Culture device for screening inorganic phosphorus dissolving bacteria and screening method of inorganic phosphorus dissolving bacteria

Abstract

The invention belongs to the technical field of microorganisms, and discloses a culture device for screening inorganic phosphorus dissolving bacteria and a screening method of the inorganic phosphorus dissolving bacteria. The culture device provided by the invention comprises a visual culture tube which comprises a culture part and a color development part, wherein the culture part is filled with an inorganic phosphorus dissolving bacteria screening liquid culture medium; the color development part is arranged below the culture part, and pH color development gel in the color development part has the functions of filtration and indication at the same time, so that the inorganic phosphorus dissolving bacteria screening liquid culture medium and related acid metabolites can enter the pH color development gel under the action of gravity, and bacteria are enriched on the upper surface of the culture part and / or the color development part; the inorganic phosphorus dissolving bacteria with the phosphorus dissolving capacity can be rapidly and accurately screened out by observing the color change of the pH developing gel and the growth condition of the bacteria, and the method has the advantages of being easy to operate, not prone to being polluted by fungi, high in screening efficiency, high in accuracy rate and the like, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a culture device for screening inorganic phosphorus-dissolving bacteria and a screening method for inorganic phosphorus-dissolving bacteria. Background Art

[0002] Phosphorus (P) is a non-renewable macronutrient that plays an important role in plant growth and is widely used in agricultural production. However, P fixation in soil causes most of the soluble inorganic P to be rapidly converted into forms that are unusable by plants, which not only reduces the efficiency of P utilization but also may lead to excessive P accumulation in the soil.

[0003] Microorganisms play a key role in the biogeochemical cycle of phosphorus, especially inorganic phosphorus solubilizing bacteria (iPSBs), which can effectively release fixed inorganic phosphorus in the soil and convert it into a form that can be absorbed by plants. Therefore, screening and obtaining inorganic phosphorus solubilizing bacteria from soil is of great significance for improving the utilization efficiency of phosphorus in soil.

[0004] At present, the traditional method for screening inorganic phosphorus-dissolving bacteria is the petri dish method, which involves culturing bacteria on a culture medium containing inorganic phosphorus, observing and selecting bacteria that can dissolve inorganic phosphorus. However, this method requires multiple transfers, which is not only time-consuming and labor-intensive, but also easily affected by fungal contamination. It is difficult to screen a large number of effective strains in a short period of time, and has great limitations. Summary of the invention

[0005] The first purpose of the present invention is to provide a culture device for screening inorganic phosphorus-dissolving bacteria. The culture device can screen and obtain inorganic phosphorus-dissolving bacteria in a sample to be screened by only one inoculation, has the advantages of simple operation and short time, can screen a large number of effective strains in a short time, and has good application prospects.

[0006] The second object of the present invention is to provide a method for screening inorganic phosphorus-dissolving bacteria.

[0007] Specifically, the culture device for screening inorganic phosphorus-dissolving bacteria provided by the present invention includes a visual culture tube, which includes a culture part and a color development part that are interconnected, and the color development part is arranged below the culture part; the culture part is provided with a liquid culture medium for screening inorganic phosphorus-dissolving bacteria; the color development part is provided with a pH color development gel, the pH color development gel includes a bromocresol purple indicator, and the pore size of the pH color development gel is 1 to 200 nm.

[0008] Furthermore, the inorganic phosphorus-dissolving bacteria screening liquid culture medium includes 8-10 g / L of glucose, 0.8-1 g / L of hydroxyapatite, 0.3-0.5 g / L of ammonium sulfate, 0.1-0.2 g / L of sodium chloride, 0.1-0.2 g / L of potassium chloride, 0.05-0.1 g / L of magnesium sulfate, 0.001-0.002 g / L of manganese sulfate and 0.001-0.002 g / L of iron sulfate.

[0009] Furthermore, the pH value of the inorganic phosphorus-dissolving bacteria screening liquid culture medium is 7 to 7.5.

[0010] Furthermore, the preparation of the pH color developing gel includes: mixing agar and bromocresol purple indicator, heating and dissolving to obtain a gel solution; adding the gel solution into a visual culture tube, and cooling to obtain the pH color developing gel.

[0011] Furthermore, the added concentration of the agar is 2-3 wt%, and the added concentration of the bromocresol purple indicator is 5-15 μM.

[0012] Furthermore, based on the total height of the visible culture tube, the height of the culture part accounts for 25-50%, and the height of the color development part accounts for 25-50%.

[0013] Furthermore, the culture device also includes a frame, and the visible culture tube is arranged on the frame.

[0014] Furthermore, the visual culture tube further comprises a buffer portion, wherein the buffer portion is arranged in communication between the culture portion and the color development portion, and the buffer portion is provided with gel, and the pore size of the gel is 20 to 500 nm.

[0015] Furthermore, a separation paper is detachably provided between the culture part and the color development part, and the separation paper is used to temporarily isolate the contact between the inorganic phosphorus-dissolving bacteria screening liquid culture medium and the pH color development gel.

[0016] The method for screening inorganic phosphorus-dissolving bacteria provided by the present invention is to process samples to be screened using the above-mentioned culture device for screening inorganic phosphorus-dissolving bacteria.

[0017] Furthermore, the screening method specifically includes: taking the sample to be screened, processing it and adding it into the visual culture tube for screening and culturing; judging whether a positive visual culture tube containing inorganic phosphorus-dissolving bacteria is obtained according to the color change of the color developing part.

[0018] Furthermore, the screening culture is carried out at a temperature of 25 to 35° C. and for a time of 24 to 72 hours.

[0019] Furthermore, the conditions for judging that the visible culture tube is a tube positive for inorganic phosphorus-soluble bacteria include: (1) cells grow on the upper surface of the culture part and / or the color development part; (2) the color development part changes from purple to yellow.

[0020] Beneficial effects:

[0021] The culture device provided by the present invention comprises a visual culture tube with a special structure, which comprises a culture part and a color development part. The culture part contains an inorganic phosphorus-dissolving bacteria screening liquid culture medium to provide growth and reproduction space for bacteria; and the color development part is arranged below the culture part, and the pH color development gel arranged thereon can play the role of filtering and indicating at the same time, so that only the inorganic phosphorus-dissolving bacteria screening liquid culture medium and related acidic metabolites in the culture part can enter the interior of the pH color development gel under the action of gravity, and the bacteria are enriched on the upper surface of the culture part and / or the color development part. By observing the color change of the pH color development gel and the growth of bacteria, the inorganic phosphorus-dissolving bacteria strain with phosphorus-dissolving ability can be quickly and accurately screened out; the culture device has the advantages of simple operation, not being susceptible to fungal contamination, high screening efficiency and accuracy, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the structure of a culture device for screening inorganic phosphorus-dissolving bacteria provided in Example 1 of the present invention;

[0023] Figure 2 A schematic diagram of the structure of a culture tube of a culture device for screening inorganic phosphorus-dissolving bacteria provided in Example 1 of the present invention;

[0024] Figure 3 This is a schematic diagram of the structure of the culture tube of the culture device for screening inorganic phosphorus-dissolving bacteria provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0025] The culture device for screening inorganic phosphorus-dissolving bacteria provided by the present invention specifically includes a visual culture tube, which includes a culture part and a color development part that are interconnected, and the color development part is arranged below the culture part; the culture part is provided with a liquid culture medium for screening inorganic phosphorus-dissolving bacteria; and the color development part is provided with a pH color development gel.

[0026] In the present invention, the visual culture tube is a type of device for cell culture commonly used in the biological field, which is specifically configured to be a transparent material or has a visual window for observing the culture part and the color development part. Those skilled in the art can select the corresponding culture tube according to actual needs, and the present invention does not impose any special limitation on it.

[0027] In the present invention, the inorganic phosphorus-dissolving bacteria screening liquid culture medium refers to a culture medium used to cultivate and screen bacteria that can dissolve inorganic phosphorus. It uses inorganic phosphorus compounds as the only phosphorus source and is a type of culture medium conventionally used in inorganic phosphorus-dissolving bacteria screening. Technicians in this field can select corresponding culture tubes according to actual needs, and the present invention does not impose any special limitation on it.

[0028] In the present invention, the inorganic phosphorus-dissolving bacteria screening liquid culture medium preferably includes 8 to 10 g / L of glucose, such as 8 g / L, 8.3 g / L, 8.7 g / L, 9 g / L, 9.5 g / L, 10 g / L or any value therebetween; 0.8 to 1 g / L of hydroxyapatite, such as 0.8 g / L, 0.85 g / L, 0.9 g / L, 0.95 g / L, 1 g / L or any value therebetween; 0.3-0.5 g / L of ammonium sulfate, such as 0.3 g / L, 0.32 g / L, 0.36 g / L, 0.4 g / L, 0.45 g / L, 0.5 g / L or any value therebetween; 0.1-0.2 g / L of sodium chloride, such as 0.1 g / L, 0.11 g / L, 0.13 g / L, 0.15 g / L, 0.18 g / L, 0.2 g / L or any value therebetween; any value between; 0.1-0.2 g / L potassium chloride, such as 0.1 g / L, 0.13 g / L, 0.15 g / L, 0.17 g / L, 0.2 g / L or any value between them; 0.05-0.1 g / L magnesium sulfate, such as 0.05 g / L, 0.07 g / L, 0.09 g / L, 0.1 g / L or any value between them; 0.001-0.002 g / L L of manganese sulfate, such as 0.001g / L, 0.0012g / L, 0.0014g / L, 0.0018g / L, 0.002g / L or any value therebetween; 0.001-0.002g / L of iron sulfate, such as 0.001g / L, 0.0013g / L, 0.0015g / L, 0.0018g / L, 0.002g / L or any value therebetween. At this time, the inorganic phosphorus-dissolving bacteria screening liquid culture medium has better screening ability and can achieve more accurate screening of inorganic phosphorus-dissolving bacteria.

[0029] In the present invention, the pH value of the inorganic phosphorus-dissolving bacteria screening liquid culture medium is preferably 7 to 7.5, such as 7, 7.1, 7.2, 7.3, 7.4, 7.5 or any value therebetween. At this time, the inorganic phosphorus-dissolving bacteria have a relatively good growth state in the inorganic phosphorus-dissolving bacteria screening liquid culture medium, and will not interfere with the final color development judgment result.

[0030] In the present invention, the pH color gel refers to a gel including a bromocresol purple indicator, and its pore size is specifically 1 to 200 nm, such as 1 nm, 15 nm, 20 nm, 25 nm, 30 nm, 40 nm, 80 nm, 100 nm, 150 nm, 180 nm, 200 nm or any value therebetween. At this time, the pH color gel has a dense pore structure and has both cell filtration and indication functions.

[0031] In the present invention, the preparation of the pH color developing gel specifically includes: mixing agar and bromocresol purple indicator and heating to dissolve to obtain a gel solution; adding the gel solution into a visual culture tube and cooling to obtain the pH color developing gel.

[0032] In some specific embodiments, the concentration of agar added is preferably 2-3wt%, such as 2wt%, 2.1wt%, 2.3wt%, 2.5wt%, 2.8wt%, 3wt% or any value therebetween; the concentration of bromocresol purple indicator added is 5-15μM, such as 5μM, 5.8μM, 7μM, 9μM, 10μM, 13μM, 15μM or any value therebetween. At this time, the pH color gel contains a suitable concentration of bromocresol purple indicator, which can achieve a better color indication effect.

[0033] In the present invention, based on the total height of the visual culture tube, the height of the culture part preferably accounts for 25-50%, such as 25%, 28%, 30%, 33.33%, 38%, 40%, 45%, 50% or any value therebetween; the height of the color development part preferably accounts for 25-50%, such as 25%, 30%, 33.33%, 40%, 48%, 50% or any value therebetween. At this time, the oxygen and air flow space in the visual culture tube accounts for a small proportion, which can inhibit the growth and spread of fungal spores to a certain extent, thereby achieving the effect of reducing fungal contamination.

[0034] In the present invention, the culture device preferably further comprises a frame, and the visible culture tube is arranged on the frame. In this case, the frame is used to fix the visible culture tube, which can improve the convenience of operation during the screening of inorganic phosphorus-dissolving bacteria.

[0035] In the present invention, the visual culture tube preferably further includes a buffer portion, the buffer portion is arranged between the culture portion and the color development portion, the buffer portion is provided with a gel, and the pore size of the gel is preferably 20 to 500 nm, such as 20 nm, 25 nm, 30 nm, 50 nm, 80 nm, 100 nm, 200 nm, 300 nm, 500 nm or any value therebetween. At this time, the setting of the buffer portion allows the enrichment of bacteria to occur on the upper surface of the culture portion and / or the buffer portion, which can better realize the judgment of the color change of the pH color development gel and the growth of bacteria, and further improve the accuracy of screening.

[0036] In the present invention, a separation paper is preferably detachably provided between the culture part and the color development part. In this case, the separation paper is used to temporarily isolate the contact between the inorganic phosphorus-dissolving bacteria screening liquid culture medium and the pH color development gel. When in use, the separation paper can be removed and used, which can better meet the needs of screening a large number of effective strains in a short time.

[0037] Based on the excellent performance of the above-mentioned culture device, the present invention also provides a method for screening inorganic phosphorus-dissolving bacteria.

[0038] In the present invention, the screening method uses the above-mentioned culture device for screening inorganic phosphorus-dissolving bacteria to process the sample to be screened.

[0039] In the present invention, the screening method specifically includes: taking the sample to be screened, processing it and adding it into the visual culture tube for screening and culturing; judging whether a positive visual culture tube containing inorganic phosphorus-dissolving bacteria is obtained according to the color change of the color developing part.

[0040] In the present invention, the screening culture is a technical means conventionally used in the screening of existing inorganic phosphorus-dissolving bacteria. Those skilled in the art can make adaptive choices according to actual needs, and the present invention does not impose any particular limitation thereto.

[0041] In some specific embodiments, the screening culture conditions include a temperature of preferably 25 to 35°C, such as 25°C, 26°C, 27°C, 29°C, 30°C, 32°C, 34°C, 35°C or any value therebetween; and a time of 24 to 72 hours, such as 24, 28, 30, 36, 40, 48, 60, 72 or any value therebetween. At this time, the screening culture conditions are more suitable for the growth of inorganic phosphorus-dissolving bacteria and can achieve a better screening effect.

[0042] In the present invention, the conditions for judging that the visible culture tube is a tube positive for inorganic phosphorus-soluble bacteria specifically include: (1) cells grow on the upper surface of the culture part and / or the color development part (the upper surface of the buffer part); (2) the color development part changes from purple to yellow.

[0043] Although the present invention can be easily embodied in different forms of embodiments, only some of the specific embodiments are shown in the drawings and will be described in detail in this specification. It should be understood that this description should be regarded as an exemplary illustration of the principles of the invention and is not intended to limit the invention to that described herein.

[0044] Thus, a feature indicated in this specification will be used to illustrate one of the features of an embodiment of the present invention, rather than implying that each embodiment of the present invention must have the described feature. In addition, it should be noted that this specification describes many features. Although some features can be combined together to illustrate possible system designs, these features can also be used in other combinations that are not explicitly described. Thus, unless otherwise stated, the described combinations are not intended to be limiting.

[0045] In the embodiments shown in the drawings, the indications of directions (such as up, down, left, right, front and back) used to explain the structure and movement of various elements of the present invention are not absolute but relative. These descriptions are appropriate when these elements are in the positions shown in the drawings. If the description of the positions of these elements changes, the indications of these directions also change accordingly.

[0046] Embodiments of the present invention are described in detail below, and the examples of the embodiments are intended to be used to explain the present invention, but should not be construed as limiting the present invention. In the embodiments, if specific techniques or conditions are not specified, the techniques or conditions described in the literature in this area or the product specifications are used. If the manufacturer is not specified for reagents or instruments used, they are all conventional products that can be obtained commercially.

[0047] Preparation Example

[0048] This preparation example is used to illustrate the preparation of soil samples to be screened, which specifically includes:

[0049] (1) About 500 g of surface soil (depth 0-15 cm) was collected from farmlands near Hailun City, Heilongjiang Province (47'26"N, 126'38"E) and Yingtan City, Jiangxi Province (28'14"N, 116'54"E) in CONG, China, and then air-dried and sieved through a 0.2 mm sieve to obtain soil samples to be screened and stored at 4°C;

[0050] (2) The soil sample to be screened was mixed with water at an addition ratio of 1:2.5 (w / v) to prepare a suspension. The pH value of the suspension was measured using an XL60 pH meter, and the total phosphorus content in the suspension was measured using the molybdenum blue colorimetric method and the sodium bicarbonate extraction method. The results are shown in Table 1.

[0051] Table 1. pH and phosphorus content analysis of soil samples to be screened

[0052]

[0053] Example 1

[0054] This example is used to illustrate a culture device for screening inorganic phosphorus-dissolving bacteria and its preparation. Figure 1 A schematic diagram of the structure of the culture device provided in this embodiment, Figure 2 Schematic diagram of the structure of the culture tube in the culture device. Figure 1 and 2 The culture device includes a frame 1 and a plurality of culture tubes 2. The culture tubes 2 are movably mounted on the frame 1 and are made of transparent plastic. Along the vertical direction, the culture tubes 2 include a color development portion 21 and a culture portion 22 from bottom to top, and the color development portion 21 and the culture portion 22 each occupy 1 / 3 of the height of the culture tube 2.

[0055] The color development part 21 is filled with bromocresol purple agar gel with a pore size of about 50 nm. The culture part 22 is filled with an inorganic phosphorus-dissolving bacteria screening liquid culture medium, which includes 10 g / L of glucose, 1 g / L of hydroxyapatite, 0.5 g / L of ammonium sulfate, 0.2 g / L of sodium chloride, 0.2 g / L of potassium chloride, 0.1 g / L of magnesium sulfate, 0.002 g / L of monohydrated manganese sulfate and 0.002 g / L of heptahydrated iron sulfate, and the pH value is 7.0.

[0056] The preparation of the culture device provided in this embodiment specifically includes: (1) taking agar and a bromocresol purple indicator with a concentration of 10 μM in an amount of 3 wt % and heating them to dissolve, cooling to about 50° C. and then adding them to each culture tube 1 in a 96-well microplate to form a color development portion 21 occupying 1 / 3 of the total height of the culture tube 1; (2) after the color development portion 21 is completely solidified, adding an inorganic phosphorus-dissolving bacteria screening liquid culture medium to the culture tube 1 to form a culture portion 22 occupying 1 / 3 of the total height of the culture tube 1.

[0057] Example 2

[0058] The culture device for screening inorganic phosphorus-dissolving bacteria provided in this embodiment is basically the same as that in Example 1. Figure 3 The difference is that a buffer part 23 is provided between the color development part 21 and the culture part 22, and the buffer part 23 is filled with agar gel with a pore size of about 200 nm. The other structures are the same.

[0059] The preparation of the culture device provided in this embodiment specifically includes: (1) taking agar and a bromocresol purple indicator with a concentration of 10 μM at an addition amount of 3 wt %, heating and dissolving them, cooling to about 50° C. and adding them to each culture tube 1 in a 96-well microplate to form a color development part 21 occupying 1 / 3 of the total height of the culture tube; (2) after the color development part 21 is completely solidified, taking agar and water at an addition amount of 2 wt %, heating and dissolving them, cooling to about 50° C. and adding them to each culture tube 1 in a 96-well microplate to form a culture part 23 occupying 1 / 5 of the total height of the culture tube; (3) after the buffer part 23 is completely solidified, placing a piece of isolation paper on the buffer part (remove it when in use), and then adding inorganic phosphorus-dissolving bacteria screening liquid culture medium into the culture tube 1 to form a culture part 22 occupying 1 / 3 of the total height of the culture tube.

[0060] Example 3

[0061] This embodiment The culture device for screening inorganic phosphorus-dissolving bacteria provided in this embodiment is basically the same as that in Example 1, except that the inorganic phosphorus-dissolving bacteria screening liquid culture medium contained in the culture part 22 is different. The inorganic phosphorus-dissolving bacteria screening liquid culture medium provided in this embodiment specifically includes 8 g / L of glucose, 0.8 g / L of hydroxyapatite, 0.3 g / L of ammonium sulfate, 0.1 g / L of sodium chloride, 0.1 g / L of potassium chloride, 0.05 g / L of magnesium sulfate, 0.001 g / L of manganese sulfate monohydrate and 0.001 g / L of ferric sulfate heptahydrate, and the pH value = 7.5; the other structures are the same.

[0062] Example 4

[0063] This example is used to illustrate a method for screening inorganic phosphorus-dissolving bacteria, which specifically includes:

[0064] 1. Positive wells for inorganic phosphorus-soluble bacteria

[0065] (1) Take 1 g of the two soil samples to be screened provided in the preparation example and mix them with 100 mL of sterile water for homogenization, and then use sterile water to make a series of gradient dilutions (dilution degree is 10-10 5 ), and a series of soil suspensions were obtained.

[0066] (2) The soil suspension was added at an amount of 1 μL / well into the culture tubes of the culture devices provided in Examples 1 to 3, and the culture tubes were capped and placed in a shaker at 30°C for 72 h. The colony growth on the surface of the color developing portion 21 and the color change inside the color developing portion 21 were observed. If bacteria grew on the surface of the color developing portion 21 and the inside changed from purple to yellow, it was a positive well for inorganic phosphorus-dissolving bacteria.

[0067] 2. Identification of positive wells for inorganic phosphorus-dissolving bacteria

[0068] (1) The bacteria in each inorganic phosphate-solubilizing bacteria positive well were inoculated into a new inorganic phosphate-solubilizing bacteria liquid culture medium at an inoculation rate of 1%, and cultured in a shaking incubator at 30° C. for 24 h to obtain a seed solution.

[0069] (2) The genomic DNA of various sub-fluids was extracted using a bacterial genomic DNA kit (Merck, catalog number NA2110) according to the instructions.

[0070] (3) Using the genomic DNA of the various sub-liquids extracted as templates, PCR amplification was performed using universal bacterial primers 24F and 1492R to obtain PCR amplification products. The PCR reaction system included 1 μL of Premix Ex Taq Hot Start Version, 0.2 μmol of primer 24F, 0.2 μmol of primer 1492R, and 1 μL of DNA template, ddH 2 The PCR amplification program included 95°C for 4 minutes, each cycle included 95°C for 30 seconds, 58°C for 90 seconds, 72°C for 30 seconds, 30 cycles, and 72°C for 5 minutes.

[0071] The nucleotide sequence of primer 24F is: AGAGTTTGATCCTGGCTCAG;

[0072] The nucleotide sequence of primer 1492R is: TACGGYTACCTTGTTACGACTT.

[0073] (4) The PCR amplification product was purified using a DNA purification kit (Thermo Fisher Scientific, catalog number K310001) according to the instructions and sent to an external sequencing organization for sequencing.

[0074] The two soil samples to be screened provided in the preparation example were screened using the culture device provided in Example 1. A total of 74 culture tubes were positive for inorganic phosphorus-dissolving bacteria, and two culture tubes had bacterial growth but no color change as uncertain wells. The sequencing results of the strains in the above 76 culture tubes were compared with the bacterial lineage sequences in the GenBank database, and it was determined that all of them were inorganic phosphorus-dissolving bacteria, including 33 strains of Bacillus, 6 strains of Pseudomonas, 3 strains of Rhodococcus, 8 strains of Arthrobacter, 1 strain of Massilia, and 1 strain of Durum. The positive identification accuracy rate was as high as 100%.

[0075] The culture device provided in Example 2 was used to screen the two soil samples to be screened provided in the preparation example. A total of 79 culture tubes were positive for inorganic phosphorus-dissolving bacteria. Further sequencing and comparison with the gene database determined that all of them were inorganic phosphorus-dissolving bacteria, and the positive identification accuracy rate was as high as 100%.

[0076] The culture device provided in Example 3 was used to screen the two soil samples to be screened provided in the preparation example. A total of 83 culture tubes were positive for inorganic phosphorus-dissolving bacteria. Further sequencing and comparison with the gene database determined that all of them were inorganic phosphorus-dissolving bacteria, and the positive identification accuracy rate was as high as 100%.

[0077] That is, the culture devices provided in Examples 1 to 3 of the present invention can realize the rapid and accurate screening of inorganic phosphorus-solubilizing bacterial strains.

[0078] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

Claims

1. A culture device for screening inorganic phosphorus-dissolving bacteria, characterized in that: The culture device comprises a visible culture tube, which comprises a culture part and a color development part which are interconnected, and the color development part is arranged below the culture part; the culture part is provided with an inorganic phosphorus-dissolving bacteria screening liquid culture medium; the color development part is provided with a pH color development gel, the pH color development gel comprises a bromocresol purple indicator, and the pore size of the pH color development gel is 1 to 200 nm.

2. The culture device for screening inorganic phosphorus-dissolving bacteria according to claim 1, characterized in that: The inorganic phosphorus-dissolving bacteria screening liquid culture medium comprises 8-10 g / L of glucose, 0.8-1 g / L of hydroxyapatite, 0.3-0.5 g / L of ammonium sulfate, 0.1-0.2 g / L of sodium chloride, 0.1-0.2 g / L of potassium chloride, 0.05-0.1 g / L of magnesium sulfate, 0.001-0.002 g / L of manganese sulfate and 0.001-0.002 g / L of iron sulfate; Optionally, the pH value of the inorganic phosphorus-dissolving bacteria screening liquid culture medium is 7 to 7.

5.

3. The culture device for screening inorganic phosphorus-dissolving bacteria according to claim 1, characterized in that: The preparation of the pH color developing gel comprises: mixing agar with a bromocresol purple indicator and heating to dissolve to obtain a gel solution; adding the gel solution into a visual culture tube and cooling to obtain the pH color developing gel; Optionally, the agar is added at a concentration of 2 to 3 wt %, and the bromocresol purple indicator is added at a concentration of 5 to 15 μM.

4. The culture device for screening inorganic phosphorus-dissolving bacteria according to claim 1, characterized in that: Taking the total height of the visible culture tube as a reference, the height of the culture part accounts for 25-50%, and the height of the color development part accounts for 25-50%.

5. The culture device for screening inorganic phosphorus-dissolving bacteria according to claim 1, characterized in that: The culture device further comprises a frame, and the visible culture tube is arranged on the frame.

6. The culture device for screening inorganic phosphorus-dissolving bacteria according to claim 1, characterized in that: The visual culture tube further comprises a buffer part, which is arranged between the culture part and the color development part in communication, and the buffer part is provided with gel, and the pore size of the gel is 20-500nm.

7. The culture device for screening inorganic phosphorus-dissolving bacteria according to claim 1, characterized in that: An isolation paper is detachably arranged between the culture part and the color development part, and the isolation paper is used to temporarily isolate the contact between the inorganic phosphorus-dissolving bacteria screening liquid culture medium and the pH color development gel.

8. A method for screening inorganic phosphorus-dissolving bacteria, characterized in that: The screening method uses the culture device for screening inorganic phosphorus-dissolving bacteria described in any one of claims 1 to 7 to process the sample to be screened.

9. The method for screening inorganic phosphorus-dissolving bacteria according to claim 8, characterized in that: The screening method comprises: taking the sample to be screened, processing it and adding it into the visual culture tube for screening and culturing; judging that a positive tube of the visual culture tube containing inorganic phosphorus-dissolving bacteria is obtained according to the color change of the color developing part.

10. The method for screening inorganic phosphorus-dissolving bacteria according to claim 9, characterized in that: The screening culture temperature is 25-35°C and the time is 24-72h; Optionally, the conditions for judging that the visible culture tube is a tube positive for inorganic phosphorus-soluble bacteria include: (1) cells grow on the upper surface of the culture part and / or the color development part; (2) the color development part changes from purple to yellow.

Images