Split double-stranded DNA probe for CRISPR / Cas12a nonlinear signal amplification detection and composition and application thereof

Abstract

The invention belongs to the technical field of biochemical analysis, and particularly relates to a split double-stranded DNA probe for CRISPR / Cas12a nonlinear signal amplification detection as well as a composition and application of the split double-stranded DNA probe. The DNA double-stranded auxiliary probe comprises an annular structure and a PAM (Polyacrylamide) sequence which can be identified by crRNA-A; the composite probe comprises a magnetic bead and a DNA double-chain auxiliary probe; according to the diagnostic reagent, the composite probe is introduced on the basis of a traditional CRISPR / Cas12a detection system, a positive feedback signal amplification channel is constructed through introduction of a DNA double-chain auxiliary probe, and the sensitivity of the CRISPR / Cas12a system is improved; by introducing the magnetic beads, redundant DNA single chains are removed, the trans-cleavage efficiency is improved, and background signals are reduced. The scheme is expected to provide a new reference approach for development of a CRISPR / Cas12a detection system and direct detection of nucleic acid without amplification.

Description

Technical Field

[0001] The present invention belongs to the field of biochemical analysis technology. More specifically, it relates to a split double-stranded DNA probe for CRISPR / Cas12a nonlinear signal amplification detection and its composition and application. Background Art

[0002] The CRISPR / Cas12a system has the ability to recognize target sequences and trans-cut with high specificity, which makes CRISPR / Cas12a technology widely used and has good prospects in the field of molecular diagnosis. However, since the intensity of the trans-cutting activity of the Cas protein has not reached a sufficiently high level, the detection limit of the simple CRISPR / Cas12a detection system can only reach the 0.1nM level, which is far from meeting the current common detection needs. In order to achieve higher sensitivity and detection speed, a common idea is to pre-amplify the target nucleic acid, such as the "DETECTR" and "SHERLOCK" systems. However, the introduction of pre-amplification increases the complexity of detection, reduces the advantages of the CRISPR / Cas12a system, and increases the risk of aerosol contamination.

[0003] Therefore, it is very necessary to develop a method for direct detection of nucleic acid targets without amplification. According to the current research results, they can be roughly divided into the following strategies: 1. Amplifying signals through multiple enzyme cascade reactions or biochemical circuits. This strategy increases the complexity of the reaction, reaction time and detection cost by introducing more enzymes. 2. By reducing the reaction volume or electrochemical sensors to collect weak signals, this strategy has poor stability and low accuracy. 3. By hiding crRNA to construct a positive feedback pathway to amplify the signal, the RNA probe prepared by this strategy has poor stability and high cost.

[0004] Therefore, there is an urgent need to develop more efficient, simple, and stable amplification-free direct detection technology to fully unleash the advantages of CRISPR / Cas12a in the field of molecular diagnosis and meet the growing needs of precision medicine and disease diagnosis. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the existing CRISPR / Cas12a system, which needs to be further improved in detection sensitivity, and the existing amplification-free strategy, such as high complexity and poor stability, and provide a DNA double-stranded auxiliary probe.

[0006] Another object of the present invention is to provide a composite probe.

[0007] Another object of the present invention is to provide a diagnostic reagent based on CRISPR / Cas12a.

[0008] Another object of the present invention is to provide the use of the DNA double-stranded auxiliary probe, the composite probe, and the CRISPR / Cas12a-based diagnostic reagent in the preparation of a product for detecting a double-stranded DNA target.

[0009] Another object of the present invention is to provide a method for detecting double-stranded DNA targets not for the purpose of disease diagnosis.

[0010] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0011] The present invention protects a double-stranded DNA auxiliary probe, which comprises the nucleotide sequences shown in SEQ ID NO.5 (CCGGGAGCTCAGGTAAACATTTATTTCACAAACCTTGAAAGGGCC) and SEQ ID NO.12 (TCTGGTTGGGTGGGCCCTTTCAAGGTTTGTGTGTTTACCTGAGCTCCCGG).

[0012] The double-stranded DNA auxiliary probe is composed of a TS chain (SEQ ID NO.5) and a NTS chain (SEQ ID NO.12) that are complementary to each other, and contains a circular structure (TTTATTT) and a PAM (Protospacer Adjacent Motif) sequence that can be recognized by crRNA-A.

[0013] The present invention protects a composite probe, which comprises magnetic beads and probes modified on the surface of the magnetic beads, and the probes include the DNA double-stranded auxiliary probe.

[0014] There are many ways to modify the probe on the surface of magnetic beads, including covalent chemical connection, affinity ligand interaction, ionic or dipole interaction, and the use of specific linkers. These methods have their own advantages and disadvantages, and the appropriate method can be selected according to specific application requirements and experimental conditions.

[0015] Further, as an optional implementation, the magnetic beads are streptavidin magnetic beads.

[0016] Furthermore, the probe is modified on the surface of the magnetic beads by the action of biotin-streptavidin. As a more common connection method, the probe can be first labeled with biotin, and then connected and modified to the surface of the streptavidin magnetic beads through the specific action between biotin and streptavidin.

[0017] Furthermore, the biotin includes a biotin-TEG-linker (linker is a connecting agent) functionally modified with biotin, and the sequence of the biotin-TEG-linker functionally modified with biotin is: biotin-TEG-CACCCAACCAGA, wherein the nucleotide sequence involved in the linker is shown in SEQ ID NO.13 (CACCCAACCAGA).

[0018] Furthermore, the probe is modified with a fluorescent group.

[0019] Furthermore, the fluorescent group is a FAM fluorescent group.

[0020] Furthermore, the fluorescent group is modified on the nucleotide sequence shown in SEQ ID NO.5 of the DNA double-stranded auxiliary probe, and the sequence after the modification of the fluorescent group is as follows: CCGGGAGCTCAGGTAAACATTTA / i6FAMdT / TTCACAAACCTTGAAAGGGC C.

[0021] Furthermore, as an optional method, the composite probe is prepared by the following steps: incubating a biotin-labeled probe with streptavidin magnetic beads, modifying the probe on the surface of the magnetic beads through a biotin-streptavidin reaction, thereby obtaining the composite probe.

[0022] The present invention protects a CRISPR / Cas12a-based diagnostic reagent, which includes the DNA double-stranded auxiliary probe or the composite probe.

[0023] The above-mentioned diagnostic reagent based on CRISPR / Cas12a is based on the traditional CRISPR / Cas12a detection system, and introduces a composite probe comprising magnetic beads and double-stranded DNA auxiliary probes modified on the surface of the magnetic beads. The double-stranded DNA auxiliary probe in the composite probe is composed of complementary TS chains and NTS chains, and contains a ring structure and a PAM sequence that can be recognized by crRNA-A. A fluorescent group is modified on the ring structure of the double-stranded DNA auxiliary probe to generate a fluorescent signal. A sequence is extended from the 5' end of the NTS chain of the double-stranded DNA auxiliary probe, which can be complementary to another biotin-functionalized linker chain, and then the auxiliary probe is connected to the magnetic beads through the interaction of biotin-streptavidin, or the double-stranded DNA auxiliary probe can be connected to the magnetic beads in other ways.

[0024] When there is no target to be detected, the TS chain is divided into two sections by the ring structure, and there is a secondary structure, so it cannot be recognized by crRNA-A and cannot activate Cas12a; when there is a target to be detected, first the double-stranded DNA to be detected is recognized by crRNA-T, activating Cas12a, and the activated Cas12a shears the ring structure of the DNA double-stranded auxiliary probe by trans-cutting, on the one hand, releasing the fluorescent group, generating a fluorescent signal, on the other hand, the secondary structure of the DNA double-stranded auxiliary probe is destroyed, and the TS chain becomes two sections of split DNA, which can be recognized by crRNA-A, further activating Cas12a, forming positive feedback, and amplifying the fluorescent signal. In addition, the introduction of magnetic beads removes excess DNA single strands, improves the efficiency of trans-cutting, and further reduces the background signal.

[0025] Therefore, the present invention reduces the problem of excessive background signal in the existing CRISPR / Cas12a nonlinear amplification method by introducing a composite probe comprising magnetic beads and a double-stranded DNA auxiliary probe modified on the surface of the magnetic beads; a CRISPR / Cas12a positive feedback system is constructed by the composite probe to generate a nonlinear amplification process, thereby improving the sensitivity of the CRISPR / Cas12a detection method.

[0026] More importantly, the above-mentioned CRISPR / Cas12a-based diagnostic reagents are highly flexible and versatile. By specifically designing and replacing the nucleotide sequence of crRNA-T (used to identify specific DNA targets) in CRISPR / Cas12a, the diagnostic reagent can easily adapt to different types of double-stranded DNA target detection needs. This means that no matter what kind of double-stranded DNA target is faced, only the nucleotide sequence information of crRNA-T needs to be adjusted to achieve accurate detection of different DNA targets, which has significant advantages in the field of double-stranded DNA target detection.

[0027] Furthermore, the CRISPR / Cas12a-based diagnostic reagent also includes crRNA-A and crRNA-T;

[0028] The nucleotide sequence of the crRNA-A is shown in SEQ ID NO.10 (UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG). The crRNA-A is complementary to the nucleotide sequence shown in SEQ ID NO.5.

[0029] The crRNA-T is complementary to the target DNA.

[0030] Furthermore, the CRISPR / Cas12a-based diagnostic reagent also includes Cas12a protein.

[0031] Furthermore, the CRISPR / Cas12a-based diagnostic reagent also includes a buffer solution.

[0032] Furthermore, the buffer solution is preferably nebuffer.

[0033] When the object of detection is a DNA target of HPV6, the crRNA-T is as shown in SEQ ID NO.17: UAAUUUCUACUAAGUGUAGAUCCUUUACCCCAAUGCUCGCCC.

[0034] When the object of detection is a DNA target of HPV11, the crRNA-T is as shown in SEQ ID NO.18: UAAUUUCUACUAAGUGUAGAUAACAUUGUGUACCCUUACCC.

[0035] When the object of detection is a DNA target of HPV16, the crRNA-T is as shown in SEQ ID NO.19: UAAUUUCUAAGUGUAGAUATAGGAAAATAGGGATGTCCAAC.

[0036] When the object of detection is a DNA target of HPV18, the crRNA-T is as shown in SEQ ID NO.20: UAAUUUCUAAGUGUAGAUGGTCAGGTAACTGCACCCTAAAT.

[0037] The present invention also protects the use of the DNA double-stranded auxiliary probe, the composite probe, and the CRISPR / Cas12a-based diagnostic reagent in the preparation of a product for detecting a double-stranded DNA target.

[0038] Furthermore, the virus corresponding to the double-stranded DNA target includes HPV (human papillomavirus) virus.

[0039] The present invention also protects a method for detecting a double-stranded DNA target not for the purpose of disease diagnosis, using the DNA double-stranded auxiliary probe, the composite probe or the CRISPR / Cas12a-based diagnostic reagent.

[0040] Furthermore, the method comprises the following steps: mixing the CRISPR / Cas12a-based diagnostic reagent and the DNA sample to be tested, and performing fluorescence detection after the reaction is completed.

[0041] Furthermore, the CRISPR / Cas12a-based diagnostic reagent includes the composite probe, Cas12a protein, crRNA-A and crRNA-T.

[0042] Furthermore, the volume ratio of the composite probe to the mixture of Cas12a protein, crRNA-A and crRNA-T in the CRISPR / Cas12a-based diagnostic reagent is 1:(0.5-1.5), more preferably 1:(0.8-1.2).

[0043] Furthermore, the molar ratio of Cas12a protein, crRNA-A and crRNA-T in the CRISPR / Cas12a-based diagnostic reagent is 1:(0.25-3):(0.05-0.5), and more preferably 1:(1-2):(0.1-0.3).

[0044] Furthermore, the reaction conditions are incubation at 25-45° C. for 10-60 min under stirring and light-shielding conditions.

[0045] Furthermore, the parameters of the fluorescence detection are set according to the properties of the fluorescent group. For example, when the fluorescent group is a FAM fluorescent group, the setting parameters of the fluorescence detection are: setting the excitation wavelength to 485nm, the detection emission wavelength to 528nm, and the detection height to 7mm.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] The present invention discloses a double-stranded DNA auxiliary probe, a composite probe, and a diagnostic reagent based on CRISPR / Cas12a and its application, wherein the double-stranded DNA auxiliary probe is composed of a TS chain and an NTS chain complementary to each other, and comprises a ring structure and a PAM sequence that can be recognized by crRNA-A; the composite probe comprises magnetic beads and a double-stranded DNA auxiliary probe modified on the surface of the magnetic beads; the diagnostic reagent based on CRISPR / Cas12a is a composite probe introduced on the basis of a traditional CRISPR / Cas12a detection system, wherein the introduction of the double-stranded DNA auxiliary probe constructs a positive feedback signal amplification pathway, and improves the sensitivity of the CRISPR / Cas12a system; the introduction of magnetic beads removes redundant single-stranded DNA, improves the efficiency of trans-cutting, reduces the background signal, and has significant advantages in the field of double-stranded DNA target detection. The above scheme is expected to provide a new reference approach for the development of CRISPR / Cas12a detection systems and direct detection of nucleic acids without amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is a statistical diagram of the effect of inserting a ring structure at different positions on the TS chain in the auxiliary probe on the background signal.

[0049] Figure 2It is a schematic diagram of the scheme of the CRISPR / Cas12a nonlinear signal amplification detection system of the present invention, wherein Sample represents sample, Extract represents extraction, Target DNA represents target DNA, assistant probe represents auxiliary probe, streptavidin-coated magnetic beads represents streptavidin magnetic beads, Cleavage site represents cleavage site, and One-pot assay represents one-pot assay.

[0050] Figure 3 This is a statistical diagram of the sensitivity verification results of the CRISPR / Cas12a nonlinear signal amplification detection system of the present invention.

[0051] Figure 4 This is a statistical chart showing the sensitivity verification results of traditional CRISPR / Cas12a.

[0052] Figure 5 This is a comparison chart of fluorescence signals specific to HPV virus DNA of different types detected by the CRISPR / Cas12a nonlinear signal amplification detection system of the present invention. DETAILED DESCRIPTION

[0053] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0054] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0055] The materials and equipment used in the embodiments are as follows:

[0056] Experimental Materials

[0057] The oligonucleotide chains purified by HAP (High Affinity Purification), DEPC-treated water, TM buffer solution, TE buffer solution, 1 M Tris-HCl solution (pH 7.5), 0.5 M EDTA solution, 2 M NaCl solution, and Tween-20 were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.

[0058] LbaCas12a protein and 10×nebuffer2.1 were purchased from NewEnglandBiolabs (Beijing) Co., Ltd.;

[0059] 5 μm streptavidin magnetic beads were purchased from Beaver Biotechnology (Suzhou, China), hereinafter referred to as magnetic beads;

[0060] qPCR 96-well white plate was purchased from Gunster Biotech (Taiwan, China);

[0061] All chemical reagents were of analytical grade and used directly without further purification;

[0062] All aqueous solutions were prepared using ultrapure water;

[0063] The multifunctional microplate reader Synergy H1 was purchased from BioTek (USA).

[0064] Buffer 1 buffer solution: 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 M NaCl, 0.01%~0.1% Tween-20.

[0065] TS (CCGGGAGCTCAGGTAAACATTTA / i6FAMdT / TTCACAAACCTTGAAAGGGCC) is TS+10 (SEQ ID NO. 5) modified with a fluorescent group.

[0066] Biotin-TEG-linker is a linker modified with biotin (SEQ ID NO. 13).

[0067] FAM-reporter-BHQ1 is a reporter modified with a fluorescent dye (FAM) and a quencher (BHQ1) (SEQ ID NO. 16).

[0068] Example 1 Screening of TS sequences in auxiliary probes

[0069] (1) Assembly of different auxiliary probes:

[0070] Add TS+2 (1.2 μL 100uM), TS+4 (1.2 μL 100uM), TS+6 (1.2 μL 100uM), TS+8 (1.2 μL 100uM), TS+10 (1.2 μL 100uM), TS+12 (1.2 μL 100uM), TS+14 (1.2 μL 100uM), TS+16 (1.2 μL 100uM), and TS+18 (1.2 μL 100uM) shown in Table 1 to enzyme-free EP tubes respectively, add NTS (1 μL 100uM) shown in Table 2 to each EP tube, add TM buffer solution to 10 μL, mix the above system, and the reaction procedure is to heat at 95°C for 5 min, slowly cool to room temperature, react at 25°C for 1 h, and refrigerate for use after the reaction.

[0071] (2) Construction of auxiliary probe-magnetic beads

[0072] Place the magnetic beads on a vortex oscillator for 20 seconds and vortex to resuspend the magnetic beads. Use a pipette to take 10 μL of magnetic beads into an enzyme-free EP tube, place the EP tube on a magnetic separator, let it stand for 1 minute, use a pipette to remove the supernatant, and remove the EP tube from the magnetic separator. Add 100 μL of buffer 1 buffer solution, vortex to resuspend the magnetic beads, place the EP tube on a magnetic separator, let it stand for 1 minute, use a pipette to remove the supernatant, and remove the EP tube from the magnetic separator. Repeat 3 times.

[0073] Take biotin-TEG-linker (1μL 100uM) in an enzyme-free EP tube, add buffer 1 to 100μL, shake thoroughly, add to the washed magnetic beads, and shake thoroughly to resuspend the magnetic beads. Place the EP tube on a rotating mixer and rotate and mix at room temperature for 30 minutes. Place the EP tube on a magnetic separator, let it stand for 1 minute, use a pipette to remove the supernatant, and remove the EP tube from the magnetic separator. Add 100μL TM buffer solution, shake thoroughly to resuspend the magnetic beads, place the EP tube on a magnetic separator, let it stand for 1 minute, use a pipette to remove the supernatant, and remove the EP tube from the magnetic separator. Repeat 3 times to obtain magnetic beads connected to biotin-TEG-linker.

[0074] Take 5 μL of the assembled different auxiliary probes in an enzyme-free EP tube, add TM buffer solution to 100 μL, shake thoroughly, add to the magnetic beads connected to biotin-TEG-linker, shake thoroughly to resuspend the magnetic beads. Place the EP tube on a rotating mixer and rotate and mix at room temperature for 2 hours.

[0075] Place the EP tube on a magnetic separator, let it stand for 1 minute, remove the supernatant with a pipette, and remove the EP tube from the magnetic separator. Add 100 μL of TM buffer solution, place the EP tube on a magnetic separator, let it stand for 1 minute, remove the supernatant with a pipette, and remove the EP tube from the magnetic separator. Repeat 3 times to obtain the auxiliary probe-magnetic beads. The auxiliary probe is modified to the surface of the magnetic beads through the specific interaction between biotin and streptavidin. Add 10 μL of ultrapure water and refrigerate for later use.

[0076] (3) Detection of background signals by CRISPR / Cas12a systems constructed with different auxiliary probes

[0077] Cas12a (2 μL 5uM), crRNA-A (1 μL 9uM), crRNA-T (1 μL 1uM) were incubated at 37 ° C for 30 min to obtain a mixture of cas12a and crRNA. A mixture of 2 μL cas12a and crRNA, 10 × nebuffer2.1 (2 μL), auxiliary probe-magnetic beads (2 μL), FAM-reporter-BHQ1 (2 μL 10uM, reporter has modified fluorescent groups and quenching groups at both ends, which are released after being cut by cas12a to generate fluorescent signals), and ultrapure water is added to 20 μL. The EP tube is placed on a rotating mixer and incubated for 30 min in dark rotation at 37 ° C. The EP tube is placed on a magnetic separator, left to stand for 1 min, and the supernatant is taken with a pipette to obtain a fluorescence detection system. The above reaction solution is transferred to a 96-well plate and measured using a multifunctional microplate reader. Set parameters: set the excitation wavelength to 485nm, the detection emission wavelength to 528nm, and the detection height to 7mm; click Detect to obtain the fluorescence signal value.

[0078] Table 1 Nucleotide sequences of different TS

[0079]

[0080]

[0081] Table 2 Other nucleotide sequences

[0082]

[0083] The results are as follows Figure 1 As shown, the insertion of the ring structure into different positions of the TS chain has a greater impact on the background signal. Among them, when the ring structure is inserted into the center of the TS, that is, the TS+10 group, the auxiliary probe assembled by TS+10 and NTS has the lowest impact on the background signal. This is because the secondary structure formed when the ring structure is located in the center is the most stable, and the stability of binding to the crRNA / Cas12a complex is the worst, which means that when there is no target DNA, the auxiliary probe assembled by TS+10 and NTS is difficult to bind to / Cas12a and activate the protein, reducing the generation of background signals. Therefore, the auxiliary probe assembled by TS+10 and NTS was selected for further exploration.

[0084] Example 2 Verification of the sensitivity of the CRISPR / Cas12a nonlinear signal amplification detection system

[0085] This embodiment sets up a series of experimental groups, and uses the CRISPR / Cas12a nonlinear signal amplification detection system assisted by split double-stranded DNA probe in the present invention to detect double-stranded DNA targets.

[0086] The auxiliary probe-magnetic beads were constructed according to the method of Example 1.

[0087] Detection of CRISPR / Cas12a nonlinear signal amplification detection system: Cas12a (2μL 5uM), crRNA-A (1μL 9uM), crRNA-T (1μL 1uM) were incubated at 37°C for 30min. Add 2μL of a mixture of cas12a and crRNA, 10×nebuffer2.1 (2μL), auxiliary probe-magnetic beads (2μL), DNA target (DNA target assembled from Target1 and Target2 shown in Table 2, 2μL; the concentrations of DNA targets in different groups were 10nM, 1nM, 100pM, 10pM, 1pM, 100fM, 10fM, 1fM), and add ultrapure water to 20μL. Place the EP tube on a rotating mixer and incubate in dark at 37°C for 30min. Place the EP tube on a magnetic separator, let stand for 1min, take the supernatant with a pipette, and obtain a fluorescence detection system. The reaction solution was transferred to a 96-well plate and measured using a multifunctional microplate reader.

[0088] Detection of traditional CRISPR / Cas12a system: Cas12a (2μL 5uM), crRNA-A (1μL 9uM), crRNA-T (1μL 1uM) were incubated at 37°C for 30min. Add 2μL of a mixture of cas12a and crRNA, 10×nebuffer2.1 (2μL), DNA target (2μL different groups with concentrations of 10nM, 1nM, 100pM, 10pM, 1pM, 100fM, 10fM, 1fM) and FAM-reporter-BHQ1 (2μL 10uM) to an enzyme-free EP tube, and add ultrapure water to 20μL. Place the EP tube on a rotating mixer and incubate in dark at 37°C for 30min. Transfer the above reaction solution to a 96-well plate and measure using a multifunctional microplate reader.

[0089] Detection principle of the CRISPR / Cas12a nonlinear signal amplification detection system of the present invention Figure 2As shown, an auxiliary DNA probe is introduced on the basis of the traditional CRISPR / Cas12a detection platform. The auxiliary probe is composed of a TS chain and an NTS chain complementary to each other, and contains a ring structure and a PAM sequence that can be recognized by crRNA-A. A FAM group is modified on the ring structure of the auxiliary probe to generate a fluorescent signal. A sequence is extended from the 5' end of the NTS chain of the auxiliary probe, which can be complementary to another biotin-TEG-linker chain functionalized with biotin, and then the auxiliary probe is connected to the magnetic beads through the interaction of biotin-streptavidin.

[0090] When there is no target to be detected, the TS chain is divided into two sections by the ring structure, and there is a secondary structure, so it cannot be recognized by crRNA-A and cannot activate Cas12a; when there is a target to be detected, first the double-stranded DNA to be detected is recognized by crRNA-T, activating Cas12a, and the activated Cas12a shears the ring structure of the auxiliary probe through trans-cutting, on the one hand, releasing FAM, generating a fluorescent signal, on the other hand, the secondary structure of the auxiliary probe is destroyed, and the TS chain becomes two sections of split DNA, which can be recognized by crRNA-A, further activating Cas12a, forming positive feedback, and amplifying the fluorescent signal. In addition, the introduction of magnetic beads removes excess DNA single strands, improves the efficiency of trans-cutting, and further reduces the background signal.

[0091] Therefore, the present invention removes the redundant DNA single strands in the auxiliary probe assembly process through the design of split auxiliary probes and the introduction of magnetic beads, thereby reducing the problem of excessive background signal in the existing CRISPR / Cas12a nonlinear amplification method; constructs a CRISPR / Cas12a positive feedback system through auxiliary probes, generates a nonlinear amplification process, and improves the sensitivity of the CRISPR / Cas12a detection method.

[0092] The test results containing auxiliary probe-magnetic beads are as follows Figure 3 As shown in Figure 2, the CRISPR / Cas12a nonlinear signal amplification detection system based on the split double-stranded DNA probe assisted by the present invention can detect a double-stranded DNA target of at least 100aM, which is significantly lower than the traditional CRISPR / Cas12a detection system ( Figure 4 ), the sensitivity of the present invention has significant advantages.

[0093] Example 3 Verification of the specificity of the CRISPR / Cas12a nonlinear signal amplification detection system

[0094] In order to verify the specificity of the CRISPR / Cas12a nonlinear signal amplification detection system assisted by split double-stranded DNA probes for HPV (human papillomavirus) typing detection in the present embodiment, a series of control groups are set to measure the fluorescence signal intensity produced by different HPV subtypes and different crRNAs. The determination method is referred to Example 2, wherein the DNA target is a DNA target corresponding to different HPV subtypes, and when different HPV subtypes are detected, the corresponding crRNA-T 1 is as shown in Table 3, and other steps and parameters remain unchanged.

[0095] Selection of DNA targets: In this example, DNA fragments corresponding to different HPV subtypes were specifically selected as targets in the experiment, and the parameters used for the targets were 2 μL 10 nM.

[0096] Adjustment of crRNA-T: The nucleotide sequence of crRNA-T was adjusted for each HPV subtype (as shown in Table 3).

[0097] Other experimental steps and parameters are the same as those in Example 2.

[0098] Table 3 Nucleotide sequences of different HPV subtypes

[0099]

[0100]

[0101] The results are as follows Figure 5 As shown, in the combination of multiple HPV subtypes and crRNA, only when the HPV subtype and the crRNA designed for the subtype can produce obvious fluorescent signals, the HPV DNA of other combinations cannot be recognized by crRNA, Cas12a cannot be activated, and significant fluorescent signals cannot be produced. Thus, it is shown that the CRISPR / Cas12a nonlinear signal amplification detection system based on the split double-stranded DNA probe auxiliary of the present invention has good specificity and can be used for HPV typing detection.

[0102] In summary, the CRISPR / Cas12a nonlinear signal amplification detection system based on the auxiliary split double-stranded DNA probe constructed by the present invention, on the basis of the traditional CRISPR / Cas12a detection system, introduces a split double-stranded DNA auxiliary probe, the auxiliary probe includes a PAM sequence and a ring structure that can be recognized by crRNA, and the ring structure can suppress the activation of the auxiliary probe to Cas12a before being cut, and can promote the activation of the auxiliary probe Cas12a after being cut. That is, the present invention constructs a CRISPR / Cas12a positive feedback system by an auxiliary probe, produces a nonlinear amplification process, and improves the sensitivity of the CRISPR / Cas12a detection method. In addition, the introduction of magnetic beads removes redundant DNA single strands, improves the trans-cutting efficiency, further reduces the background signal, and improves the accuracy of the detection of the target object. More importantly, the present invention is based on the CRISPR / Cas12a nonlinear signal amplification detection system assisted by split double-stranded DNA probes and has a high degree of flexibility and versatility. By specifically designing and replacing the nucleotide sequence of crRNA-T (used to identify specific DNA targets) in CRISPR / Cas12a, the system can easily adapt to different types of double-stranded DNA target detection needs. This means that no matter what kind of double-stranded DNA target is faced, it only needs to adjust the nucleotide sequence information of crRNA-T to achieve accurate detection of different DNA targets, which has significant advantages in the field of double-stranded DNA target detection.

[0103] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A DNA double-stranded auxiliary probe, characterized in that: The DNA double-stranded auxiliary probe comprises the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.

12.

2. A composite probe, characterized in that: The composite probe comprises magnetic beads and probes modified on the surface of the magnetic beads, and the probes include the DNA double-stranded auxiliary probe according to claim 1.

3. The composite probe according to claim 2, characterized in that: The magnetic beads are streptavidin magnetic beads.

4. The composite probe according to claim 3, characterized in that: The probe is modified on the surface of the magnetic bead through the action of biotin-streptavidin.

5. The composite probe according to any one of claims 2 to 4, characterized in that: The probe is modified with a fluorescent group.

6. A diagnostic reagent based on CRISPR / Cas12a, characterized in that The CRISPR / Cas12a-based diagnostic reagent includes the double-stranded DNA auxiliary probe according to claim 1 or the composite probe according to any one of claims 2 to 5.

7. The CRISPR / Cas12a-based diagnostic reagent according to claim 6, characterized in that The CRISPR / Cas12a-based diagnostic reagent also includes crRNA-A and crRNA-T; Wherein, the nucleotide sequence of crRNA-A is shown in SEQ ID NO.10; The crRNA-T is complementary to the target DNA.

8. The CRISPR / Cas12a-based diagnostic reagent according to claim 6 or 7, characterized in that The CRISPR / Cas12a-based diagnostic reagent also includes Cas12a protein.

9. Use of the double-stranded DNA auxiliary probe according to claim 1, the composite probe according to any one of claims 2 to 5, and the CRISPR / Cas12a-based diagnostic reagent according to any one of claims 6 to 8 in the preparation of a product for detecting a double-stranded DNA target.

10. A method for detecting a double-stranded DNA target not for the purpose of disease diagnosis, characterized in that: A double-stranded DNA auxiliary probe as described in claim 1, a composite probe as described in any one of claims 2 to 5, or a CRISPR / Cas12a-based diagnostic reagent as described in any one of claims 6 to 8 is used.

Images