Molecular element high-throughput mining method for stress response of microorganisms to toxic degradation-resistant organic pollutants and application of molecular element high-throughput mining method

Abstract

The invention discloses a molecular element high-throughput mining method for stress response of microorganisms to toxic degradation-resistant organic pollutants and an application of the molecular element high-throughput mining method. According to the invention, the optimized method is utilized to carry out high-throughput excavation on molecular elements of microorganisms responding to the stress of the toxic and nondegradable organic pollutants, and important functional elements obtained by excavation are applied to monitoring of the toxic and nondegradable organic pollutants and transformation of chassis cells of a treatment technology.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a high-throughput mining method and application of molecular components of microbial stress response to toxic and difficult-to-degrade organic pollutants. Background Art

[0002] With the rapid development of the economy and society, the types of toxic and difficult-to-degrade organic pollutants in the environment are increasing, which seriously threatens the ecological environment and human health. It is urgent to establish new and efficient technologies for the prevention and control of toxic and difficult-to-degrade organic pollutants. Microorganisms have many enzyme systems and regulatory networks that can efficiently respond to external nutrients or toxic substances, thereby effectively taking in, excreting, metabolizing or transforming them. Based on the molecular elements of microbial response to environmental pollution stress, the monitoring and control of toxic pollutants have been applied, and a large number of successful cases have been reported. For example, the efficient degradation and removal of toxic pollutants by microbial decomposition and metabolism elements, and the accurate identification and monitoring of toxic pollutants by microbial transcriptional regulatory elements. Although some studies have reported that a few microorganisms have certain degradation functions for toxic and difficult-to-degrade organic pollutants, the relevant microbial resources are still extremely scarce, and the molecular elements of microbial response to the stress of toxic and difficult-to-degrade organic pollutants are rarely reported, which seriously limits the innovation and development of green and efficient prevention and control technologies for toxic and difficult-to-degrade organic pollutants.

[0003] In the process of microbial response to environmental pollution stress, the promoter acts as a "switch" for gene expression regulation, regulating the transcription start time and expression level of different genes by binding to transcription factors. The interaction between transcription factors and promoters is one of the key mechanisms for microorganisms to respond to environmental pollution stress and regulate gene expression. Due to the lack of simple and efficient methods, many regulatory elements of microbial response to environmental pollution stress have not been effectively explored and utilized. In view of this technical difficulty, the patentee invented and authorized the patent "A method for screening and identifying stress-responsive gene expression regulatory factors (ZL202010699515.0)" to effectively explore the molecular elements of microbial response to environmental pollution stress. However, in actual application, this method still has certain problems in terms of cost, time consumption, versatility, and data acquisition. In view of this, the present invention further optimizes the screening and identification method of molecular elements of microbial response to environmental pollution stress by adopting processes such as changing screening markers, replacing host vectors, optimizing protein-DNA binding amplification and screening steps, and introducing DNA high-throughput sequencing technology. The optimized method is used to perform high-throughput mining of molecular elements of microbial response to toxic and difficult-to-degrade organic pollutants, and the important functional elements mined are applied to the transformation of chassis cells for monitoring and treatment of toxic and difficult-to-degrade organic pollutants. Summary of the invention

[0004] The purpose of the present invention is to provide an optimized high-throughput screening and identification method for molecular elements of microbial response to environmental pollution stress in view of the shortcomings of existing element mining technology and the lack of responsive elements to toxic and recalcitrant organic pollutants. The optimized method is used to perform high-throughput mining on molecular elements of microbial response to toxic and recalcitrant organic pollutants, and the important functional elements mined are applied to the transformation of chassis cells for toxic and recalcitrant organic pollutant monitoring and control technology.

[0005] The high-throughput mining method and application of molecular elements of microbial response to toxic and refractory organic pollutants of the present invention comprises the following steps:

[0006] a. Extract genomic DNA of cells to be screened and identified, and then digest with restriction endonuclease Mnli, add 5'Mix and 3'Mix adapters to the digested DNA fragments, so that adapter sequences are added to both ends of the Mnli digestion product, and use a forward primer H1-F containing a HindIII restriction site and a portion of the homology arm sequence near the corresponding restriction site of pBBR1MCS-5 and a reverse primer X1-R containing a portion of the homology arm sequence near the corresponding restriction site of pBBR1MCS-5, and amplify the connection product of the Mnli digestion product plus the adapter by PCR, and the PCR product is recovered and purified to obtain a genomic DNA library with an adapter;

[0007] b. The cells to be screened and identified are stressed with pollutants, and the cells without pollutants are used as controls. Then, the stress response protein is extracted, and the response protein solution is combined with the genomic DNA library. After the protein and DNA are fully bound, the sample is loaded onto a pre-cleaned nitrocellulose membrane filter column, centrifuged and the effluent is discarded, and the cells are washed with a filter washing buffer for multiple times, and the response protein-bound DNA fragments are eluted with an elution buffer;

[0008] c. Insert the kanamycin resistance gene with promoter and the multiple cloning site into the pBBR1MCS-5 plasmid DNA, and then insert the response protein binding DNA fragment into the pBBR1MCS-5 plasmid DNA, and then homologously recombinant into the cells to be screened and identified, and screened with kanamycin. Extract the genomic DNA of the positive clones obtained by screening, and perform high-throughput sequencing to obtain the environmental pollution stress response protein binding DNA fragment in the recombinant plasmid.

[0009] Preferably, the cell to be screened and identified is Sphingobium xenophagum C1.

[0010] The present invention also provides an efflux protein pump gene cluster consisting of AcrA, AcrB, TolC and AdaB. The encoding nucleotide sequences of AcrA, AcB, TolC and AdaB are shown in SEQ ID NO.2 to NO.5 respectively.

[0011] The present invention also provides the use of the efflux protein pump gene cluster composed of AcrA, AcrB, TolC and AdaB in improving the strain's tolerance to TBBPA.

[0012] The present invention also provides a ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein, whose encoding nucleotide sequence is shown in SEQ ID NO.21.

[0013] The present invention also provides the use of the above-mentioned ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein in degrading TBBPA.

[0014] Preferably, the gene encoding the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein is introduced into the engineered bacteria, and the engineered bacteria produces the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein for degrading TBBPA.

[0015] Preferably, the engineered bacteria is Escherichia coli.

[0016] The present invention also provides a xenobiotic-responsive transcription factor chr1_2605, whose nucleotide sequence is shown in SEQ ID NO.22.

[0017] The present invention also provides application of xenobiotic response transcription factor chr1_2605 in monitoring TBBPA pollution.

[0018] The screening and identification technology of the molecular elements of microbial response to environmental pollution stress after optimization of the present invention has been significantly improved in terms of cost, time consumption, versatility, and data acquisition compared with the original patented technology. First, the screening marker was changed from the luciferase activity detection before optimization to the antibiotic resistance screening, which greatly reduced the expensive cost of using the substrate luciferin to detect the signal. Secondly, the screening step was changed to two rounds of antibiotic resistance screening, which greatly reduced the false negatives caused by the round of antibiotic resistance screening before optimization and the huge workload of random strain selection verification. Furthermore, the operating vector was changed from pACYC-Luc before optimization to the wide host vector pBBR1MCS-5, which can adapt to most host strains other than Escherichia coli and has higher versatility in screening the molecular elements of environmental strains. Finally, by merging all positive clones for DNA high-throughput sequencing analysis, the workload was greatly reduced compared with the method of random strain selection verification sequencing before optimization, and the data acquisition was significantly improved.

[0019] The optimized method was used to conduct high-throughput mining and analysis of the molecular elements of microbial response to toxic and recalcitrant organic pollutants, and a number of molecular elements mainly involved in the efflux or ingestion of toxic and recalcitrant organic pollutants, the toxic response of toxic and recalcitrant organic pollutants, the nonspecific detoxification of toxic and recalcitrant organic pollutants, the specific degradation of toxic and recalcitrant organic pollutants, and some unknown functional processes were obtained. The important functional elements include: ① Molecular elements of the efflux protein system: chr1_112~chr1_119 gene clusters, which are acrR, acrA, acrB, tolC, adaB, fabG, modC and modB genes, involving the AcrAB-TolC efflux protein pump and molybdate transport system; chr1_1648~chr1_1650 gene clusters, which are pitA, ykaA and lysR genes, involving the phosphate / sulfate transport system. ②Transcriptional regulation and degradation molecular elements: chr1_2604~chr1_2605 operons, encoding ketoglutarate / Fe-dependent dioxygenase with COG4340 conserved domain and xenobiotic response transcription factor with COG3800 conserved domain; p2_166~p2_168 gene clusters, encoding hypothetical proteins hp2 and hp3 and mucR transcriptional regulatory factors. ③Detoxification or toxicity response molecular elements: chr1_709~chr1_713 gene clusters, including gstA, nrdA, hp1, nrdB and ulaG genes, involving cellular detoxification processes involving glutathione S-transferase and DNA replication / recombination / repair, etc.; chr1_2603, is the lpd gene, involving glutathione disulfide reductase; chr1_1993~chr1_1995 gene clusters, including nlpD, iscA and xthA genes. Participates in cell wall / cell membrane synthesis, Fe-S cluster biosynthesis, and exonuclease-mediated DNA replication / recombination / repair processes, etc.

[0020] ①Based on the AcrAB-TolC efflux protein pump elements chr1_118~chr1_115 and the broad host vector pBBR1MCS-5, a highly tolerant artificial cell system Sphingobium xenophagum C1 (pBBR-118-115) for toxic and difficult to degrade organic pollutants was constructed. It was confirmed that increasing the copy number of the AcrAB-TolC efflux protein pump can improve the strain's tolerance to the stress of toxic and difficult to degrade organic pollutants, providing a new type of highly tolerant molecular element for the development of bioaugmentation technology for high-concentration toxic and difficult to degrade organic pollutants in the environment. ②Based on the ketoglutarate / Fe-dependent dioxygenase element chr1_2604 and the expression vector pET30b, an artificial cell system E.coli BL21 (DE3, pET30b-2604) for the degradation of toxic and difficult to degrade organic pollutants was constructed. It was confirmed that the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein was induced to express in large quantities and accumulated in advance in chassis cells, which had a strong oxidative degradation ability for toxic and difficult-to-degrade organic pollutants, and provided a new type of molecular element for the development of bio-enhanced treatment technology for toxic and difficult-to-degrade organic pollutants in the environment. ③ Based on the xenobiotic response transcription factor element chr1_2605 and the broad host vector pBBR1MCS-5, the typical toxic and difficult-to-degrade organic pollutant tetrabromobisphenol A (TBBPA) pollution monitoring sensor cell Sphingobium xenophagumC1 (pBBR-2605-HiBiT) was constructed. Among the experimental test concentrations of TBBPA, the maximum luciferase signal was obtained by induction of 7.0μM TBBPA pollution stress, and the minimum detection limit was between 0.01 and 0.05μM. The feasibility of xenobiotic-responsive transcription factor elements in responding to the stress of toxic and recalcitrant organic pollutants was confirmed, providing a new type of molecular element for the development of biological monitoring technology for toxic and recalcitrant organic pollutants in the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : Flowchart of the optimized screening and identification technology for molecular elements that respond to environmental pollution stress in microorganisms.

[0022] Figure 2 : Changes in the abundance of different amplicon sequence variants (ASVs) in microorganisms in response to TBBPA pollution stress.

[0023] Figure 3 : Information on important functional gene clusters that are significantly differentially induced in microbial responses to TBBPA pollution stress.

[0024] Figure 4 : Growth of highly tolerant artificial cells constructed based on efflux protein pump elements under different concentrations of TBBPA pollution stress.

[0025] Figure 5 : Degradation of different concentrations of TBBPA by the degradation artificial cells constructed based on dioxygenase elements.

[0026] Figure 6 : Fluorescence response of pollution monitoring sensor cells constructed based on xenobiotic-responsive transcription factor elements to different concentrations of TBBPA. DETAILED DESCRIPTION

[0027] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0028] Example 1: Optimization of the screening and identification methods of molecular elements that mediate microbial responses to environmental pollution stress.

[0029] 1. Construction of genomic DNA library

[0030] (1) Extraction and enzyme digestion of genomic DNA

[0031] The xenophagous sphingobium Sphingobium xenophagum C1 (see Int J Syst Evol Microbiol. 2016, 66 (10): 3912-3916; Int J Syst Evol Microbiol. 2019, 69 (7): 2161-2165., which the applicant also holds and guarantees to provide to the public within 20 years from the date of application) was inoculated into 5 mL of LB medium (each liter of the medium contains 10.0 g of peptone, 5.0 g of yeast extract, and 5.0 g of NaCl, and the solvent is water; the preparation method is to dissolve each component in water and sterilize it), cultured overnight at 30°C, and the cells were collected by centrifugation at room temperature. The whole genome DNA of strain C1 was extracted using a bacterial genome extraction kit. The genome of strain C1 was digested with Mnli restriction endonuclease (cutting site: 5'...CCTC(N)7...3') at 37°C for 1 h, resulting in a base (N) bulge at the 3' end of the digested DNA fragment.

[0032] (2) Preparation of DNA linkers

[0033] Design and synthesize adapter primers containing partial homology arm sequences near the restriction site of the broad-host vector pBBR1MCS-5, and anneal under the conditions in Table 1 below to form double-stranded adapters.

[0034] Table 1: Adapter primer sequences and annealing temperatures

[0035]

[0036] (3) Adding adapters to Mnli digestion products and amplification

[0037] Add 5'Mix and 3'Mix adapters to the DNA fragments digested by Mnli, and use T4 DNA ligase to connect them overnight at 4°C to add adapter sequences to both ends of the Mnli digestion product. Use the forward primer H1-F (5'-ACTCATTAGGCACCCCAGGC AAGCTT GTC-3') and the reverse primer X1-R (5'-GAATATGGCTCAT TCTAGA GCATCATGGTGAGT-3'), and amplify the Mnli digestion product plus the adapter connection product by conventional PCR method. Use DNA product purification kit to recover and purify the PCR product, which is the genomic DNA library with adapter.

[0038] 2. Interaction between genomic DNA library and pollution stress response proteins

[0039] (1) Microbial responses to environmental pollution stress

[0040] Inoculate Sphingobium xenophagum C1 into 5 mL of LB medium and culture at 30°C overnight. Inoculate the overnight culture into 100 mL × 6 bottles of fresh LB medium at 1% inoculum and culture at 30°C until the bacterial OD reaches 0. 600 ≈0.4~0.6. The cells were collected by centrifugation at room temperature and an inorganic salt buffer (containing 2.0 g Na2HPO4·12H2O, 0.7 g KH2PO4, 0.5 g NH4Cl, 0.3 g NaCl, 0.1 g MgSO4·7H2O, 0.05 g CaSO4·2H2O, 0.2 mg FeCl3·6H2O, 0.2 mg NaMoO4, 0.2 mg MnCl2·4H2O, 0.2 mg CuCl2·2H2O, 0.2 mg ZnSO4, 0.2 mg H3BO3, 0.3 mg CoCl2·6H2O per liter) was used. 0.4mg, peptone 0.2g / L, yeast powder 0.1g / L, solvent is water; the preparation method is to dissolve each component in water and sterilize it) After washing the bacteria twice, it is finally resuspended in the same volume of inorganic salt buffer, and 3 bottles of culture medium are added with target environmental pollutants respectively, and the other 3 bottles of culture medium are blank controls. All culture bottles are placed in a shaker and cultured at 30℃ for a certain period of time.

[0041] (2) Extraction of environmental pollution stress response proteins

[0042] 100 mL of cells were collected by centrifugation at room temperature, and after washing the cells twice with inorganic salt buffer, 2-4 mL of cell lysis solution (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.25% Triton X-100, pH 8.0) was added, lysozyme was added to make the final concentration 0.5 mg / mL, and after adding protease inhibitors, the cells were lysed at room temperature for about 30 min. The cell lysate was then centrifuged at 8500 × g for 5-10 min at 4 ° C, and the supernatant was collected, which was the environmental pollution stress response protein mixture.

[0043] (3) Protein-DNA interaction and separation of bound DNA fragments

[0044] Combine the 2 mL response protein mixture extracted in step 2 (2) with the 25 μL (about 15 μg) genomic DNA library extracted in step 1 (3) after Mnli digestion and adding adapters, and incubate at room temperature for about 30 minutes in binding buffer (20 mM Hepes, 10 mM ammonium sulfate, 10 mM KCl, 0.2% Tween-20, 1 mM DTT, pH 7.6).

[0045] Transfer the above protein-DNA binding mixture to a nitrocellulose membrane filter column that has been washed with binding buffer in advance, and incubate on ice for about 20 minutes. Then centrifuge at 6000×g for 2 minutes at 4°C, and discard the effluent. Add 2mL of pre-cooled rinse buffer (100mM Tris-HCl, 2.5mM EDTA·2Na, 0.1% Tween-20, pH 7.6) to wash away the DNA fragments that are not bound to the protein, centrifuge at 6000×g for 2 minutes at 4°C, and discard the effluent. Repeat the column washing 4 times. Finally, use elution buffer (0.5% SDS) to elute the response protein-bound DNA fragments bound to the nitrocellulose membrane column. Use a DNA product purification kit to recover and purify the eluted DNA fragments, which are the DNA fragments bound to the environmental pollution stress response protein.

[0046] 3. High-throughput sequencing of DNA fragments bound by environmental pollution stress response proteins

[0047] (1) Transformation of the broad-host vector pBBR1MCS-5

[0048] The DNA of pET24a plasmid was extracted using a plasmid extraction kit, and the kanamycin resistance gene encoding DNA sequence containing the promoter sequence and the multiple cloning site sequence were amplified using conventional PCR methods using primers Kana-R (5'-AAATATTAACGCCTCGAGTTAGAAAAACTCATCGAGC-3') and primer Kana-F (5'-CATTAGGCACCCCAGGCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTCTAGAGA AGATCCTTTGATC-3') with pET24a plasmid DNA as a template. Primer Primer4 (5'-GCCTGGGGTGCCTAATGAGTGAGCTAACTC-3') and primer pBBR-F (5'-CTCGAGGCGTTAATATTTTGTTAAAATTCGCG-3') were used to perform reverse amplification using conventional PCR methods to obtain a linearized vector. The kanamycin resistance gene fragment and the linearized pBBR1MCS-5 plasmid fragment were recovered and purified using a purification kit, and the pBBR1MCS-5 plasmid DNA was connected to the kanamycin resistance gene fragment using a recombinase, and then transformed into Escherichia coli DH5ɑ competent cells by heat shock, and positive clones were screened by 50 mg / L gentamicin resistance. The positive clone DNA was picked for PCR amplification of the kanamycin resistance gene fragment and sequencing verification, and a pBBR1MCS-5 recombinant plasmid with a successfully transformed multiple cloning site and a promoter-containing kanamycin resistance gene was obtained, named pBBR1MCS-Km1.

[0049] Primer Kana-R (base sequence as above) and primer Kana-F2 (5'-CGAATTCGGATCCTCTAGAATGAGCCATATTCAACGG-3') were used, and pET24a plasmid DNA was used as a template. The kanamycin resistance gene encoding DNA sequence without a promoter sequence was amplified by conventional PCR method, and the pBBR1MCS-Km1 plasmid was digested with restriction endonucleases XbaI and XhoI at 37°C for 30 minutes. Then, the kanamycin resistance gene fragment and the pBBR1MCS-Km1 plasmid fragment cut by endonucleases were purified using a purification recovery kit, and the pBBR1MCS-Km1 plasmid and the kanamycin resistance gene fragment were connected using a recombinase, and heat-shocked into Escherichia coli DH5ɑ competent cells, and positive clones were screened by 50 mg / L gentamicin resistance. The positive clone DNA was picked for PCR amplification and sequencing verification of the kanamycin resistance gene, and the pBBR1MCS-5 recombinant plasmid with a successfully transformed kanamycin resistance gene with a multiple cloning site and without a promoter was obtained and named pBBR1MCS-Km2.

[0050] (2) Enzyme digestion preparation of transformation vector and homologous recombination with DNA fragments

[0051] The DNA of the recombinant plasmid pBBR1MCS-Km2 was extracted using a plasmid extraction kit, and the linearized vector was obtained by digestion with restriction endonucleases HindIII and XbaI at 37°C. The pBBR1MCS-Km2 plasmid DNA was connected to the DNA fragment bound to the environmental pollution stress response protein using the recombinase, and the DNA fragment was transformed into Escherichia coli DH5ɑ competent cells by heat shock, and the positive clones were screened by 50mg / L gentamicin resistance. All positive clones were inoculated into LB medium containing 50mg / L gentamicin at the same time and cultured overnight at 37°C. The DNA of the recombinant plasmid was extracted using a plasmid extraction kit, and the recombinant plasmid was electroporated (2200V, 25μF, 200Ω, 1mm) into the competent cells of Sphingobiumxenophagum C1, and double resistance was screened by 50mg / L gentamicin and 50mg / L kanamycin.

[0052] (3) High-throughput sequencing of DNA fragment recombinant plasmids bound to environmental pollution stress response proteins

[0053] All positive clones on the double-resistance plate were inoculated into LB culture containing 50 mg / L gentamicin and 50 mg / L kanamycin and cultured overnight at 30°C. The whole genome DNA of the double-resistance recombinant plasmid strain was extracted using a bacterial genome extraction kit and sent to Guangdong Meige Gene Technology Co., Ltd. High-throughput sequencing primers were used to perform PCR amplification and high-throughput sequencing of the environmental pollution stress response protein binding DNA fragment in the recombinant plasmid. The amplification primers used for high-throughput sequencing are: Barcode X (5'- NNNNNNNNNNNN Barcode X primer sequences are shown in Table 2 below:

[0054] Table 2: Barcode X primer sequences used for high-throughput sequencing

[0055] Primer name Sequence (5'~3') Barcode 1 AGCTGTCGGTAAACTCATTAGGCACCCCAGGC Barcode 2 GCAAAGGTCACTACTCATTAGGCACCCCAGGC Barcode 3 CTTAGAATCCGAACTCATTAGGCACCCCAGGC Barcode 4 GTCCGTACCTTGACTCATTAGGCACCCCAGGC Barcode 5 AACGCATGAGGAACTCATTAGGCACCCCAGGC Barcode 6 CTGTTGACTGACACTCATTAGGCACCCCAGGC

[0056] The screening and identification technology for molecular elements of microbial responses to environmental pollution stress, after optimization by the present invention, has been significantly improved in terms of cost, time consumption, versatility, and data acquisition compared to the original patented technology. First, the screening marker was changed from luciferase activity detection before optimization to antibiotic resistance screening, which greatly reduced the expensive cost of using substrate luciferin to detect signals. Secondly, the screening step was changed to two rounds of antibiotic resistance screening, which greatly reduced the false negatives caused by the first round of antibiotic resistance screening before optimization and the huge workload of random strain selection and verification. Furthermore, the operating vector was changed from pACYC-Luc before optimization to the broad-host vector pBBR1MCS-5, which can adapt to most host strains other than Escherichia coli and has higher versatility in screening molecular elements of environmental strains. Finally, by merging all positive clones for DNA high-throughput sequencing analysis, the workload was greatly reduced compared to the method of random strain selection and verification before optimization, and the amount of data acquisition was significantly improved. See the optimized screening and identification technology process. Figure 1 shown.

[0057] Example 2: High-throughput mining and analysis of molecular components of microbial responses to TBBPA pollution stress.

[0058] 1. Construction of genomic DNA library

[0059] The above operation is the same as in Example 1.

[0060] 2. Interaction between genomic DNA library and TBBPA-responsive proteins

[0061] (1) Microbial response to TBBPA stress

[0062] Inoculate Sphingobium xenophagum C1 into 5 mL of LB medium and culture at 30°C overnight. Inoculate the overnight culture into 100 mL × 6 bottles of fresh LB medium at 1% inoculum and culture at 30°C until the bacterial OD reaches 0. 600 ≈0.4~0.6. The cells were collected by centrifugation at room temperature, washed twice with inorganic salt buffer, and finally resuspended in the same volume of inorganic salt buffer. 10μL of TBBPA mother solution (200mg / mL) dissolved with 1mol / L NaOH was added to 3 bottles of culture medium respectively, so that the final concentration of TBBPA was 10mg / L, and the other 3 bottles of culture medium were blank controls. All culture bottles were placed in a shaker and cultured at 30℃ for about 16h.

[0063] (2) Extraction of TBBPA stress-responsive proteins

[0064] The above operation is the same as in Example 1.

[0065] (3) Protein-DNA interaction and separation of bound DNA fragments

[0066] The above operation is the same as in Example 1.

[0067] 3. High-throughput sequencing of DNA fragments bound by TBBPA stress response proteins

[0068] The above operation is the same as in Example 1.

[0069] 4. Comparison and analysis of high-throughput sequencing data

[0070] The raw data of functional element amplicon sequencing were removed from the Barcode X primer fragment in the double-end sequence using Cutadapt (V3.4 with Python 3.8.3) (Martin, 2011. CUTADAPT removes adapter sequences from high-throughput sequencing reads. EMBnet journal.) according to the sequence of the amplification primer used for high-throughput sequencing, and then low-quality sequences were removed by Fastp (V0.21.0, parameters -W 4–M 20). After that, the double-end data were spliced ​​using vsearch–fastq_mergepairs (V2.19.0) (Rognes et al., 2016. VSEARCH: aversatile open source tool for metagenomics. Peerj 4.) to obtain CleanTags. Based on dada2 (Callahan et al., 2017. Exact sequence variants should replace operational taxonomic units in marker-gene data analysis. ISME J 11(12), 2639-2643.; Callahan et al., 2016. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13(7), 581-583.), Clean Tags were quickly filtered and denoised, and amplicon sequence variants (ASVs) were obtained according to 100% similarity, and the sequence abundance was counted. The analysis results showed that a total of 573+790 ASVs were detected in the TBBPA stress-responsive treatment group and the non-stress-responsive control group, of which 77+125 ASVs were up-regulated (log2FC>1) and 129+167 ASVs were down-regulated (log2FC<1) under TBBPA stress conditions compared with non-stress conditions. Figure 2 ). Among them, ASV86 had the largest difference in induction under TBBPA stress response conditions compared with non-stress response conditions, with log2FC=7.69, and no expression was detected under TBBPA non-stress response conditions; while ASV76 had the largest difference in induction under significantly down-regulated conditions, with log2FC=-4.70.

[0071] By comparing the different ASVs sequences on the NCBI database website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) with the whole genome of Sphingobium xenophagum C1, the gene positions and gene cluster structures of different ASVs were located. The promoter sequence in the gene cluster structure was predicted using the BPROM module of the Softberry website (http: / / www.softberry.com / berry.phtml?topic=bprom&group=programs&subgroup=gfindb). Through comparison analysis, it was found that most of the ASVs with significant differences matched functional genes such as efflux protein gene clusters, transcriptional regulatory factors and their structural genes, oxidoreductase gene clusters, and DNA synthesis / replication / recombination / repair systems. The information of important functional gene clusters that were significantly induced in the TBBPA pollution stress response treatment group is as follows: Figure 3 shown.

[0072] A typical representative of the efflux protein gene cluster is ASV86 (log2FC=7.69), whose chr1_115~chr1_119 gene clusters are acrR (chr1_119, sequence as shown in SEQ ID NO.1), acrA (chr1_118, sequence as shown in SEQ ID NO.2), acrB (chr1_117, sequence as shown in SEQ ID NO.3), tolC (chr1_116, sequence as shown in SEQ ID NO.4) and adaB (chr1_115, sequence as shown in SEQ ID NO.5) genes. AcrR belongs to the TetR family of transcriptional regulators, has a conserved triple helical N-terminal DNA binding domain and a diverse C-terminal ligand binding domain, and plays a core role in regulating the expression of the AcrAB-TolC efflux protein pump. However, little is known about the inducing ligands of AcrR activity, and only ethidium bromide, proflavin and polyamines (putrescine, cadaverine, spermine) have been confirmed. The chr1_119-chr1_115 gene cluster excavated by the present invention is likely to have an important efflux transport function for TBBPA, and TBBPA is likely to be a new inducing ligand for AcrR activity. The chr1_119-chr1_115 gene cluster is likely to improve the strain's tolerance to TBBPA pollution stress. In addition, upstream of the chr1_119-chr1_115 gene cluster are the molybdate transport system related genes fabG (chr1_114, sequence as shown in SEQ ID NO.6), modC (chr1_113, sequence as shown in SEQ ID NO.7), and modB (chr1_112, sequence as shown in SEQ ID NO.8), which may also play a certain role in the membrane transport of TBBPA. Another phosphate / sulfate transport system chr1_1648-chr1_1650 gene cluster is located at the location of ASV71 (log2FC=4.88), which is also significantly up-regulated by TBBPA, including pitA (chr1_1648, sequence as shown in SEQ ID NO.9), ykaA (chr1_1649, sequence as shown in SEQ ID NO.10), and lysR (chr1_1650, sequence as shown in SEQ ID NO.11). These results suggest that the inorganic salt transport system may also play an important role in the efflux or uptake of TBBPA.

[0073] ASV48 (log2FC=5.76) is located in the chr1_709-chr1_713 gene cluster. Chr1_709 is the gstA (chr1_709, sequence as shown in SEQ ID NO.12) gene, encoding glutathione S-transferase, which participates in the cellular detoxification process by catalyzing the covalent binding of glutathione with a wide range of endogenous and exogenous toxins and oxidative stress products. In addition, the lpd gene (chr1_2603, sequence as shown in SEQ ID NO.13) encoding glutathione disulfide reductase was also significantly up-regulated, indicating that the glutathione detoxification process is likely to be involved in the cell's response to TBBPA toxicity. In addition, the chr1_710-chr1_713 gene clusters are nrdA (chr1_710, sequence as shown in SEQ ID NO.14), hypothetical protein gene hp1 (chr1_711, sequence as shown in SEQ ID NO.15), nrdB (chr1_712, sequence as shown in SEQ ID NO.16) and ulaG (chr1_713, sequence as shown in SEQ ID NO.17) genes, which are involved in DNA replication / recombination / repair, etc., and may be related to the toxic response of TBBPA-induced microorganisms. The location of ASV76 (log2FC=-4.70) is the chr1_1993-chr1_1995 gene cluster, which are nlpD (chr1_1993, sequence as shown in SEQ ID NO.18), iscA (chr1_1994, sequence as shown in SEQ ID NO.19) and xthA (chr1_1995, sequence as shown in SEQ ID NO.20) genes. It is involved in cell wall / cell membrane synthesis, Fe-S cluster biosynthesis, and exonuclease-mediated DNA replication / recombination / repair processes, and may also be related to TBBPA-induced toxic responses of microorganisms.

[0074] The chr1_2604-chr1_2605 operons downstream of the glutathione disulfide reductase lpd gene (chr1_2603, sequence as shown in SEQ ID NO.13) were also significantly up-regulated and induced, among which chr1_2604 (sequence as shown in SEQ ID NO.21) has a COG4340 conserved domain, encoding a ketoglutarate / Fe-dependent dioxygenase, which is likely to have an oxidative degradation function for TBBPA. chr1_2605 (sequence as shown in SEQ ID NO.22) has a COG3800 conserved domain, encoding a xenobiotic-responsive transcription factor, which is likely to directly bind to TBBPA and respond to its pollution stress. ASV121 (log2FC=5.37) is located in the p2_166~p2_168 gene cluster, encoding hypothetical proteins hp2 (p2_166, sequence as shown in SEQ ID NO.23) and hp3 (p2_168, sequence as shown in SEQ ID NO.24) and mucR transcription regulatory factor (p2_167, sequence as shown in SEQ ID NO.25), and its specific function is still unclear.

[0075] The above results indicate that the response of microorganisms to TBBPA pollution stress is a complex process, which involves several important biochemical processes and molecular elements, including the efflux or uptake of TBBPA, the toxic response of TBBPA, the nonspecific detoxification of TBBPA, the specific degradation of TBBPA and some unclear functional processes.

[0076] Example 3: Construction of a TBBPA high-tolerance artificial cell system based on efflux protein pump elements.

[0077] Inoculate Sphingobium xenophagum C1 into 5 mL of LB medium, culture at 30°C overnight, collect bacteria by centrifugation at room temperature, extract the whole genome DNA of strain C1 using a bacterial genome extraction kit and use it as a template, use primers 86-F3 (5'-AAACTAGTGGATCCTAGACATTTTCTCTCTTGAATTC-3') and 86-R3 (5'-TCACCATGAATTCTGTTCCCAAAACCTGC-3'), and amplify the DNA sequence containing the AcrAB-TolC-AdaB efflux protein pump chr1_118~chr1_115 gene cluster (sequences shown in SEQ ID NO.2~NO.5) by conventional PCR method. Extract the plasmid DNA of the broad host vector pBBR1MCS-5, digest the pBBR1MCS-5 plasmid DNA with BamHI and EcoRI restriction enzymes at 37°C, and recover and purify the plasmid fragment after enzyme digestion using a purification kit. The chr1_118~chr1_115 gene fragments were connected to the linearized pBBR1MCS-5 vector using recombinase, and the fragments were transformed into competent cells of Escherichia coli DH5ɑ by heat shock, and positive clones were screened by 50mg / L gentamicin resistance. The positive clone DNA was picked for PCR amplification and sequencing verification of the chr1_118~chr1_115 gene fragments, and the successfully connected recombinant plasmid pBBR-118-115 was obtained. The recombinant plasmid pBBR-118-115 was transformed into competent cells of C1 bacteria by electroporation, and positive clones were screened by 50mg / L gentamicin resistance. The positive clone DNA was picked for PCR amplification and verification of the chr1_118~chr1_115 gene fragments. Finally, the chassis cell C1 (pBBR-118-115) containing the pBBR-118-115 multi-copy vector was obtained.

[0078] Inoculate C1 (pBBR-118-115) chassis cells into LB liquid medium containing 50 mg / L gentamicin and culture at 30°C overnight. Inoculate the overnight culture into fresh LB containing 50 mg / L gentamicin at a 1% inoculum volume and culture at 30°C until the bacterial cell OD reaches 600 ≈0.4. Collect the cells by centrifugation at room temperature, wash the cells twice with inorganic salt buffer, and resuspend the cells with the same volume of inorganic salt buffer to make the cell OD 600 Add 50 mg / L gentamicin, 5 g / L glucose and different concentrations of TBBPA (0, 5.0, 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, 100.0 mg / L), culture at 30°C for 38 h and measure the OD of bacterial cells every half an hour600 value.

[0079] The test results showed that increasing the copy number of AcrAB-TolC efflux protein pump in Sphingobium xenophagum C1 can improve the strain's tolerance to TBBPA pollution stress. Under the experimental test concentration of TBBPA, the multi-copy C1 (pBBR-118-115) strain obtained a higher biomass than the control strain C1 (pBBR), which were 4.21% (0 mg / L), 22.14% (5.0 mg / L), 22.32% (10.0 mg / L), 28.66% (15.0 mg / L), 31.60% (20.0 mg / L), 28.51% (25.0 mg / L), 17.41% (50.0 mg / L), 18.15% (75.0 mg / L), 13.24% (100.0 mg / L) ( Figure 4 ). As the concentration of TBBPA increases, the degree of increase in biomass between strains begins to decrease, indicating that the AcrAB-TolC efflux protein pump has a certain range of TBBPA concentration tolerance given to the strain. The above results also confirm the hypothesis that the AcrAB-TolC efflux protein pump chr1_118~chr1_115 gene cluster (sequences shown in SEQ ID NO.2~NO.5) elements mentioned in Example 2 can improve the strain's tolerance to TBBPA pollution stress, and also provide a new type of high-tolerance molecular element for the development of biotechnology for monitoring and control of high-concentration TBBPA in the environment.

[0080] Example 4: Construction of TBBPA degradation artificial cell system based on dioxygenase elements.

[0081] The molecular element of ketoglutarate / Fe-dependent dioxygenase chr1_2604 (sequence as shown in SEQ ID NO.21) was optimized to match the codon usage frequency of Escherichia coli, and the codon-optimized chr1_2604 molecular element was synthesized by a gene synthesis method, and NdeI and XhoI restriction sites were designed at both ends of the optimized gene fragment. The DNA of the Escherichia coli expression vector pET30b was extracted, and the gene fragment and pET30b plasmid DNA were treated with NdeI and XhoI restriction endonucleases at 37°C, and the gene fragment and plasmid fragment after enzyme cutting were recovered and purified using a purification kit. The gene fragment was connected to the linearized vector using a recombinase, and was heat-shocked and transformed into Escherichia coli BL21 (ED3) competent cells, and positive clones were screened by 50 mg / L kanamycin resistance. The positive clone DNA was picked for PCR amplification and sequencing verification of the chr1_2604 gene fragment, and finally the E. coli chassis cells E. coli BL21 (DE3, pET30b-2604) expressing the recombinant plasmid that was successfully connected were obtained.

[0082] Inoculate E. coli BL21 (DE3, pET30b-2604) chassis cells into LB liquid medium containing 50 mg / L kanamycin and culture at 37°C overnight. Inoculate the overnight culture into fresh LB containing 50 mg / L kanamycin at a 1% inoculum volume and culture at 37°C until the bacterial cell OD reaches 0. 600 ≈0.8. Add 1mM isopropyl-β-D-thiogalactoside (IPTG) and induce culture at 37℃ for 3h. Collect the cells by centrifugation at room temperature, wash the cells twice with inorganic salt buffer, and resuspend the cells with the same volume of inorganic salt buffer. Add 50mg / L kanamycin, 1.0mM IPTG, 0.06mg / L α-ketoglutaric acid, 0.05mg / L FeSO4, 2.0-3.0mg / L TBBPA, and culture at 37℃ for 120h. Take out 3 bottles of culture medium at each set time point and freeze them in a -80℃ refrigerator. Then place the sample bottle in a freeze dryer for freeze drying. Add 4mL methanol and recovery indicator BBPA-F (0.5mg / L) to the dried sample and perform multiple freeze-thaw extractions. Finally, filter with a 0.45μm filter membrane, and the filtered sample is tested and analyzed for TBBPA concentration using an HPLC instrument.

[0083] The test results show that by inducing the expression of a large amount of ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein in the chassis cell E.coli BL21 (DE3, pET30b-2604) and accumulating it in advance, the efficient degradation of TBBPA was achieved. At 3 days, the degradation rate of 2.0 mg / L TBBPA by chassis cell E.coli BL21 (DE3, pET30b-2604) reached 44.41%. The loss rates of TBBPA in different control groups, including no chassis cell E.coli BL21 (DE3, pET30b-2604), no IPTG induction, IPTG induction but no FeSO4, and IPTG induction but no ketoglutarate, were 3.97%, 9.88%, 14.29%, and 17.93%, respectively. Figure 5 ). These results indicate that the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein induced to be expressed in large quantities and accumulated in advance in the chassis cells has a strong oxidative degradation ability for TBBPA, and also confirms the hypothesis that the ketoglutarate / Fe-dependent dioxygenase chr1_2604 (sequence as shown in SEQ ID NO.21) element mentioned in Example 2 has an oxidative degradation function for TBBPA, and also provides a new type of molecular element for the development of bioremediation technology for TBBPA pollution in the environment.

[0084] Example 5: Construction of TBBPA pollution monitoring sensor cells based on xenobiotic-responsive transcription factor elements.

[0085] By gene synthesis, the firefly luciferase small subunit coding sequence (5′-GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC-3′) was added to the 3′ end of the molecular element of the xenobiotic response transcription factor chr1_2605 (sequence as shown in SEQ ID NO.22), and a fusion gene fragment including the upstream promoter sequence of the chr1_2605 gene (5′-TTCCCGCGATTGCGATTTTTCGCAAATGTAAATT-3′) was synthesized, and BamHI and XhoI restriction sites were designed at both ends of the fusion gene fragment. The DNA of the broad host vector pBBR1MCS-5 was extracted, and the fusion gene fragment and pBBR1MCS-5 plasmid DNA were treated with BamHI and XhoI restriction endonucleases at 37°C, and the fusion gene fragment and plasmid fragment after enzyme digestion were recovered and purified using a purification kit. The fusion gene fragment was connected to the linearized vector using a recombinase, and the cells were transformed into competent E. coli DH5ɑ cells by heat shock, and positive clones were screened by 50 mg / L gentamicin resistance. The DNA of the positive clones was picked for PCR amplification and sequencing verification of the chr1_2605 fusion gene fragment, and the recombinant plasmid pBBR-2605-HiBiT with successful connection was obtained. The recombinant plasmid pBBR-2605 was transformed into competent cells of C1 bacteria by electroporation, and positive clones were screened by 50 mg / L gentamicin resistance. The positive clone DNA was picked for PCR amplification and verification of the chr1_2605 fusion gene fragment. Finally, the chassis cell C1 (pBBR-2605-HiBiT) containing the pBBR-2605-HiBiT fluorescent reporter vector was obtained.

[0086] Inoculate C1 (pBBR-2605-HiBiT) chassis cells into LB liquid medium containing 50 mg / L gentamicin and culture overnight at 30°C. Collect the cells by centrifugation at room temperature, wash the cells twice with inorganic salt buffer, and resuspend the cells in a certain volume of inorganic salt buffer to make the cell OD 600≈1.0. Different concentrations of fluorinated compounds were added to brown glass bottles: perfluorohexane sulfonic acid (0, 1.25, 2.5, 5.0, 10.0 μM), perfluorooctane sulfonic acid (0, 1.25, 2.5, 5.0 μM), perfluorooctane sulfonic acid (0, 1.25, 2.5, 5.0 μM); chlorinated compounds: trichlorodicol (0, 1.25, 2.5, 5.0, 10.0 μM), pentachlorophenol (0, 0.05, 0.1, 0.2, 0.3 μM), hexachlorobutadiene (0 , 0.5, 1.0, 2.0, 4.0 μM), decachlorobiphenyl (0, 1.25, 2.5, 5.0, 10.0 μM); brominated substances: tetrabromobisphenol A (0, 0.01, 0.05, 0.125, 0.25, 0.50, 1.25, 3.0, 5.0, 7.0, 8.0, 10.0 μM), decabromodiphenyl ether (0, 1.25, 2.5, 5.0 μM), inorganic salt buffer, 50 mg / L gentamicin and 5 g / L glucose were added. The washed and resuspended C1 (pBBR-2605-HiBiT) chassis cell suspension was inoculated at 2% inoculation volume and cultured in a shaker at 30°C until the bacterial cell OD 600 ≈0.4. A portion of the chassis cell culture medium was taken out for biomass analysis to ensure that the biomass concentration of each sample was basically consistent. 100 μL of chassis cell culture medium was taken out, 100 μL of intracellular lysis buffer (containing lysis buffer, firefly luciferase large subunit LgBiT and luciferase luminescent substrate furimazine, Promega) was added, and luciferase activity was analyzed on a chemiluminescence instrument.

[0087] The analysis of luciferase activity of sensor cells under different pollutant stresses showed that C1 (pBBR-2605-HiBiT) chassis cells had no obvious response to fluorinated compounds (perfluorohexane sulfonic acid, perfluorooctane sulfonic acid, perfluorooctane sulfonic acid), chlorinated compounds (tricofol, pentachlorophenol, hexachlorobutadiene, decachlorobiphenyl) and decabromodiphenyl ether among brominated compounds, and only showed fluorescence activity in response to TBBPA pollution stress ( Figure 6). Among the experimental tested concentrations of TBBPA, 7.0 μM TBBPA pollution stress induced the maximum luciferase signal. As the TBBPA concentration increased to above 7.0 μM, the luciferase signal slowly but not sharply decreased, indicating that high concentrations of TBBPA had an effect on the enzyme activity of chassis cells but was not lethal. Among the experimental tested concentrations of TBBPA, the minimum detection limit of C1 (pBBR-2605-HiBiT) sensor cells was between 0.01 and 0.05 μM, approximately 5.43 and 27.19 μg / L. The above results also confirmed the hypothesis that the xenobiotic response transcription factor chr1_2605 (sequence as shown in SEQID NO.22) element mentioned in Example 2 responds to TBBPA pollution stress, and also provides a new type of molecular element for the development of biological monitoring technology for TBBPA pollution in the environment.

[0088] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A high-throughput mining method for molecular components of microbial response to toxic and refractory organic pollutants, characterized in that: The following steps are involved: a. Extract genomic DNA of cells to be screened and identified, and then digest with restriction endonuclease Mnli, add 5'Mix and 3'Mix adapters to the digested DNA fragments, so that adapter sequences are added to both ends of the Mnli digestion product, and use a forward primer H1-F containing a HindIII restriction site and a portion of the homology arm sequence near the corresponding restriction site of pBBR1MCS-5 and a reverse primer X1-R containing a portion of the homology arm sequence near the corresponding restriction site of pBBR1MCS-5, and amplify the connection product of the Mnli digestion product plus the adapter by PCR, and the PCR product is recovered and purified to obtain a genomic DNA library with an adapter; b. The cells to be screened and identified are stressed with pollutants, and the cells without pollutants are used as controls. Then, the stress response protein is extracted, and the response protein solution is combined with the genomic DNA library. After the protein and DNA are fully bound, the sample is loaded onto a pre-cleaned nitrocellulose membrane filter column, centrifuged and the effluent is discarded, and the cells are washed with a filter washing buffer for multiple times, and the response protein-bound DNA fragments are eluted with an elution buffer; c. Insert the kanamycin resistance gene with promoter and the multiple cloning site into the pBBR1MCS-5 plasmid DNA, and then insert the response protein binding DNA fragment into the pBBR1MCS-5 plasmid DNA, and then homologously recombinant into the cells to be screened and identified, and screened with kanamycin. Extract the genomic DNA of the positive clones obtained by screening, and perform high-throughput sequencing to obtain the environmental pollution stress response protein binding DNA fragment in the recombinant plasmid.

2. The method according to claim 1, characterized in that The cell to be screened and identified is Sphingobium xenophagum C1.

3. An efflux protein pump gene cluster consisting of AcrA, AcrB, TolC, and AdaB, characterized in that: The coding nucleotide sequences of AcrA, AcrB, TolC and AdaB are shown in SEQ ID NO.2 to NO.5 respectively.

4. Use of the efflux protein pump gene cluster consisting of AcrA, AcrB, TolC and AdaB according to claim 3 in improving strain tolerance to TBBPA.

5. A ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein, characterized in that The encoding nucleotide sequence is shown in SEQ ID NO.

21.

6. Use of the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein according to claim 5 in degrading TBBPA.

7. The use according to claim 6, characterized in that: The method is to introduce the coding gene of ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein into the engineered bacteria, so that the engineered bacteria produces ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein for degrading TBBPA.

8. The use according to claim 7, characterized in that: The engineering bacteria is Escherichia coli.

9. A xenobiotic-responsive transcription factor chr1_2605, characterized in that The nucleotide sequence is shown in SEQ ID NO.

22.

10. Use of the xenobiotic-responsive transcription factor chr1_2605 according to claim 9 in monitoring TBBPA pollution.

Images