Application of miR-486 in promoting delay of mesenchymal stem cells and / or treating intervertebral disc degeneration

Abstract

The invention belongs to the technical field of intervertebral disc degeneration treatment, and particularly relates to application of miR-486 in promoting mesenchymal stem cell delay and / or treating intervertebral disc degeneration. The miR-486 can promote the proliferation of mesenchymal stem cells, especially nucleus pulposus mesenchymal stem cells, inhibit the dry gene expression of the mesenchymal stem cells, reduce the degradation of extracellular matrixes of degenerative intervertebral discs of rats, reduce the apoptosis of cells in nucleus pulposus, and achieve a treatment effect.

Description

Technical Field

[0001] The present invention belongs to the technical field of intervertebral disc degeneration treatment, and specifically relates to the application of miR-486 in promoting mesenchymal stem cells to delay and / or treat intervertebral disc degeneration. Background Art

[0002] Intervertebral disc degeneration (IDD) is one of the spinal degenerative diseases. It is a common chronic process that mainly causes lower back pain and serious spinal diseases such as lumbar disc herniation and spinal stenosis. Due to its wide range of incidence, it has caused a huge socioeconomic burden and seriously affected the quality of life of patients.

[0003] At present, there are three main methods for the treatment of intervertebral disc degeneration in clinical practice. The first is conventional conservative therapy, which is mainly based on anti-inflammatory and analgesic treatment, supplemented by functional exercise. The second method is interventional therapy, which uses radiofrequency or injection of various chemical substances into the intervertebral disc. The third method is to directly perform surgical resection on the degenerated intervertebral disc. However, all three methods have their own problems. Conservative treatment can only relieve the patient's symptoms, but cannot fundamentally treat IDD, and there is still a risk of recurrence. Interventional therapy relieves IDD by reducing the inflammatory response in the intervertebral disc (IVD) and improving the microenvironment in the IVD structure. However, as the degree of IVD degeneration increases, conservative treatment cannot effectively improve the patient's clinical symptoms. Although surgical treatment can directly treat the degenerated intervertebral disc and avoid recurrence, it causes greater trauma to the patient and is not suitable for IDD patients with milder lesions.

[0004] The above methods cannot fundamentally reverse IDD. Therefore, many scholars are seeking new biological treatment methods to delay or reverse IDD. Biological treatment is an effective way to repair intervertebral disc degeneration. It can promote the proliferation of NP cells, inhibit IVD fibrosis, maintain the water content of IVD, and reverse the pathological process of IDD. Currently, stem cells are mainly used to treat intervertebral disc degeneration, including embryonic stem cells, mesenchymal stem cells, etc. However, the use of xenogeneic stem cells to treat IDD still has the risk of destroying the original IVD structure and triggering an immune response of the original tissue. Therefore, the treatment of IDD with xenogeneic mesenchymal stem cells faces the related problem of low immunogenicity. Therefore, it is particularly important to improve the effect of mesenchymal stem cells in treating IDD and reduce immunogenicity. Summary of the invention

[0005] The purpose of the present invention is to promote mesenchymal stem cells to delay and / or treat intervertebral disc degeneration, reduce the immunogenicity of mesenchymal stem cells, and improve the therapeutic effect of intervertebral disc degeneration.

[0006] In order to achieve the above object, the present invention provides the use of miR-486 in the preparation of a product for promoting mesenchymal stem cells to delay and / or treat intervertebral disc degeneration, wherein the mesenchymal stem cells include one or more of the 3rd to 5th generation mesenchymal stem cells.

[0007] Preferably, the product that promotes mesenchymal stem cells to delay and / or treat intervertebral disc degeneration includes one or more of the following products a) to c):

[0008] a) Products that promote the proliferation of mesenchymal stem cells and delay and / or treat intervertebral disc degeneration;

[0009] b) Products that inhibit the expression of stemness genes in mesenchymal stem cells to delay and / or treat intervertebral disc degeneration;

[0010] c) Products that promote the expression of FOXO1 gene in mesenchymal stem cells to delay and / or treat intervertebral disc degeneration.

[0011] Preferably, the stemness gene includes Nanog gene and / or SOX-2 gene.

[0012] The present invention also provides the use of mesenchymal stem cells modified by miR-486 in preparing products for delaying and / or treating intervertebral disc degeneration.

[0013] Preferably, the product for delaying and / or treating intervertebral disc degeneration includes a product for inhibiting the degradation of the extracellular matrix of intervertebral disc degeneration.

[0014] Preferably, the miR-486 modified mesenchymal stem cells include mesenchymal stem cells infected with a recombinant adenovirus vector.

[0015] The recombinant adenovirus comprises a basic adenovirus vector and miR-486 introduced into the basic adenovirus vector.

[0016] Preferably, the MOI value of the recombinant adenovirus vector to mesenchymal stem cells is 50-150.

[0017] Preferably, the mesenchymal stem cells include one or more of the 3rd to 5th generation mesenchymal stem cells;

[0018] The products include pharmaceuticals.

[0019] Preferably, the mesenchymal stem cells include nucleus pulposus mesenchymal stem cells.

[0020] The present invention also provides a medicine for treating intervertebral disc degeneration, wherein the active ingredients of the medicine include nucleus pulposus mesenchymal stem cells modified with miR-486.

[0021] Beneficial effects:

[0022] The present invention provides the use of miR-486 in the preparation of products that promote mesenchymal stem cells to delay and / or treat intervertebral disc degeneration. MiR-486 can promote the proliferation of mesenchymal stem cells, especially nucleus pulposus mesenchymal stem cells, inhibit the expression of stemness genes of mesenchymal stem cells, reduce the degradation of extracellular matrix of rat degenerative intervertebral disc cells, reduce apoptosis of cells in the nucleus pulposus, and achieve a therapeutic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0024] Figure 1 The cell morphology of nucleus pulposus mesenchymal stem cells P1, P3, and P5 derived from normal nucleus pulposus tissue; the magnification is 40×;

[0025] Figure 2 Flow cytometry was used to detect the phenotype of normal nucleus pulposus mesenchymal stem cells (P3);

[0026] Figure 3 The results of osteogenic staining (Alizarin red staining) of nucleus pulposus mesenchymal stem cells; the scale bar is 100 μm;

[0027] Figure 4 This is the result of adipogenic staining (Oil Red O staining) of nucleus pulposus mesenchymal stem cells; the scale bar is 100 μm;

[0028] Figure 5 The results of staining (Alcian blue staining) of nucleus pulposus mesenchymal stem cells into chondrogenic spheres; the scale bar is 200 μm;

[0029] Figure 6 The staining results of miR-486 modified NPMSCs at different MOI values;

[0030] Figure 7 The results of cell flow cytometry analysis of miR-486 modified NPMSCs at different MOI values;

[0031] Figure 8 is the expression of miR-486 in NPMSCs;

[0032] Fig. 9 The effect of miR-486 modification on the expression of stemness genes in NPMSCs;

[0033] Fig.10 The effect of miR-486-modified NPMSCs on the expression of FOXO1; **** indicates P < 0.001;

[0034] Fig.11is the cell proliferation curve of NPMSCs under different conditions;

[0035] Fig.12 The results of EdU proliferation staining under a fluorescent inverted microscope;

[0036] Fig.13 The results of the caudal intervertebral disc tissue scoring of rats in each treatment group;

[0037] Fig.14 The staining results of the coccygeal intervertebral disc tissue of rats in each treatment group;

[0038] Fig.15 The results of histochemical staining of Col-Ⅰ, Col-Ⅱ, Aggrecan and Caspase-3 in the coccygeal intervertebral disc tissue of rats in each treatment group;

[0039] Fig.16 The results of positive cell counts of Col-Ⅰ, Col-Ⅱ, Aggrecan and Caspase-3 in the coccygeal intervertebral disc tissue of rats in each treatment group. DETAILED DESCRIPTION

[0040] The present invention provides the use of miR-486 in the preparation of a product for promoting mesenchymal stem cells to delay and / or treat intervertebral disc degeneration. In the present invention, the mesenchymal stem cells include one or more of the 3rd to 5th generation mesenchymal stem cells, and more preferably the 3rd generation mesenchymal stem cells.

[0041] miR-486 can promote the proliferation of mesenchymal stem cells, especially nucleus pulposus mesenchymal stem cells, inhibit the expression of stem genes of mesenchymal stem cells, reduce the degradation of extracellular matrix of degenerative intervertebral discs in rats, reduce the apoptosis of cells in the nucleus pulposus, and achieve a therapeutic effect. When mesenchymal stem cells were cultured to the fifth generation, the identification results of cell stemness immune markers still met the definition of mesenchymal stem cells. Among them, the immunophenotype identification results of the third generation nucleus pulposus mesenchymal stem cells showed high expression of CD73 (95.7%), CD90 (96.7%) and CD105 (86.4%), and low expression of HLA-DR (0.28%) and CD34 (0.39%).

[0042] In view of the role of miR-486, the use of miR-486 in the preparation of one or more of the following products a) to c) also falls within the scope of protection of the present invention: a) products that promote the proliferation of mesenchymal stem cells to delay and / or treat intervertebral disc degeneration; b) products that inhibit the expression of mesenchymal stem cell stemness genes to delay and / or treat intervertebral disc degeneration; c) products that promote the expression of mesenchymal stem cell FOXO1 gene to delay and / or treat intervertebral disc degeneration.

[0043] In the present invention, the stemness gene preferably includes Nanog gene and / or SOX-2 gene. The product of the present invention preferably includes a drug.

[0044] The present invention also provides the use of mesenchymal stem cells modified by miR-486 in preparing products for delaying and / or treating intervertebral disc degeneration.

[0045] In the present invention, the miR-486-modified mesenchymal stem cells include mesenchymal stem cells infected with a recombinant adenovirus vector; the recombinant adenovirus preferably includes a basic adenovirus vector and miR-486 introduced into the basic adenovirus vector. The MOI value of the recombinant adenovirus vector of the present invention for mesenchymal stem cells is preferably 50 to 150, and more preferably 100. The miR-486-modified mesenchymal stem cells provided by the present invention can inhibit the degradation of the extracellular matrix of intervertebral disc degeneration, and alleviate and / or treat intervertebral disc degeneration.

[0046] The present invention also provides a medicine for treating intervertebral disc degeneration, wherein the active ingredients of the medicine include nucleus pulposus stem cells modified with miR-486.

[0047] To further illustrate the present invention, the application of miR-486 provided by the present invention in promoting mesenchymal stem cells to delay and / or treat intervertebral disc degeneration is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0048] The experimental materials used in the embodiments of the present invention are as follows:

[0049] 1. Experimental Animals

[0050] Twenty-five 8-week-old SPF male SD rats were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. [SCXK (Beijing) 2016-0006] and raised in a standardized animal room. The SD rats in each group were raised in the same animal room at a temperature of about 25°C.

[0051] 2. Experimental Reagents

[0052] α-MEM culture medium (Gibco), fetal bovine serum (Gibco), PBS (Wuhan Sevier Biotechnology Co., Ltd.), phosphate buffered saline powder (Wuhan Sevier Biotechnology Co., Ltd.), penicillin-streptomycin (HyClone, USA), 0.25% trypsin containing EDTA (Gibco), dimethyl sulfoxide (DMSO) (Beijing Inokai Technology Co., Ltd.), type II collagenase (Sigma, USA), fluorescently labeled CD90 antibody (Thermo Fisher, USA), fluorescently labeled CD105 antibody (Thermo Fisher, USA), fluorescently labeled CD73 antibody (Thermo Fisher, USA), fluorescently labeled CD34 antibody (Thermo Fisher, USA), fluorescently labeled HLA-DR antibody (Thermo Fisher Company), anhydrous ethanol (China National Pharmaceutical Company), glycine (Shanghai Weidayouer Company), human mesenchymal stem cell osteogenic differentiation medium (Wuhan Pronocell Life Science Co., Ltd.), human mesenchymal stem cell chondrogenic differentiation medium (Wuhan Pronocell Life Science Co., Ltd.), human mesenchymal stem cell adipogenic differentiation medium (Wuhan Pronocell Life Science Co., Ltd.), Oil Red O staining kit (Cyagen, USA), Alizarin Red staining kit (Cyagen, USA), Alcian Blue staining kit (Cyagen, USA), Real-Time PCR kit (CST, USA), BeyoClick TM EdU-555 cell proliferation detection kit (Biyuntian Biotechnology), xylene (China National Pharmaceutical Group), HE stain (China ServiceBio), differentiation solution (China ServiceBio), neutral gum (China National Pharmaceutical Group).

[0053] 3. Experimental instruments

[0054] Clean bench (Beijing Semiconductor Equipment Plant No. 1), CO2 constant temperature cell culture incubator (Thermo Fisher, USA), optical inverted microscope (Olympus, Japan), VarioskanFlash multifunctional full wavelength microplate reader (Thermo Fisher, USA), ice maker (Beijing Changliu Scientific Instrument Co., Ltd.), PowerPac164-5050 electrophoresis instrument (Bio-Rad, USA), UV spectrophotometer (Thermo Fisher, USA), -80℃ ultra-low temperature refrigerator (Haier, China), ultraspeed floor centrifuge (Beckman, USA), pipette (Thermo Fisher, USA), 50mL centrifuge tube (Corning, USA), EP tube (Corning, USA), cell culture flask (Corning, USA), cell culture plate (6-24 wells) (Corning, USA), BD FACS Calibur flow cytometer (BD, USA), water bath (Changfeng, China), 7500Fast Real-Time PCR System (ABI, USA), ultrapure water instrument (Millipore, USA), high-speed refrigerated centrifuge (Thermo Fisher, USA), fluorescence inverted microscope (Olympus, Japan)

[0055] Example 1

[0056] 1. Extraction, Isolation and Culture of Human Nucleus Pulposus Mesenchymal Stem Cells

[0057] With the approval of the Chinese Medical Ethics Committee and written consent from the patients, we collected the nucleus pulposus tissue from patients aged 20 to 30 years who underwent surgery for acute lumbar disc herniation and whose MRI showed Pearce grade I and II disc degeneration. The nucleus pulposus tissue samples removed during the operation were washed with sterile saline to remove blood stains on the surface of the tissue, transferred to a centrifuge tube containing sterile α-MEM, and brought back to the laboratory within 2 hours. After obtaining the tissue sample, the nucleus pulposus stem cells were isolated and extracted as soon as possible to ensure cell survival rate. In a sterile clean bench, the samples were rinsed repeatedly with sterile PBS buffer for 3 times and transferred to a culture dish containing a small amount of α-MEM culture medium. Sterile ophthalmic forceps and ophthalmic scissors were used to peel off the annulus fibrosus and other tissues around the nucleus pulposus tissue. The gel-like nucleus pulposus was selected and placed in a tube. The nucleus pulposus tissue was cut into pieces with tissue scissors to about 1 mm. 3sized pieces. Transfer to a 50mL centrifuge tube. Add 0.2% type II collagenase solution, and digest for 2 hours at 250rpm in a constant temperature shaker at 37℃. Add the same volume of complete culture medium to terminate digestion. Centrifuge at 1000rpm for 5min to remove the supernatant, add 20mL α-MEM culture medium to resuspend the cells, filter with a 100μm cell sieve, and retain the digested tissue. Use 5mL of α-MEM complete culture medium containing 1% double antibody and 15% serum to resuspend the digested tissue, and inoculate it in a T25 culture bottle, shake it with the "cross" method, try to evenly disperse the tissue blocks, and transfer it to a 37℃, 5% CO2 incubator for culture. Observe the cells with an inverted phase contrast microscope, adhere to the wall, and grow. After 3 days of culture, very few cells appear. After about 7 days, a large number of cells adhere to the wall. When changing the medium, carefully aspirate the culture medium to prevent tissue loss, and then change the culture medium every 3 days. When the cells reach 80% to 100% fusion, aspirate and discard the supernatant and tissue blocks. Under the microscope, cells can be seen to be spindle-shaped or fusiform after attaching to the wall. Figure 1 ), and after purification, NPMSCs from passage 3 (P3) to passage 5 (P5) were used for subsequent experiments.

[0058] When the primary cell growth reaches 85%-95%, it can be subcultured. Aspirate the culture medium, rinse with PBS, and digest with 0.25% trypsin. Under the microscope, the cells are spherical and a large number of cells fall off from the bottom of the culture flask. Add 2mL of α-MEM complete culture medium to terminate the digestion process. Use the pipette tip to blow repeatedly until the cells completely fall off from the bottom of the culture flask, transfer the primary cell suspension to a 15mL centrifuge tube, and centrifuge at 1000rpm for 5min to remove the supernatant. Add 2mL of α-MEM complete culture medium, blow and mix, and then transfer to the culture flask at a ratio of 1:2 for culture.

[0059] 2. Cryopreservation and thawing of human nucleus pulposus mesenchymal stem cells

[0060] When freezing cells, place 0.25% trypsin in a 37°C water bath for 15 minutes. Prepare cell freezing solution with a ratio of DMSO: FBS = 1:9. Digest cells in the same way as cell passage. Count cells and resuspend them in freezing solution. Adjust cell concentration and place cells at 1×10 6 ~5×10 6 / mL, transfer 1mL into a 2mL cryotube. Place the cryotube in a gradient cryobox and place it in a -80℃ refrigerator. After 24 hours, take out the cryobox and transfer the cryotube to liquid nitrogen for long-term storage. Record the information of the frozen cells. When the cells are revived, adjust the constant temperature water bath to 37℃, open the liquid nitrogen tank and take out the frozen cells that need to be revived according to the freezing information. Check whether the cryotube is loose. After confirming that it is not loose, quickly place it in a 37℃ water bath and shake it to quickly complete the thawing process to prevent crystals from damaging the cells. During the thawing process, always keep the mouth of the cryotube higher than the liquid level of the water bath. After thawing, quickly transfer it to a 15mL centrifuge tube, add 10mL of α-MEM complete medium, 1000rpm, 5min, centrifuge and discard the supernatant, add 1mL of α-MEM complete medium to resuspend, transfer to a 10cm culture dish, shake it evenly with the "cross" method, transfer it to a 37℃, 5% CO2 incubator for culture, and change the medium for about 24 hours.

[0061] 3. Detection of Cellular Immunophenotype of NPMSCs by Flow Cytometry

[0062] When the cells reach 90% after cell subculturing, discard the supernatant, wash with sterile PBS three times, digest with 0.25% trypsin-EDTA digestion solution, collect in a 15mL centrifuge tube, add 1mL pre-cooled sterile PBS, pipette and mix, count. Take 2×10 6 Place cells in a 15mL centrifuge tube, add pre-cooled PBS, resuspend the cells, and dispense into flow tubes, 2mL per tube, centrifuge at 1700rpm for 6min, and discard the supernatant. Add 2mL PBS again to resuspend, centrifuge at 1700rmp for 2min, and then resuspend with 50mL PBS. Add 1L of fluorescent labeled antibodies (CD90, CD105, CD73, CD34, HLA-DR) to each tube according to the concentration recommended in the antibody manual, and incubate at room temperature in the dark for 40min. The supernatant was removed by centrifugation, and the cells were resuspended in PBS and washed twice. The method was the same as above. After being resuspended in 400L PBS, the cell surface antigens were analyzed by flow cytometry. The results showed that when mesenchymal stem cells were cultured to the fifth generation, the identification results of cell stemness immune markers still met the definition of mesenchymal stem cells. Among them, the immunophenotype identification results of the third generation nucleus pulposus mesenchymal stem cells showed high expression of CD73 (95.7%), CD90 (96.7%) and CD105 (86.4%), and low expression of HLA-DR (0.28%) and CD34 (0.39%). Figure 2 ).

[0063] 4. Identification of the differentiation potential of NPMSCs by inducing differentiation into three lines

[0064] (1) Alizarin red staining

[0065] Add ascorbic acid, penicillin-streptomycin, sodium β-glycerophosphate, FBS and other ingredients to the stem cell osteogenic differentiation medium in the optimal proportion according to the instructions to prepare the osteogenic differentiation complete medium. When the degree of confluence of NPMSCs seeded in the six-well plate reaches 80-90%, aspirate the complete medium in the well and replace it with osteogenic differentiation medium. Replace the osteogenic differentiation complete medium every 3 days. After 2-4 weeks of induction culture depending on the situation, stain with Alizarin Red staining solution. Red granular nodules can be seen under a microscope, which are calcified nodules deposited on the cell surface unique to osteogenic differentiation ( Figure 3 ).

[0066] (2) Oil Red O staining

[0067] FBS, dexamethasone, rosiglitazone and IBMX were added to the stem cell adipogenic differentiation medium ADP1 liquid basal medium according to the optimal ratio in the instructions to prepare adipogenic differentiation medium A liquid (hereinafter referred to as A liquid). As above, it was added to the ADP2 liquid basal medium to prepare adipogenic differentiation medium B liquid (hereinafter referred to as B liquid). After subculture, the cells were placed in a six-well plate. When the growth of NPMSCs reached 90%, the complete medium was discarded and replaced with 2mL of adipogenic A liquid for culture. After 3 days of induction, A liquid was replaced with B liquid. After 24 hours of induction, it was replaced with A liquid again. After alternating culture for 3 to 5 times, when obvious lipid droplets were observed in the stem cells, B liquid was continued to be used for 3-6 days (replaced once every 3 days) until the lipid droplets became large, round and full enough, and the induction could be terminated. Each well was washed twice with PBS, 2mL of 4% neutral formaldehyde solution was added, and fixed for 30 minutes. Prepare Oil Red O working solution at a ratio of saturated Oil Red O solution: distilled water = 1:3. Aspirate the neutral formaldehyde solution and wash twice with PBS. Stain with Oil Red O working solution for 30 minutes. Aspirate the Oil Red O dye solution and wash twice with PBS to remove background impurities. Multiple red grape-like areas can be seen under the microscope, which are the lipid droplet changes unique to adipogenic differentiation ( Figure 4 ).

[0068] (3) Alcian blue staining

[0069] Add dexamethasone, ascorbic acid, ITS additives, penicillin-streptomycin and other ingredients to the chondrogenic differentiation basal medium according to the optimal ratio in the instructions to prepare a semi-complete chondrogenic differentiation medium. Before each use, temporarily add TGF-β3 according to the ratio to prepare a complete chondrogenic differentiation medium for mesenchymal stem cells. As above, when the NPMSCs confluence reaches 80-90%, add the complete chondrogenic differentiation medium (prepared and used immediately) to resuspend the cells. Pipette 500L of cell suspension (i.e. 2.5×10 5Cells) were transferred into a 15mL centrifuge tube and centrifuged at 150g for 5 minutes. After centrifugation, the cell clusters should not be shaken or blown, and should be cultured in an incubator at 37°C and 5% CO2. New chondrogenic differentiation complete medium was used every 2 days, 0.5mL per tube. After 48 hours of inoculation, the cell clusters were seen to gather into spheres, and the induction culture was continued. After 3 weeks of induction, the chondrogenic spheres were fixed with 4% paraformaldehyde, then embedded in paraffin and sliced, and stained with Alcian blue dye to observe the cartilage formation. Microscopic observation showed large blue areas, which were the unique cartilage changes in chondrogenic differentiation ( Figure 5 ).

[0070] comprehensive Figures 3 to 5 It can be seen that the nucleus pulposus mesenchymal stem cells that meet the characteristics of mesenchymal stem cells were separated from the nucleus pulposus tissue, and the nucleus pulposus mesenchymal stem cells have the ability to differentiate into three lines of osteoblasts, adipocytes and chondrocytes. The third to fifth generation cells were selected in subsequent experiments.

[0071] 5.miR-486 infects NPMSCs

[0072] 5.1 Determine the optimal MOI required to infect NPMSCs

[0073] NPMSCs were inoculated in 24-well plates, and different infection wells were set at 0, 50 MOI, 100 MOI, and 150 MOI, respectively. The number of cells in each well was 5 × 10 4 . The required amount of virus was calculated based on the virus dosage pfu = optimal MOI × number of cells / virus titer. According to the calculation, 0, 0.5μl, 1μl, and 1.5μl were added to the four different infection wells of 0, 50MOI, 100MOI, and 150MOI, respectively. The number of positive cells was detected by cell flow cytometry under a fluorescent inverted microscope to determine the MOI value required for the selection experiment. The results showed that the staining positive rates in 0, 50MOI, 100MOI, and 150MOI were 0.19%, 50.5%, 72.4%, and 72.9%, respectively, and there was no significant difference between 100MOI and 150MOI ( Figure 6 and Figure 7 ), and finally determined the optimal infection to be 100 MOI.

[0074] 5.2 NPMSCs / miR-486 used in experiments

[0075] (1) NPMSCs were seeded in a 12-well culture plate, with 1×10 cells per well. 5Each well was cultured in 1 mL volume and adhered overnight. When the cells grew to 75%, the adenovirus stock solution was diluted with α-MEM complete medium according to the optimal infection MOI value of 100. Take out the 12-well plate from the incubator, discard the culture medium, add the prepared adenovirus solution diluted with complete culture medium, and set up three groups of control group (Normal), empty group (AD-NULL), and miR-486 group in the 12-well culture plate. After adding the calculated virus solution, mix them well and place them in a CO2 incubator at 37°C and 5% CO2. After 40 hours of infection, the fluorescence expression in the cells was observed using an inverted phase contrast microscope. Observe the efficiency of infection of NPMSCs. Note: The state of the cells before infection has a great influence on the final infection effect. Before adding the virus, make sure that the cells are in good condition. High expression of miR-486 was observed under a fluorescent inverted microscope.

[0076] (2) To verify the expression of miR-486 in infected NPMSCs and confirm whether the infection was successful, actin was used as an internal reference gene to detect the expression level of specific genes. RT-qPCR experiments were used for verification. By designing miR-486 primers (Table 1), extracting RNA, and reversely transcribing cDNA, the high expression of miR-486 in the experimental group was measured. After statistical analysis, the P value was <0.05, and the difference was statistically significant ( Figure 8 ).

[0077] (3) Immunofluorescence, flow cytometry and RT-qPCR experiments confirmed that miR-486 successfully infected NPMSCs. To evaluate the effect of miR486 infection on the stemness of NPMSCs, RT-qPCR experiments were performed to synthesize primers for Nanog and SOX-2 (Table 1), extract RNA, and reverse transcribe cDNA. The results showed that Nanog and SOX-2 were both lowly expressed in the experimental group. After statistical analysis, the P value was <0.01, and the difference was statistically significant ( Fig. 9 ). Overexpression of miR-486 can promote the proliferation of NPMSCs and inhibit the expression of stemness genes in NPMSCs.

[0078] (4) Primer design for FOXO1 (Table 1) was performed, and RT-qPCR was used to detect the expression of FOXO1, the target gene of miR-486. The results of RT-qPCR showed that mi-486-modified NPMSCs increased the expression of FOXO1. The P value was <0.001, and the difference was statistically significant ( Fig.10 ).

[0079] Table 1 Primer sequences

[0080] Gene Upstream primer (5'-3') Downstream primer (5'-3') Actin GGGACCTGACTGACTACCTC(SEQ ID NO.1) GGGACCTGACTGACTACCTC(SEQ ID NO.2) miR-486 GGTCCTGTACTGAGCTGC(SEQ ID NO.3) GGTCCTGTACTGAGCTGC(SEQ ID NO.4) Nanog CTGTGTTCTCTTCCACCCA(SEQ ID NO.5) CTGTGTTCTCTTCCACCCA(SEQ ID NO.6) SOX-2 CATCCACACTCACGCAAA(SEQ ID NO.7) CATCCACACTCACGCAAA(SEQ ID NO.8) FOXO1 GGGGCAGTCCAAGACATA(SEQ ID NO.9) GGGGCAGTCCAAGACATA(SEQ ID NO.10)

[0081] 6. Effect of miR-486 on the proliferation of NPMSCs

[0082] (1) CCK-8 assay for NPMSCs proliferation

[0083] The blank group, control group (NPMSCs), empty group (NPMSCs / nul), and miR-486 group (NPMSCs / miR-486) ​​were set up. The number of cells per well was set to 1×10 3 / well. According to the group settings, add the pre-prepared complete culture medium to the culture medium of each group, and after resuspending, inoculate in a 96-well plate, with 3 sub-wells set up in each well. The volume of each well is 100 μL, and transfer to a 37°C, 5% CO2 incubator for culture. After the culture plates in the incubator were cultured for 0d, 1d, 3d, 5d, 7d, 9d, 11d, and 13d, 100 μL of CCK-8 culture medium was added when they were taken out (CCK-8: complete culture medium = 1:9). Continue incubation for 2 hours. Turn on the multifunctional full-wavelength microplate reader and detect the absorbance value (OD value) of each group at a wavelength of 450nm. Repeat the above steps 3 times, and draw a proliferation curve according to the OD value of each group. Draw a curve with the cell culture time as the horizontal axis and the OD value as the vertical axis. The results showed that miR-486 began to show proliferation differences on the 9th day of NPMSCs proliferation, and the cell growth reached its maximum value on the 11th day ( Fig.11 )

[0084] (2) EdU proliferation staining

[0085] 1) Preparation of reagents and consumables: washing solution (3% BSA in PBS), permeabilization solution (0.3% Triton X-100 in PBS), deionized water or ultrapure water;

[0086] 2) The NPMSCs cells pre-seeded in six-well plates were cultured and three groups were set up: control group (NPSC), empty group (NPSC / nul), and miR-486 group (NPSC / miR-486). The pre-treated complete culture medium was added and incubated for 40 hours;

[0087] 3) Prepare 2X EdU working solution, dilute EdU (10 mM) with a-MEM complete cell culture medium at 1:500 to obtain 2X EdU working solution (20 μM);

[0088] 4) Add 1 mL of a-MEM complete cell culture medium to a six-well plate in advance, pipette 1 mL into a six-well plate, add an equal volume of 1 mL of 20 μM EdU working solution into the six-well plate, and continue to incubate the cells for 8 hours;

[0089] 5) After the incubation, fix the cells with 1 mL of 4% paraformaldehyde solution at room temperature for 15 min;

[0090] 6) Aspirate and discard the fixative solution, and wash three times with 1 mL of washing solution;

[0091] 7) Remove the washing solution and incubate each well with 1 mL of permeabilization solution (PBS containing 0.3% Triton X-100) at room temperature for 15 minutes;

[0092] 8) Wash cells 1-2 times with 1 mL of washing solution per well, each time for 3-5 min;

[0093] 9) Dissolve one tube of ClickAdditive in 1.3 mL of deionized water and mix until completely dissolved to prepare ClickAdditive Solution. Take the amount of ClickAdditive Solution you need and aliquot the rest and store at -20°C;

[0094] 10) Prepare Click reaction solution (Click Reaction Buffer 1.72 mL, CuSO4 80 μL, Azide 5554 μL, Click Additive Solution 200 μL) and use it within 15 min;

[0095] 11) Remove the washing solution. Add 0.5 mL of Click reaction solution to each well and gently shake the culture plate to mix the reaction solution evenly. Incubate at room temperature in the dark for 30 minutes. Wash again with washing solution 3 times, 3-5 minutes each time;

[0096] 12) Nuclear staining. Use Hoechst 33342 for nuclear staining. Prepare 1X Hoechst 33342 solution according to the instructions. Aspirate the washing solution, add 1 mL of 1X Hoechst 33342 solution to each well, and incubate at room temperature in the dark for 10 minutes. Aspirate the 1X Hoechst 33342 solution. Wash 3 times with washing solution, 3-5 minutes each time;

[0097] 13) Fluorescence detection. The cell proliferation ratio was measured. The results showed that compared with the control group, the proliferation ratio of miR-486-modified NPMSCs was higher, with a significant difference ( Fig.12 ).

[0098] Example 2

[0099] In vivo effect of miR-486 modified nucleus pulposus mesenchymal stem cells on the treatment of intervertebral disc degeneration

[0100] 1. Establishment of rat model of intervertebral disc degeneration

[0101] SD rats were selected and placed on the experimental animal operation table of the experimental center. Pentobarbital was used for intermittent intraperitoneal injection anesthesia (10mL / kg). After successful anesthesia, they were placed on the operation table, the limbs and tail were fixed, and the tail was disinfected. After the drape was completed, a 21G needle was used to puncture the coccygeal segments (Co5-6 and Co7-8). The needle was inserted vertically, parallel to the upper and lower end plates to the center of the intervertebral disc, and the puncture needle was slowly rotated 180°, stayed for 5 seconds, and the puncture needle was removed. Gauze was used to compress and stop bleeding. After disinfection again, the treated coccygeal segments were wrapped with gauze. After marking the treated coccygeal segments, they were returned to the cage for continued feeding. The untreated rat intervertebral discs were used as the control group. After marking, they were returned to the cage for continued feeding. After surgery, the coccygeal vertebrae of the surgical group were disinfected and repeatedly marked regularly. Two weeks after the puncture, the three-dimensional reconstruction of the treated segments using Mirco-CT confirmed that the intervertebral disc degeneration model was successfully established.

[0102] 2. Experimental animals are divided into groups and injected with therapeutic drugs

[0103] Step 1 After the model was successfully constructed, it was randomly divided into a control group (NC), a degeneration group (DC), a NPMSCs group, a NPMSCs-null group, and a NPMSCs / miR-486 group. There were 5 model rats in each group. After the model rats were fully anesthetized, the limbs were fixed routinely. After routine disinfection, a 1mL injection needle was used to enter the intervertebral disc at the marked position and slowly injected. After the injection was completed, the needle was slowly pulled out to avoid secondary damage to the intervertebral disc. Use gauze to press gently for 2 minutes, and after routine disinfection again, put it back in the cage for continued feeding. Regularly check the health of the coccyx and disinfect it to prevent infection. After the skin lesions are completely healed, the health status is recorded regularly. The rats in the control group were not treated.

[0104] 3. Decalcification

[0105] (1) The rats killed by CO2 anesthesia were fixed on the operating table, and the intervertebral disc connected to the marked section of the coccygeal vertebra was selected as the surgical incision. The marked section of the coccygeal vertebra was completely preserved and the other parts were removed. The intact coccygeal vertebra was immersed in 4% paraformaldehyde tissue fixative for 48 hours;

[0106] (2) After fixation, the complete caudal vertebrae containing the marked segments were removed and placed in a 50 mL centrifuge tube containing 10% EDTA decalcification solution. The tube was placed on a shaker at room temperature for decalcification. The decalcification solution was changed every 4-5 days.

[0107] (3) Observe the coccyx every day and tentatively puncture the coccyx vertebral body with a 1 mL syringe. Decalcification is complete when the vertebral body can be easily penetrated.

[0108] 4. Slicing

[0109] (1) Sampling: Take the decalcified caudal vertebrae tissue out of the decalcification solution with tweezers and place it on the operating table. Trim the tissue around the caudal vertebrae and mark the trimmed caudal vertebrae and place them in a dehydration box for dehydration.

[0110] (2) Dehydration and wax dipping: Place the dehydration box in gradient alcohol for dehydration;

[0111] (3) Embedding: Use an embedding machine to embed the wax-soaked coccygeal vertebrae. First, place the embedding block in the embedding frame. Before the wax block solidifies, place the embedding block in the embedding frame, mark it, cool it at -20°C, and trim the wax block after solidification.

[0112] (4) Sectioning: Place the trimmed wax block on a slicer and cut it to a thickness of about 4 μm. Pick up the tissue in the water with a glass slide, place it in an oven to dry, and then take it out and place it in a room temperature environment for later use.

[0113] 5. H&E staining

[0114] Take out the paraffin sections and wash with water. Use hematoxylin staining solution to stain for 5 minutes, wash twice with water, differentiate with solution, wash again with water, wash again with blue solution. Immerse the sections in 85% and 95% gradient alcohol in turn, dehydrate for 6 minutes, and stain with eosin for 5 minutes. After dehydration to transparency, use neutral gum to seal the sections. The staining results show that the acupuncture model of rat intervertebral disc degeneration is successful ( Fig.13 ).

[0115] 6. Safranin-Fast Green Staining

[0116] Paraffin sections were dewaxed as above. After washing with water, they were placed in fast green stain for 8 minutes, and washed with water until the cartilage was colorless. After soaking in differentiation solution, they were washed with water. Safranin stain was used for 20 seconds, and then quickly dehydrated with anhydrous ethanol. After using xylene until transparent, the sections were sealed with neutral gum. The staining results showed that the green osteogenic part of the cartilage endplate, annulus fibrosus and nucleus pulposus in the degeneration group was higher than that in the normal group and the treatment group, and the intervertebral disc degeneration was obvious ( Fig.13 ).

[0117] 7.Masson staining

[0118] Dewax the paraffin sections as above. Soak in potassium dichromate overnight and wash with water. Mix equal volumes of hematoxylin A and B to make an iron hematoxylin stain solution, soak in the iron hematoxylin stain solution for 3 minutes, wash with water, then differentiate, turn blue, and wash with water. Stain with ponceau acid fuchsin for 10 minutes and wash with water. Stain with phosphomolybdic acid aqueous solution for 2 minutes, then soak in aniline blue stain solution for 5 minutes, differentiate with 1% glacial acetic acid, and then make a transparent seal. The staining results are as follows Fig.13 shown.

[0119] 8. In order to evaluate the treatment of intervertebral disc degeneration, the stained sections of rat intervertebral discs were sealed with labels to indicate all group information, and the serial numbers were re-marked. Three spinal surgeons were found, and before participating in the scoring, the doctors were asked to master the intervertebral disc grading standards and the significance of H&E staining, safranin fast green staining, and Masson staining. The scoring process adopted the double-blind principle, and the experimenters recorded the score of each sample throughout the process. The data obtained were entered into GraphPad 8.0 software for statistical analysis. The results showed that compared with the normal group, the NPMSCs group, the NPMSCs-null group, and the NPMSC / miR-486 group, the three treatment groups were all effectively treated, and the NPMSC / miR-486 group had the most obvious treatment effect, and the difference was statistically significant ( Fig.14 ).

[0120] 9. Immunohistochemical staining of COL-II, COL-I, Aggrecan, and Caspase-3

[0121] (1) Paraffin sections are the same as above. The sections are processed in sequence according to the process of dewaxing solution I for 15 min - dewaxing solution II for 15 min - dewaxing solution III for 15 min - anhydrous ethanol I for 5 min - anhydrous ethanol II for 5 min - 85% alcohol for 5 min - 75% alcohol for 5 min - water washing;

[0122] (2) Soak tissue sections in citric acid antigen retrieval buffer (PH6.0) and perform antigen retrieval in a microwave oven, heat at medium for 8 minutes until boiling, turn off the heat for 8 minutes, keep warm, and then switch to medium-low heat for 7 minutes. After cooling, decolorize in PBS (pH7.4), shake and wash 3 times, 5 minutes each time;

[0123] (3) Soak in 3% hydrogen peroxide solution, incubate in dark for 25 minutes, wash again, and drip 3% BSA into the disc tissue circle to evenly cover the tissue, and seal at room temperature for 30 minutes;

[0124] (4) Gently remove the blocking solution, add the primary antibody prepared in a certain ratio of PBS to the slices, and incubate the slices flat in a humidified box at 4°C overnight;

[0125] (5) Wash the slices in PBS (pH 7.4) using the same method as above. After the slices are slightly dry, add a secondary antibody (labeled with HRP) of the same species as the primary antibody to cover the tissue and incubate at room temperature for 50 min.

[0126] (6) Wash the slices in PBS (PH7.4). The method is the same as above. After the slices are slightly dried, add freshly prepared DAB color developing solution in the circle. The color development time is controlled under a microscope. The positive color is brown-yellow. Wash the slices with water to stop the color development.

[0127] (7) Counterstaining of cell nuclei: Hematoxylin staining, see H&E staining for the method;

[0128] (8) Seal the slides with dehydrated gum.

[0129] (9) The immunohistochemical sections of rat intervertebral discs were re-labeled with serial numbers and counted. Three researchers were found, based on the brown-yellow color of positive cells and the blue color of cell nuclei ( Fig.15 ). Before counting, positive cells were brown and cell nuclei were blue. The experimenter recorded the positive cell counts of each sample throughout the process. The data obtained were entered into GraphPad 8.0 software for statistical analysis. The results showed that COL-Ⅰ was positively expressed in all groups and significantly increased in the IDD group. There was no statistically significant difference between the NPMSCs / miR-486 treatment group and the normal group (P>0.05). Compared with the degeneration group, the expression of Aggrecan and Col-Ⅱ in the degenerated intervertebral disc treated with nucleus pulposus mesenchymal stem cells overexpressing miR-486 increased, reducing the degradation of the extracellular matrix of nucleus pulposus cells. The expression of Caspase-3 was reduced, inhibiting the apoptosis of nucleus pulposus cells. Compared with the degeneration group, the expression of Col-Ⅰ in the outer layer fibrosis of the degeneration group was significantly increased. The ratio of Col-Ⅰ / Col-Ⅱ in the intervertebral disc of the NPMSCs / miR-486 treatment group decreased. miR-486-modified NPMSCs have a therapeutic effect on degenerative intervertebral disc degeneration ( Fig.16 ).

[0130] Based on the above, it can be seen that miR-486 can promote the proliferation of NPMSCs and inhibit the expression of stemness genes of nucleus pulposus mesenchymal stem cells. NPMSCs / miR-486 reduced the degradation of extracellular matrix of degenerative intervertebral discs in rats and reduced the apoptosis of cells in the nucleus pulposus, thus achieving a therapeutic effect.

[0131] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of miR-486 in the preparation of products that promote mesenchymal stem cells to delay and / or treat intervertebral disc degeneration.

2. The use according to claim 1, characterized in that: The product includes one or more of the following a) to c): a) Products that promote the proliferation of mesenchymal stem cells and delay and / or treat intervertebral disc degeneration; b) Products that inhibit the expression of stemness genes in mesenchymal stem cells to delay and / or treat intervertebral disc degeneration; c) Products that promote the expression of FOXO1 gene in mesenchymal stem cells to delay and / or treat intervertebral disc degeneration.

3. The use according to claim 2, characterized in that: The stemness genes include Nanog gene and / or SOX-2 gene.

4. Application of miR-486-modified mesenchymal stem cells in the preparation of products for delaying and / or treating intervertebral disc degeneration.

5. The use according to claim 4, characterized in that: The products for delaying and / or treating intervertebral disc degeneration include products for inhibiting degradation of extracellular matrix of intervertebral disc degeneration.

6. The use according to claim 4, characterized in that: The miR-486 modified mesenchymal stem cells include mesenchymal stem cells infected with a recombinant adenovirus vector; The recombinant adenovirus vector comprises a basic adenovirus vector and miR-486 introduced into the basic adenovirus vector.

7. The use according to claim 6, characterized in that: The MOI value of the recombinant adenovirus vector to mesenchymal stem cells is 50-150.

8. The use according to any one of claims 1 to 7, characterized in that: The mesenchymal stem cells include one or more of the 3rd to 5th generation mesenchymal stem cells; The products include pharmaceuticals.

9. The use according to claim 8, characterized in that: The mesenchymal stem cells include nucleus pulposus mesenchymal stem cells.

10. A drug for treating intervertebral disc degeneration, characterized in that: The active ingredients of the medicine include nucleus pulposus mesenchymal stem cells modified by miR-486.

Images