which is obtained by making different point mutations to IscBn (D61A) and / or mutating ωRNA. However, in the absence of fusion modification of the mutated IscBn (D61A), the corresponding system has the limitation of low editing efficiency for some sites of the genome (compared to other sites). Summary of the invention

[0007] The purpose of the present invention is to provide an optimized NlovFz2-ωRNA editing system. By optimizing and transforming the NlovFz2 protein and ωRNA structure in the existing gene editing system, the editing efficiency is improved, thereby expanding and enriching the "mini" gene editing tool box.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions: In the first aspect, an editing system guided by optimized ωRNA for identifying target sites is provided, the editing system comprising a recombinant vector A1 for expressing an RNA-guided nuclease of eukaryotic origin and a mutant ωRNA backbone, the coding sequence of the mutant ωRNA backbone having multiple (multiple) mutations compared with the coding sequence of the ωRNA backbone (referred to as the parent ωRNA backbone) of the parent NlovFz2-ωRNA editing system as shown in SEQ.ID.NO.4, including any one of the ωRNA backbone mutants formed by partially or completely deleting the bases (e.g., U) in the non-pairing region of the stem-loop structure at the 3' end of the parent ωRNA backbone.

[0009] Preferably, the multiple (multiple) mutations specifically include any one of the following situations: (a1) Deletion of the nucleotides containing T at 105 bp, 106 bp, 112 bp and 113 bp in the ω RNA backbone coding sequence of the parent NlovFz2-ω RNA editing system, and the coding sequence of the corresponding ω RNA backbone mutant is shown in SEQ.ID.NO.7; or, (a2) The nucleotides with T bases at 104 bp, 105 bp, 106 bp, 112 bp and 113 bp in the ω RNA backbone coding sequence of the parental NlovFz2-ω RNA editing system are deleted, and the coding sequence of the corresponding ω RNA backbone mutant is shown in SEQ.ID.NO.8.

[0010] Preferably, the multiple (multiple) mutations also include any one of the following situations for combination with other mutations (such as a1, a2 above): (b1) In the ωRNA backbone coding sequence of the parent NlovFz2-ωRNA editing system, the 97th bp nucleotide with a T base is replaced by a C base, and the 120th bp nucleotide with an A base is replaced by a G base, and the coding sequence of the corresponding ωRNA backbone mutant is shown in SEQ.ID.NO.6; or, (b2) in the ω RNA backbone coding sequence of the parent NlovFz2-ω RNA editing system, the nucleotide with the base A at the 103rd bp is replaced by the nucleotide with the base G, and the nucleotide with the base T at the 114th bp is replaced by the nucleotide with the base C, and the coding sequence of the corresponding ω RNA backbone mutant is shown in SEQ.ID.NO.9; or, (b3) The nucleotide with the base A at the 103rd bp and the nucleotide with the base T at the 114th bp in the ω RNA backbone coding sequence of the parental NlovFz2-ω RNA editing system are deleted, and the coding sequence of the corresponding ω RNA backbone mutant is shown in SEQ.ID.NO.10.

[0011] Preferably, the coding sequence of the mutant ωRNA backbone is any one of the following: (i) the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11 or SEQ.ID.NO.12; wherein SEQ.ID.NO.5 is the coding sequence of the ω RNA backbone mutant of the combination of a1 and b1 above; or, (ii) a nucleotide sequence encoding an ω RNA backbone mutant having the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11 or SEQ.ID.NO.12; or (iii) a nucleotide sequence having a sequence similarity of 95% or more to the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11 or SEQ.ID.NO.12.

[0012] Preferably, the nuclease is NlovFz2 protein, and its coding sequence is shown in SEQ.ID.NO.1.

[0013] Preferably, the recombinant vector A1 further comprises a spacer sequence (ie, a Spacer sequence) designed according to the target site and used to form ωRNA with the mutant ωRNA backbone through expression.

[0014] Preferably, the recombinant vector A1 further comprises a first reporter gene sequence for expressing a fluorescent protein (eg, expressing red fluorescence).

[0015] Preferably, the editing system further comprises a recombinant vector B1 for SSA detection of the cleavage activity of a nuclease (such as NlovFz2 protein), wherein the recombinant vector B1 comprises a second reporter gene sequence for expressing a fluorescent protein (such as expressing green fluorescence) after targeted cleavage.

[0016] In a second aspect, an optimized NlovFz2-ωRNA editing system is provided, which includes a recombinant vector A2 for expressing a NlovFz2 mutant protein and the above-mentioned mutant ωRNA backbone, wherein the NlovFz2 mutant protein has mutations at one or more of the following amino acid sites compared to the parent NlovFz2 protein: position 6, position 44, position 64, position 178, position 285, and the amino acid sites are all mutated to arginine.

[0017] Preferably, the coding sequence of the parent NlovFz2 protein is shown in SEQ.ID.NO.1.

[0018] Preferably, the coding sequence of the NlovFz2 mutant protein is any one of the following: (i) the nucleotide sequence shown in SEQ.ID.NO.2, which is the coding sequence of the corresponding NlovFz2 mutant protein obtained by mutating the 285th amino acid (specifically glutamine) of the parent NlovFz2 protein to arginine; or, (ii) A coding sequence of a protein having the same function (e.g. a protein encoding the same amino acid sequence after replacing one or more nucleotides by codon degeneracy) obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ.ID.NO.2. Preferably, the recombinant vector A2 further comprises a first reporter gene sequence for expressing a fluorescent protein (eg, expressing red fluorescence).

[0019] Preferably, the sequence of the recombinant vector A2 is as shown in SEQ.ID.NO.21 (ie, the nucleotide sequence of the enNlovFz2 system plasmid).

[0020] Preferably, the recombinant vector A2 further comprises a spacer sequence (ie, a Spacer sequence) designed according to the target site and used to form ωRNA with the mutant ωRNA backbone through expression.

[0021] Preferably, the editing system further comprises a recombinant vector (such as the above-mentioned recombinant vector B1) for performing SSA detection on the cleavage activity of the NlovFz2 mutant protein.

[0022] In the third aspect, a fusion protein-based NlovFz2-ωRNA efficient editing system is provided, which includes a recombinant vector A3 for expressing the fusion protein and the above-mentioned mutant ωRNA skeleton, wherein the fusion protein includes the above-mentioned NlovFz2 mutant protein and a modified component for enhancing the cutting activity.

[0023] Preferably, the modified component specifically includes T5 exonuclease, TREX1 exonuclease or CasTX nuclease expressed in fusion with the NlovFz2 mutant protein.

[0024] Preferably, the modification component further comprises a linker, such as XTEN.

[0025] Preferably, the coding sequence of the fusion protein is any one of the following: (i) the nucleotide sequence shown in SEQ.ID.NO.3, which is formed by connecting SEQ.ID.NO.2, the XTEN sequence and the coding sequence of T5 exonuclease; or (ii) a coding sequence of a protein having the same function (e.g. a protein encoding the same amino acid sequence after replacing one or more nucleotides using codon degeneracy) obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ.ID.NO.3; or (iii) a nucleotide sequence having a sequence similarity of 95% or more to the nucleotide sequence shown in SEQ.ID.NO.3.

[0026] In a fourth aspect, a eukaryotic-derived RNA-guided nuclease system composition is provided, the composition comprising a first nucleic acid and a second nucleic acid, wherein the first nucleic acid is a vector for expressing the above-mentioned NlovFz2 protein (for example, a protein encoded by SEQ.ID.NO.1), NlovFz2 mutant protein (for example, a protein encoded by SEQ.ID.NO.2) or fusion protein (for example, a protein encoded by SEQ.ID.NO.3), and the second nucleic acid is a vector for expressing the coding sequence and spacer sequence of the above-mentioned mutant ω RNA backbone (for example, an ω RNA backbone mutant encoded by SEQ.ID.NO.5).

[0027] Preferably, the first nucleic acid further comprises a first reporter gene sequence for expressing a fluorescent protein (such as expressing red fluorescence), and the second nucleic acid further comprises a second reporter gene sequence for expressing a fluorescent protein (such as expressing green fluorescence).

[0028] Preferably, the ωRNA expressed by the second nucleic acid (using the coding sequence and the spacer sequence of the mutant ωRNA backbone) can bind to the protein component expressed by the first nucleic acid and guide the protein component to the target site for cutting; wherein the protein component and the ωRNA bind to each other to form an RNP complex.

[0029] Preferably, the recombinant vector A1, recombinant vector A2, recombinant vector A3 and the first nucleic acid further include NLS sequences located upstream and downstream of the coding sequence of the target protein (specifically the above-mentioned NlovFz2 protein, NlovFz2 mutant protein, fusion protein) expressed by them.

[0030] A fifth aspect provides the use of the above-mentioned editing system or composition in gene editing.

[0031] Preferably, the gene editing is gene knockout or gene knockin.

[0032] In a sixth aspect, the use of the editing system or composition in preparing a preparation is provided, wherein the preparation is used for: (i) gene or genome editing; (ii) Target nucleic acid detection and diagnosis; (iii) editing the target sequence in the target locus to modify the genome of the organism; (iv) Gene therapy for diseases; (v) Targeting target genes; (vi) Cutting the target gene.

[0033] The beneficial effects of the present invention are embodied in: Through a large number of experiments and repeated explorations, the present invention systematically engineered the ωRNA structure (ωRNA skeleton) of the NlovFz2-ωRNA editing system and the NlovFz2 protein, and discovered an optimized NlovFz2-ωRNA editing system (such as the enNlovFz2 system) that can significantly improve gene editing efficiency, providing technical support for the efficient delivery of gene editing tools, and having broad application prospects in biological breeding, gene therapy, and promoting functional mechanism research in biomedicine and breeding-related fields. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1a Schematic diagram of the primary structure (amino acid sequence) of the parent NlovFz2 protein.

[0034] Figure 1b Schematic diagram of the structure of the parent ωRNA (including the ωRNA backbone and Spacer); where: S1 represents the stem-loop structure marked in blue in the ωRNA backbone, S2 represents the stem-loop structure marked in green in the ωRNA backbone, S3 represents the stem-loop structure marked in yellow in the ωRNA backbone, and Spacer is marked in red and used for identification B2M Take the gene locus (the specific targeted DNA sequence is "TCACCTGTCTCCAAGCCAGC") as an example.

[0035] Figure 1c The NlovFz2-ωRNA editing system modified for different ωRNA mutants (base substitutions on the ωRNA backbone) is expressed in the cell genome B2M Verification of editing efficiency at the gene locus (WT-ωRNA indicates that the part corresponding to the ωRNA backbone in the parental NlovFz2-ωRNA editing system is not mutated).

[0036] Figure 1d The NlovFz2-ωRNA editing system modified for different ωRNA mutants (base deletion on the ωRNA backbone) is expressed in the cell genome B2M Verification of editing efficiency at the gene locus (WT-ωRNA indicates that the part corresponding to the ωRNA backbone in the parental NlovFz2-ωRNA editing system is not mutated).

[0037] Figure 1e The corresponding NlovFz2-ωRNA editing system was transformed into the cell genome after the combination of better mutations on the ωRNA backbone. B2M Verification of editing efficiency at the gene locus (the data column on the far right is WT-ωRNA).

[0038] Figure 1f The corresponding NlovFz2-ωRNA editing system after modification by other mutation combinations on the ωRNA backbone is expressed in the cell genome. B2MVerification of editing efficiency at a gene locus (compared with the corresponding single mutation).

[0039] Figure 1g This is the plasmid map of an optimized NlovFz2-ω RNA editing system (i.e., enNlovFz2).

[0040] Figure 2a In order to select the key amino acids of NlovFz2 protein according to the functional domain, arginine mutations were performed (the arrows indicate the positions of P6R and Q285R, respectively) and their efficiency in cutting the reporter vector in cells was verified.

[0041] Figure 2b To determine the key amino acid mutation of NlovFz2 protein, the NlovFz2 mutant protein (specifically Q285R mutation) was used to cut the reporter vector. The results of flow cytometry (FACS) were performed. Among them, Q2 represents the cells that were successfully transfected with the NlovFz2 system plasmid and the reporter vector, and the reporter vector was cut, that is, the cells emitted red and green dual fluorescence simultaneously.

[0042] Figure 3 Verification of the efficiency of cleavage of the reporter vector in cells by combinatorial mutations of the efficient mutation sites of the NlovFz2 protein (the data column on the far right is the NlovFz2-ωRNA v3.1 system).

[0043] Figure 4 The combination of the optimal NlovFz2 mutant protein and the optimal ωRNA backbone mutation and the verification of their editing efficiency in cells: * P <0.05;** P <0.01; **** P <0.001.

[0044] Figure 5 The optimal NlovFz2-ω RNA editing system (i.e., enNlovFz2) was combined with T5 exonuclease, TREX1 exonuclease, and CasTX nuclease (fused to NlovFz2 mutant proteins, respectively) and their editing efficiency in cells was verified.

[0045] Figure 6a The experimental process involves transfection of the enNlovFz2-ωRNA-mCherry ternary co-expression plasmid (Plasmid) where the editing system (taking enNlovFz2 as an example), single fluorescence flow cytometry sorting, cell genomic DNA extraction and target site deep sequencing; between the two NLS sequences is the coding sequence of the NlovFz2 mutant protein (mutated to Q285R) used by enNlovFz2.

[0046] Figure 6b To verify and compare the editing efficiency of the parental NlovFz2-ω RNA editing system (i.e., NlovFz2-WT or WT-NlovFz2), enNlovFz2, the optimal NlovFz2-ω RNA editing system with fusion exonuclease (i.e., enNlovFz2-T5), the enCnCas12f editing system, and the enRhCas12f editing system at different endogenous sites (different genes and targeted DNA sequences) in HEK293T cells.

[0047] Figure 6c Schematic diagram of the structure of the endogenous site (specifically the targeted DNA sequence, abbreviated as sg) selected in the experiment.

[0048] Figure 6d Statistical results of the editing efficiency of WT-NlovFz2, enNlovFz2, enNlovFz2-T5, enCnCas12f and enRhCas12f at each endogenous site in the experiment. DETAILED DESCRIPTION

[0049] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The embodiments are only used to explain the present invention and are not used to limit the protection scope of the present invention.

[0050] Example 1 Modification and Optimization of NlovFz2-ω RNA Editing System 1. Design of NlovFz2 mutant protein In the present invention, amino acid residues are represented by three letters or single letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R); if the "x" position (starting from the N-terminus) in the reference sequence of the protein is mutated, the mutation type at that position is indicated as "parent protein amino acid residue 'x' mutant protein amino acid residue", for example, P6R means that P at position 6 is changed to R.

[0051] For the known NlovFz2 protein, by dividing its domain functions, some amino acid sites that may be related to protein functions were selected in each domain for arginine mutation, where the amino acid sequence of the parent NlovFz2 protein is as follows: Figure 1a The NlovFz2 protein reference sequence is shown. Specifically, when the corresponding amino acid site is mutated, the coding sequence of the corresponding mutant protein is determined according to the coding sequence of the parent NlovFz2 protein.

[0052] 2. Design of mutant ωRNA-scaffold For the ωRNA in the known NlovFz2-ωRNA editing system (whose 5' end is the ωRNA backbone and the 3' end is the Spacer), the regions are divided according to the stem-loop structure in its ωRNA backbone (the ωRNA backbone has a total of three stem-loop structures, which are called stem-loop S1, stem-loop S2 and stem-loop S3 in the order from 5' to 3', see Figure 1b), and perform deletion, insertion, and base substitution transformations in different regions.For example, S3Loop-Δ4U, i.e., the mutation site of the ωRNA backbone in the parental NlovFz2-ωRNA editing system is the 4 bases UUUU in the top “Loop” of the stem-loop S3 (corresponding to the nucleotides T at the 105th, 106th, 112th, and 113th bp of the ωRNA backbone coding sequence from the 5th ` in the parental NlovFz2-ωRNA editing system), and the mutation type is deletion; S3Loop-Δ5U, i.e., the mutation site of the ωRNA backbone in the parental NlovFz2-ωRNA editing system is the 5 bases UUUUU in the top “Loop” of the stem-loop S3 (corresponding to the 104th, 105th, 106th, 112th, and 113th bp of the ωRNA backbone coding sequence from the 5th ` in the parental NlovFz2-ωRNA editing system). UA97CG is located at stem-loop S3, that is, the UA base pair at the 97th position from 5' to CG base pair relative to the ωRNA backbone in the parental NlovFz2-ωRNA editing system (when the 97th nucleotide from 5' of the ωRNA backbone coding sequence in the parental NlovFz2-ωRNA editing system is replaced by base T to base C, because the stem-loop structure inside the ωRNA backbone has complementary base pairs, it also causes the 120th nucleotide from 5' to be replaced by base C. bp nucleotide is replaced by base A to base G); AU103CG is located in stem-loop S3, i.e., the AU base pair at the 103rd position from 5' to CG relative to the ω RNA backbone in the parental NlovFz2-ω RNA editing system is mutated to a CG base pair; AU103GC, i.e., the AU base pair at the 103rd position from 5' to GC relative to the ω RNA backbone in the parental NlovFz2-ω RNA editing system; U115C (or GU102GC) is located in stem-loop S3, i.e., the base U at the 115th position from 5' to C relative to the ω RNA backbone in the parental NlovFz2-ω RNA editing system is replaced by a C base; S3-Δ2bp, i.e., the mutation site of the ω RNA backbone in the parental NlovFz2-ω RNA editing system is the two base pairs from the outside to the inside of stem-loop S3 (corresponding to the nucleotide with a G base at the 102nd bp from 5' to the ω RNA backbone coding sequence in the parental NlovFz2-ω RNA editing system, and the nucleotide with a G base at the 103rd bp from 5' to the ω RNA backbone coding sequence in the parental NlovFz2-ω RNA editing system). bp with an A base, 114 bp with a T base and 115 bp with a T base) and the mutation type is deletion; S3-Δ1bp, that is, the mutation site of the ω RNA backbone in the parental NlovFz2-ω RNA editing system is 1 base pair from the outside to the inside of the stem-loop S3 (corresponding to the 103rd bp with an A base and the 114th bp with a T base in the ω RNA backbone coding sequence from 5` in the parental NlovFz2-ω RNA editing system), and the mutation type is deletion. 3. Vector construction strategies and examples The recombinant vectors expressing NlovFz2 mutant protein and / or ωRNA mutant (specific mutation in the ωRNA backbone) all use pEASY ® -T1 Cloning Kit (Trans). The parental NlovFz2 system eukaryotic expression vector was used as a template, different primers were designed, and the required fragments were amplified by standard PCR. The method designed for amplification was to take the mutation site as the center, and to find single restriction sites on both sides of the mutation site (located at the 5' end and 3' end of the coding sequence, respectively). After restriction digestion, the vector skeleton was obtained, and then the DNA sequence of the NlovFz2 protein or ωRNA skeleton (i.e., the coding sequence) was divided into two parts. The two DNA sequences extended from the front and rear single restriction sites to the mutation site of the NlovFz2 protein or ωRNA skeleton, and two pairs of primers were used to amplify the two DNA sequences, and the sequences to be mutated were introduced into the primers at the same time; the combination of different mutation sites in the mutant was carried out by PCR using the NlovFz2 system eukaryotic expression vector containing a single mutant coding sequence of the NlovFz2 protein (or ωRNA skeleton) as a template, and another or more mutations were introduced through one or more amplifications according to the above amplification method. Among them, the parent NlovFz2 system eukaryotic expression vector is obtained by the following method: using the Cas12i editing system plasmid (from the literature An engineered xCas12i with high activity, high specificity, andbroad PAM range; in this plasmid, the CAG promoter starts the expression of Cas12i protein, the U6 promoter starts the expression of sgRNA, and the CMV promoter starts the expression of fluorescent protein) and replacing the nucleotide sequence encoding the Cas12i protein (directly connected to it upstream and downstream is the NLS sequence: that is, the nuclear localization signal sequence SV40 NLS at the 5' end and the nuclear localization signal sequence nucleoplasmin NLS at the 3' end) and the nucleotide sequence encoding the sgRNA backbone by synthesized nucleotide sequences encoding the parent NlovFz2 protein and the nucleotide sequence encoding the parent ω RNA backbone, respectively, to obtain the parent NlovFz2-ω RNA editing system plasmid.

[0053] The parental NlovFz2-ωRNA editing system plasmid was used as a template to construct a recombinant vector expressing NlovFz2 mutant protein and / or ωRNA mutant (specific mutation in the ωRNA backbone part). The construction process is illustrated as follows.

[0054] To construct Figure 1gTaking the plasmid enNlovFz2 shown in the figure as an example, the parental NlovFz2-ω RNA editing system plasmid was firstly digested with BshTI and SacⅠ restriction endonucleases (Thermo) to obtain a linearized vector backbone. The parental NlovFz2-ω RNA editing system plasmid was used as a template, and PCR was performed using primers F1 (5`-CCTGAAATCACTTTTTTTCAGGTTGGA-3`, i.e., SEQ.ID.NO.13) and primer R1 (5`-CCAGAGTGCCGAGGGGCCTGATTTTCTCCCC-3`, i.e., SEQ.ID.NO.14), primer F2 (5`-AGGCCCCTCGGCACTCTGGACAGGTGGTGG-3`, i.e., SEQ.ID.NO.15) and primer R2 (5`-AGTCGAGGCTGATCAGCG-3`, i.e., SEQ.ID.NO.16). pEASY ® -T1 CloningKit and construct a recombinant vector by seamless cloning to introduce the Q285R mutation of NlovFz2 protein; then, the NlovFz2-ω RNA editing system plasmid containing Q285R obtained in the previous step was digested with SacⅠ and NheⅠ restriction endonucleases (Thermo) to obtain a linearized backbone vector. The NlovFz2-ω RNA editing system plasmid containing Q285R obtained in the previous step was used as a template and primer F3 (5`-GCAAAGAAGAAAAAGTAAGAATTCCTAG-3`, i.e., SEQ.ID.NO.17) was used to generate a linearized backbone vector. ) and primer R3 (5`-TTCGAACAACAAACATCGAACGAAGTGCTGATCTTGCAAGCAAAC-3`, i.e., SEQ.ID.NO.18), primer F4 (5`-TCGTTCGATGTTTGTTGTTCGAATTGTTGATTTAAATAAAGGCGTGAGACC-3`, i.e., SEQ.ID.NO.19) and primer R4 (5`-TCGCCCTTGCTCACCATG-3`, i.e., SEQ.ID.NO.20) were used for PCR, and pEASY ®-T1 Cloning Kit constructs recombinant vectors through seamless cloning to obtain enNlovFz2 system plasmid (i.e., NlovFz2-ωRNA editing system plasmid containing Q285R+S3Loop-Δ4U+UA97CG). In the enNlovFz2 system plasmid, the NlovFz2 protein (specifically, the NlovFz2 protein with the Q285R mutation) expression cassette contains a CAG promoter (i.e., CMV enhancer + chicken β-actin promoter) and a transcription termination signal (specifically, a bGH poly(A) sequence); the ωRNA expression cassette uses the U6 promoter, and the downstream of the promoter is the ωRNA skeleton (i.e., NlovFz2 ωRNA scaffold, also known as ωRNA-scaffold) with the S3Loop-Δ4U and UA97CG mutations introduced, and the downstream of the ωRNA skeleton is a restriction site (specifically, Eco31I) for inserting an intervening sequence (i.e., a Spacer sequence); the fluorescent protein (specifically, mCherry) expression cassette uses the CMV promoter.

[0055] Example 2 Verification of editing efficiency in cells after modification of ω RNA backbone in NlovFz2 system Targeting people B2M Endogenous gene selection target site B2M -site: 5`- ccg tcacctgtctccaagccagc -3` (i.e., SEQ.ID.NO.22), where the italic part is the TAM sequence and the underlined area is the target DNA sequence of the target site. B2M -site paired primers were annealed and connected with the NlovFz2 system eukaryotic expression vector fragment that was linearized by Eco31I restriction enzyme and was capable of expressing the modified target ωRNA structure (i.e., mutant ωRNA backbone) to obtain the targeted B2M NlovFz2 system expression vector at the gene locus.

[0056] Hieff Trans® PEI transfection reagent (YEASEN) was used to transfect the target B2M The NlovFz2 system expression vector of the gene locus was transfected into 3×10 5HEK293T cells. After transfection, the parental NlovFz2 system eukaryotic expression vector (i.e., parental NlovFz2-ωRNA editing system plasmid) was used as a positive control, and untransfected cells were used as a negative control (NC). 60 to 72 hours after transfection, red fluorescent positive cells were flow-sorted for genome extraction. The method for extracting genomic DNA from cell samples was as follows: cells were reselected using 1× Lysis Buffer with Proteinase K added, lysed at 55°C overnight, and then treated at 95°C for 10 minutes to inactivate Proteinase K to obtain genomic DNA from positive cells.

[0057] Phanta Max Super-Fidelity DNA Polymerase (Vazyme) and high-throughput sequencing primers with barcodes were used to amplify the target fragment containing the editing site on the extracted DNA. After library construction, the amplicon was sent for sequencing. The editing efficiency obtained through data analysis was as follows: Figure 1c , Figure 1d As shown. The optimal modification method for different regions of the ωRNA backbone v1 version was selected, that is, 8 ωRNA backbone mutants (referred to as mutation types) that can significantly improve the editing efficiency relative to the parental NlovFz2-ωRNA editing system were obtained: S3Loop-Δ4U, S3Loop-Δ5U, AU103CG, AU103GC, GU102GC, UA97CG, S3-Δ2bp, S3-Δ1bp (S3-Δ9bp was not selected because it deleted too many bases and S3Loop-Δ2U was included in S3Loop-Δ4U and S3Loop-Δ5U).

[0058] The coding sequence of the ωRNA backbone in the above-mentioned parental NlovFz2-ωRNA editing system is the nucleotide sequence shown below (i.e., SEQ.ID.NO.4): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGATTTGTTTGTTTTGTTCAAATTGTTGATTTAAATAAAGGCG-3` The coding sequence corresponding to the above-mentioned ωRNA backbone mutant UA97CG is the nucleotide sequence shown below (i.e., SEQ.ID.NO.6): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTCGTTCGATTTGTTTGTTTTGTTCGAATTGTTGATTTAAATAAAGGCG-3` The coding sequence of the above-mentioned ωRNA backbone mutant S3Loop-Δ4U is the nucleotide sequence shown below (i.e., SEQ.ID.NO.7): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGATGTTTGTTGTTCAAATTGTTGATTTAAATAAAGGCG-3` The coding sequence of the above-mentioned ωRNA backbone mutant S3Loop-Δ5U is the nucleotide sequence shown below (i.e., SEQ.ID.NO.8): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGAGTTTGTTGTTCAAATTGTTGATTTAAATAAAGGCG-3` The coding sequence of the above-mentioned ω RNA backbone mutant AU103GC is the nucleotide sequence shown below (i.e., SEQ.ID.NO.9): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGGTTTGTTTGTTCTTGTTCAAATTGTTGATTTAAATAAAGGCG-3` The coding sequence of the above-mentioned ωRNA backbone mutant S3-Δ1bp is the nucleotide sequence shown below (i.e., SEQ.ID.NO.10): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGTTTGTTTGTTTGTTCAAATTGTTGATTTAAATAAAGGCG-3` Example 3 Verification of editing efficiency in cells after iterative modification of the ω RNA backbone in the NlovFz2 system Based on the above-mentioned ωRNA backbone mutation sites, different mutation sites were combined and iteratively mutated, and then the activity of the NlovFz2-ωRNA iterative mutants (i.e., the improvement in editing efficiency relative to the parental NlovFz2-ωRNA editing system) was verified.

[0059] Will target B2M Gene locus (i.e. the target locus mentioned above) B2M -site) and the corresponding NlovFz2 system expression vector was transfected into 3×10 5 In HEK293T cells. After transfection, the parental NlovFz2 system expression vector (i.e., the parental NlovFz2-ωRNA editing system plasmid) was used as a positive control, and the untransfected cells were used as a negative control. 60h to 72h after transfection, red fluorescence flow sorting was performed to obtain positive cells for genome extraction and high-throughput sequencing. The editing efficiency results obtained by high-throughput sequencing data analysis are shown in Figure 1e , Figure 1f shown.

[0060] The three most efficient ωRNA backbone mutation site combinations among the editing results of the NlovFz2 system with different ωRNA structures obtained by high-throughput sequencing data analysis were selected for subsequent experiments: ωRNA v3.1 (i.e., the ωRNA backbone mutant of the S3Loop-Δ4U+UA97CG combination), ωRNA v3.2 (i.e., the ωRNA backbone mutant of the S3Loop-Δ5U+AU103GC combination), and ωRNA v3.3 (i.e., the ωRNA backbone mutant of the S3Loop-Δ4U+S3-Δ1bp combination) (see for details). Figure 1e ).

[0061] The coding sequence of the above-mentioned ωRNA backbone mutant ωRNA v3.1 is the nucleotide sequence shown below (i.e., SEQ.ID.NO.5): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTCGTTCGATGTTTGTTGTTCGAATTGTTGATTTAAATAAAGGCG-3` The coding sequence of the above-mentioned ωRNA backbone mutant ωRNA v3.2 is the nucleotide sequence shown below (i.e., SEQ.ID.NO.11): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGGGTTTGCTGTTCAAATTGTTGATTTAAATAAAGGCG-3` The coding sequence of the above-mentioned ωRNA backbone mutant ωRNA v3.3 is the nucleotide sequence shown below (i.e., SEQ.ID.NO.12): 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGTGTTTGTGTTCAAATTGTTGATTTAAATAAAGGCG-3` Example 4 Verification of the editing activity of NlovFz2 mutant protein After verifying the editing efficiency of the corresponding NlovFz2 system using the modified ωRNA backbone in cells, the single-strand annealing (SSA) test was used to verify the activity of the NlovFz2 mutant protein. Specifically, different NlovFz2 system eukaryotic expression vectors with expected amino acid mutations were designed, and they were all able to target a fluorescent reporter vector, which carried a fluorescent protein EGFP coding sequence that would only be expressed if targeted and cut. When the NlovFz2 system eukaryotic expression vector entered the cell, the fluorescent protein mCherry coding sequence it carried was expressed and emitted red light. Only when the fluorescent reporter vector was successfully cut by the NlovFz2 mutant protein expressed by the NlovFz2 system eukaryotic expression vector, the fluorescent reporter vector could be used to achieve the expression of EGFP and emit green fluorescence.

[0062] The construction principle of the above fluorescent reporter vector is described as follows (reference: Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and singleguided RNA): the green fluorescent protein EGFP coding sequence is divided into two segments, the last 200bp of the former segment and the first 200bp of the latter segment are homologous sequences, the two segments are cloned separately, and a stop codon and a ω RNA target sequence are inserted between the two (for example, the above B2M -site). When the ωRNA-specific detection vector (i.e., the fluorescent reporter vector) is transfected into cells alone, no green fluorescence is observed. However, if the gene editing plasmid (e.g., the parental NlovFz2 system plasmid or the modified NlovFz2 system plasmid) and the corresponding fluorescent reporter vector are co-transfected into cells, the RNP complex will be recruited to the ωRNA target sequence between the two fluorescent protein coding sequences, thereby breaking the double-stranded DNA by cutting, and then the former sequence of the fluorescent protein EGFP and the homologous region of the latter sequence undergo homologous recombination. After homologous recombination, a complete fluorescent protein EGFP coding sequence will be generated, and green fluorescence will be expressed. Finally, the effect of different transformation strategies of the NlovFz2 protein on the editing efficiency of the gene editing system can be evaluated by analyzing the proportion of green fluorescent cells. The complex of NlovFz2-ω RNA editing system expression vector carrying the coding sequence of NlovFz2 mutant protein and fluorescent reporter vector was transfected at a ratio of 1:1 (1 μg:1 μg) to 3×10 5 After transfection in HEK293T cells, the parental NlovFz2 system was used as a positive control, and the untransfected cells were used as a negative control. After 60 hours of transfection, flow cytometry was performed to count the proportion of green-emitting cells in red-emitting cells. The experimental results showed no obvious green fluorescence, which may be due to the low editing activity of the parental NlovFz2 system. Therefore, the ωRNA v3.1 in Example 3 was used to replace the ωRNA backbone in the NlovFz2-ωRNA editing system with the NlovFz2 mutant protein coding sequence. Flow cytometry analysis found that the green fluorescence was significantly improved (see Figure 2b The cleavage efficiency of different NlovFz2 mutant proteins on the fluorescent reporter vector obtained based on ωRNA v3.1 is shown in the figure. Figure 2aAs shown, five NlovFz2 mutant proteins (referred to by mutation type) with significantly improved cleavage efficiency compared to the parent NlovFz2 protein were identified: P6R, Q44R, E64R, T178R, and Q285R, that is, relative to the amino acid sequence of the parent NlovFz2 protein in Example 1, the 6th, 44th, 64th, 178th, and 285th positions from the N-terminus were mutated to arginine, respectively. Example 5 Verification of editing activity of NlovFz2 mutant protein (combined mutation) The above amino acid mutation sites: P6R, Q44R, E64R, T178R, Q285R were used to perform iterative mutations respectively, that is, to verify the cleavage efficiency of NlovFz2 protein with combined mutations at the following amino acid sites: (1) The amino acid mutation positions R are at the 6th position from the N-terminus (specifically, by changing the bases C, C, T at the 16th, 17th, and 18th bp from the 5' end of the coding sequence of the parent NlovFz2 protein to bases C, G, and G) and the 44th position (specifically, by changing the bases C, A, and G at the 130th, 131st, and 132nd bp from the 5' end of the coding sequence of the parent NlovFz2 protein to bases C, G, and G); (2) The amino acid mutation positions R are at the 6th and 64th positions from the N-terminus (specifically, by changing the bases G, A, and G at the 190th, 191st, and 192nd bp from the 5' end of the coding sequence of the parent NlovFz2 protein to bases C, G, and G); (3) The amino acid mutation positions R are at the 6th and 178th positions from the N-terminus (specifically, by changing the bases G, A, and G at the 532nd, 533rd, and 534th bp from the 5' end of the coding sequence of the parent NlovFz2 protein bp, 534 bp to C, G, G) amino acid mutation position R; (4) from the N-terminus at the 6th and 285th positions (specifically, by changing the coding sequence of the parent NlovFz2 protein from 5' to 853 bp, 854 bp, 855 bp base C, A, G becomes base C, G, G) amino acid mutation position R; (5) amino acid mutation position R at the 44th and 64th amino acid from the N-terminus; (6) amino acid mutation position R at the 44th and 178th amino acid from the N-terminus; (7) amino acid mutation position R at the 44th and 285th amino acid from the N-terminus; (8) amino acid mutation position R at the 64th and 178th amino acid from the N-terminus; (9) amino acid mutation position R at the 64th and 285th amino acid from the N-terminus; (10) amino acid mutation position R at the 178th and 285th amino acid from the N-terminus; (11) amino acid mutation position R at the 6th, 44th and 64th amino acid from the N-terminus; (12) amino acid mutation position R at the 6th, 44th and 178th amino acid from the N-terminus; (13) amino acid mutation position R at the 6th, 44th and 285th amino acid from the N-terminus; (14) From the N-terminus, the 44th, 64th, and 178th amino acid mutation positions are R; (15) From the N-terminus, the 44th, 64th, and 285th amino acid mutation positions are R; (16) From the N-terminus, the 64th, 178th, and 285th amino acid mutation positions are R; (17) From the N-terminus, the 6th, 64th, and 178th amino acid mutation positions are R; (18) From the N-terminus, the 6th, 64th, and 285th amino acid mutation positions are R; (19) From the N-terminus, the (20) From the N-terminus, the 44th, 178th, and 285th amino acid mutation positions are R; (21) From the N-terminus, the 6th, 44th, 64th, and 178th amino acid mutation positions are R; (22) From the N-terminus, the 6th, 44th, 64th, and 285th amino acid mutation positions are R; (23) From the N-terminus, the 6th, 44th, 178th, and 285th amino acid mutation positions are R;(24) The amino acid mutation positions 6, 64, 178, and 285 from the N-terminus are R; (25) The amino acid mutation positions 44, 64, 178, and 285 from the N-terminus are R; (26) The amino acid mutation positions 6, 44, 64, 178, and 285 from the N-terminus are R. ;

[0063] The coding sequence of the above parent NlovFz2 protein is as follows (i.e., SEQ.ID.NO.1): When verifying the cleavage activity of the combined mutation of NlovFz2 protein, the complex of the NlovFz2 system expression vector with the mutant protein coding sequence and the fluorescent reporter vector was transfected at a ratio of 1:1 (1 μg: 1 μg) to 3×10 5 After transfection in HEK293T cells, the NlovFz2-ωRNA v3.1 system (i.e., the system after replacing the ωRNA backbone in the parent NlovFz2 system with ωRNA v3.1) was used as a positive control, and untransfected cells were used as a negative control. 60h to 72h after transfection, flow cytometry was performed to count the proportion of green cells among red cells. The cleavage efficiency of the fluorescent reporter vector by different combinations of NlovFz2 protein mutations was obtained as follows: Figure 3 shown.

[0064] Figure 3 The results showed that for the same target site (specifically the above B2M -site), the efficiency decreased after the combination of protein mutations. Therefore, two optimal NlovFz2 mutant proteins were used: the NlovFz2 mutant protein with only amino acid mutation P6R and the NlovFz2 mutant protein with only amino acid mutation Q285R, for subsequent related experiments. The coding sequence of the latter NlovFz2 mutant protein is shown below (i.e., SEQ.ID.NO.2): In addition, based on the above NlovFz2 mutant protein with only the Q285R amino acid mutation, the mutant protein was fused with T5 exonuclease and the like through linker XTEN, wherein the coding sequence of the corresponding fusion protein fused with T5 exonuclease at the C-terminus of the NlovFz2 protein is as follows (i.e., SEQ.ID.NO.3): TCCGGAGGATCTAGCGGAGGCTCCTCTGGCAGCGAGACACCA GGAACAAGCGAGTCAGCAACACCAGAGAGCAGTGGCGGCAGCAGCGGCGGCAGC ATGAGCAAGTCCTGGGGCAAGT TCATCGAGGAAGAGGAAGCTGAAATGGCCTCTAGACGCAACCTGATGATCGTGGATGGCACCAACCTCGGCTTCAG GTTCAAGCACAACAACTCCAAGAAACCTTTCGCCAGCAGCTACGTGTCTACCATCCAGAGCCTGGCCAAGAGCTAT AGCGCCAGAACCACAATCGTGCTCGGCGATAAGGGCAAAAGCGTGTTCAGACTGGAACATCTGCCTGAGTACAAGG GCAACCGGGACGAGAAGTACGCCCAGCGGACCGAGGAAGAGAAGGCTCTGGATGAGCAGTTTTTCGAGTACCTGAA AGACGCCTTCGAGCTTTGTAAAACAACATTTCCTACATTCACAATCAGAGGAGTGGAAGCCGATGATATGGCCGCT TATATCGTGAAGCTGATCGGCCACCTGTACGACCACGTGTGGCTGATCTCTACAGATGGTGACTGGGACACCCTGC TGACCGACAAGGTGTCCAGATTCAGCTTCACCACCAGAAGAGAGTACCACCTGAGAGATATGTACGAGCACCACAA TGTGGACGACGTGGAGCAATTTATCAGCCTGAAGGCCATTATGGGCGACCTGGGCGACAACATCCGGGGCGTTGAA GGCATCGGCGCTAAAAGAGGCTACAACATCATCCGGGAGTTCGGCAATGTGCTGGACATCATCGACCAGCTGCCCC TGCCAGGCAAGCAGAAATACATCCAGAACCTGAACGCCAGCGAGGAGCTGCTGTTCAGAAATCTGATTCTGGTGGA CCTGCCTACCTACTGCGTGGATGCCATCGCCGCCGTGGGCCAGGACGTGCTGGACAAGTTTACCAAGGACATCCTG GAAATCGCCGAGCAG -3` In the above nucleotide sequence (i.e., SEQ.ID.NO.3), the coding sequence of T5 exonuclease is indicated in italics and the linker sequence is underlined.

[0065] Example 6 Obtaining the Optimal NlovFz2-ω RNA Editing System After obtaining three optimal ωRNA backbone mutants: ωRNA v3.1, ωRNA v3.2, and ωRNA v3.3 through Example 3, and obtaining two optimal NlovFz2 mutant proteins (referred to by mutation type): P6R and Q285R through Examples 4 and 5, they were combined to obtain the following 6 different combinations of NlovFz2-ωRNA systems: P6R+ωRNA v3.1, P6R+ωRNA v3.2, P6R+ωRNA v3.3, Q285R+ωRNA v3.1, Q285R+ωRNA v3.2, and Q285R+ωRNA v3.3.

[0066] Targeting people B2M Endogenous gene target site (i.e., the above B2M -site) to construct the corresponding expression vector, and the editing efficiency was verified according to the methods in Examples 2 and 3, that is, cell transfection, flow sorting, cell genome extraction, and high-throughput library construction and sequencing. Figure 4 As shown, the recombinant vector expressing the NlovFz2 mutant protein (specifically the mutation Q285R) and the ωRNA backbone mutant (specifically ωRNA v3.1) with the highest editing efficiency was selected as the final optimized NlovFz2-ωRNA system, named enNlovFz2, and the sequence of the corresponding vector (i.e., enNlovFz2 system plasmid) is as follows (i.e., SEQ.ID.NO.21, and the construction method is shown in Example 1): Example 7 Fusion of NlovFz2-ωRNA system with different exonucleases and verification of editing efficiency Exonucleases or other nucleases added to the CRISPR / Cas system to improve the editing efficiency of Cas proteins were selected and fused with the modified NlovFz2 mutant protein to verify the optimization scheme to further improve the editing efficiency of the system. Specifically, two exonucleases were selected: T5 exonuclease, TREX1 exonuclease, and another nuclease: CasTX. The coding sequences of T5 exonuclease, TREX1 exonuclease, and CasTX nuclease were constructed in the protein expression cassette of the enNlovFz2 system expression vector, and were connected using linker XTEN (connected to the N-terminus and C-terminus of the corresponding NlovFz2 mutant protein, respectively), and a total of 6 expression vectors with different fusion protein coding sequences were constructed: T5-enNlovFz2, enNlovFz2-T5, TREX1-enNlovFz2, enNlovFz2-TREX1, CasTX-enNlovFz2, enNlovFz2-CasTX, and the parent NlovFz2 protein and the fusion proteins of the protein with T5 exonuclease, TREX1 exonuclease, and CasTX nuclease were set as controls. According to the methods in Examples 4 and 5, in human B2M Endogenous gene loci (i.e., the above B2M -site) to verify the editing efficiency, the results are as follows Figure 5 As shown, it can be seen that fusing T5 exonuclease, TREX1 exonuclease or CasTX nuclease to the C-terminus of the NlovFz2 mutant protein in enNlovFz2 can enable the optimized system to obtain higher editing efficiency, and ultimately obtain the most efficient enNlovFz2-T5 editing system (i.e., the system obtained by fusing T5 exonuclease to the C-terminus of the NlovFz2 mutant protein in enNlovFz2).

[0067] Example 8 Verification of the editing activity of enNlovFz2 at different human endogenous sites The enNlovFz2 and enNlovFz2-T5 editing systems were used to verify the editing efficiency at different endogenous sites, and compared with the enCnCas12f and enRhCas12f editing systems with the same TAM sequence and size and similar higher-order structures (references: Molecular basis and engineering of miniature Cas12f with C-rich PAM specificity; Engineered CRISPR-OsCas12f1 and RhCas12f1 with robust activitiesand expanded target range for genome editing) to verify the superiority of the enNlovFz2 (and enNlovFz2-T5) editing system.

[0068] Specifically, we selected B2M -site-1, CXCR4 -site-1, CA2 -site-1, KRAS -site-1, DYRK1A -site-1, HPRT1 -site-1, DMD -site-1, DMD -site-2, DMD -site-3, DMD -site-4, DMD -site-5, TTR -site-1, TTR -site-2, TTR -site-3, TTR -site-4, TTR -site-5, PCSK9 -site-1, PCSK9 -site-2, PCSK9 -site-3, PCSK9 -site-4, PCSK9 -site-5, VEGFA -site-1, VEGFA -site-2, VEGFA -site-3, VEGFA -site-4, VEGFA -site-5 has a total of 26 endogenous sites, among which B2M -site-1, CXCR4 -site-1, VEGFA -site-1, CA2 -site-1,KRAS -site-1, DYRK1A -site-1, HPRT1 -site-1, DMD -site-1 is a high-efficiency editing site found in previous studies, and the remaining sites were designed later (see Figure 6c ). The editing activities of WT-NlovFz2, enNlovFz2, enNlovFz2-T5, enCnCas12f and enRhCas12f were tested and compared at the above 26 endogenous sites.

[0069] Specifically, the editing efficiency was verified according to the methods in Examples 2 and 3, i.e., cell transfection, flow sorting, cell genome extraction, and high-throughput library construction and sequencing ( Figure 6a ). The results are as follows Figure 6b , Figure 6d As shown, the editing efficiency of the enNlovFz2 system at human endogenous gene sites is significantly improved compared with the parental NlovFz2 system, and is higher than that of the enCnCas12f and enRhCas12f systems. The addition of T5 nuclease can further improve the editing efficiency of the enNlovFz2 system.

[0070] In summary, the optimized NlovFz2-ωRNA editing system such as enNlovFz2 proposed in the present invention has a wide range of application prospects due to its following characteristics, in addition to significantly improving the editing efficiency compared to the parental NlovFz2 system: (1) The optimized NlovFz2-ω RNA editing system (e.g., enNlovFz2) of the present invention can efficiently perform gene knockout and gene knockin at multiple endogenous sites in the genome of human and mammalian cells.

[0071] (2) The optimized NlovFz2-ωRNA editing system (e.g., enNlovFz2) of the present invention is small in size and convenient for the delivery of a single AAV, providing ideas for solving the limitation of packaging volume, and can expand the mini-type efficient gene editing toolbox and increase the application possibilities in the field of gene therapy.

[0072] (3) The optimized NlovFz2-ω RNA editing system (e.g., enNlovFz2) of the present invention has higher editing efficiency than enCnCas12f and enRhCas12f, which have similar structures and sizes and the same TAM sequences.

[0073] (4) The optimized NlovFz2-ω RNA editing system (e.g., enNlovFz2) of the present invention can also be used to construct animal models of gene mutations, and the constructed related animal models can be used for functional mechanism research and new drug development in the biomedical field.

Claims

1. An editing system guided by optimized ωRNA to identify target sites, characterized in that: The editing system includes a recombinant vector for expressing a nuclease guided by RNA of eukaryotic origin and a mutant ω RNA backbone, wherein the mutant ω RNA backbone includes any one of the following mutation types that causes the parental ω RNA backbone to form an ω RNA backbone mutant: deletion of part or all of the bases in the non-pairing region of the stem-loop structure at the 3' end of the parental ω RNA backbone.

2. According to claim 1, an editing system guided by optimized ω RNA to identify target sites is characterized in that: The mutation type is any one of the following: (a1) Deletion of the nucleotides containing T at 105 bp, 106 bp, 112 bp and 113 bp in the coding sequence of the parental ω RNA backbone; or, (a2) Deletion of the nucleotides containing T at 104 bp, 105 bp, 106 bp, 112 bp and 113 bp in the coding sequence of the parental ω RNA backbone.

3. An editing system for identifying target sites guided by optimized ω RNA according to claim 1 or 2, characterized in that: The mutation type is any one of the following cases for mutation combination: (b1) in the coding sequence of the parental ω RNA backbone, the 97th bp nucleotide with a T base is replaced by a C base, and the 120th bp nucleotide with an A base is replaced by a G base; or, (b2) in the coding sequence of the parental ω RNA backbone, the nucleotide with the base A at 103 bp is replaced by the nucleotide with the base G, and the nucleotide with the base T at 114 bp is replaced by the nucleotide with the base C; or, (b3) Deletion of the nucleotide with the base A at the 103rd bp and the nucleotide with the base T at the 114th bp in the coding sequence of the parental ω RNA backbone.

4. The editing system for identifying target sites guided by optimized ωRNA according to claim 1, characterized in that: The coding sequence of the mutant ωRNA skeleton is any one of the following: (i) the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11 or SEQ.ID.NO.12; or, (ii) a nucleotide sequence obtained by substitution, deletion or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11 or SEQ.ID.NO.12; or (iii) a nucleotide sequence having 95% or more similarity to the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11 or SEQ.ID.NO.

12.

5. An optimized NlovFz2-ω RNA editing system, characterized in that: The editing system includes a recombinant vector for expressing a NlovFz2 mutant protein and a mutant ω RNA skeleton, wherein the NlovFz2 mutant protein has mutations at one or more of the following amino acid sites: the 6th, 44th, 64th, 178th, and 285th amino acid sites, and the amino acid sites are all mutated to arginine; the mutant ω RNA skeleton includes any one of the following mutation types that causes the parent ω RNA skeleton to form an ω RNA skeleton mutant: deletion of part or all of the bases in the non-pairing region of the stem-loop structure at the 3' end of the parent ω RNA skeleton.

6. An optimized NlovFz2-ω RNA editing system according to claim 5, characterized in that: The sequence of the recombinant vector is shown as SEQ.ID.NO.

21.

7. A NlovFz2-ωRNA efficient editing system based on fusion protein, characterized in that: The editing system includes a recombinant vector for expressing a fusion protein and a mutant ω RNA skeleton, wherein the fusion protein includes a NlovFz2 mutant protein and a modification component for enhancing cutting activity, wherein the modification component specifically includes a T5 exonuclease, a TREX1 exonuclease or a CasTX nuclease expressed in fusion with the NlovFz2 mutant protein; the mutant ω RNA skeleton includes any one of the following mutation types that causes the parent ω RNA skeleton to form an ω RNA skeleton mutant: deletion of part or all of the bases in the non-pairing region of the stem-loop structure at the 3' end of the parent ω RNA skeleton.

8. A composition of a nuclease system guided by RNA from eukaryotic organisms, characterized in that: The composition comprises a first nucleic acid and a second nucleic acid, wherein the first nucleic acid is a vector for expressing a parent NlovFz2 protein, a NlovFz2 mutant protein or a fusion protein, and the second nucleic acid is a vector for expressing a mutant ωRNA skeleton; the fusion protein comprises a NlovFz2 mutant protein and a modification component for enhancing cutting activity; the mutant ωRNA skeleton comprises any one of the following mutation types that causes the parent ωRNA skeleton to form an ωRNA skeleton mutant: deletion of part or all of the bases in the non-pairing region of the stem-loop structure at the 3' end of the parent ωRNA skeleton.

9. Use of the editing system as described in claims 1, 5, 7 or the composition as described in claim 8 in gene editing.

10. Use of the editing system according to claim 1, 5, 7 or the composition according to claim 8 in the preparation of a preparation.

Images