Human mitochondrial genome sequencing primer group based on three-generation sequencing technology, reagent and application of human mitochondrial genome sequencing primer group

Abstract

The invention discloses a human mitochondrial genome sequencing primer group based on a three-generation sequencing technology. The human mitochondrial genome sequencing primer group comprises a primer F sequence as shown in SEQ ID No. 1 and a primer R sequence as shown in SEQ ID No. 2. According to the method, the full-length sequence of the human mitochondria can be sequenced at one time, sequencing results do not need to be spliced, and the method is simple and convenient. The 24 human mitochondrial sequences are subjected to biological information analysis, the problem of low accuracy of a three-generation sequencing platform is solved through selection of a conserved region and optimization of the primer group, accurate sequencing of the human mitochondrial sequences can be realized, the accuracy of a sequencing result is improved, and the accuracy of the human mitochondrial sequences is improved. And a new technical means is provided for the application of mitochondrial sequencing in the fields of individual identification, genetic relationship determination and the like in the field of forensic science.

Description

Technical Field

[0001] The invention relates to a human mitochondrial genome sequencing primer set, in particular to a human mitochondrial genome sequencing primer set proposed based on a third-generation sequencing technology, and belongs to the field of biotechnology. Background Art

[0002] DNA technology has extremely high accuracy and reliability in identity recognition, especially when other identification methods (such as fingerprints or visual recognition) are limited or ineffective. It not only helps to confirm the identity of suspects and victims, but is also widely used in large-scale disasters, historical remains archaeology, and identity verification of missing persons. It has become an indispensable tool for modern forensic medicine and the judicial system.

[0003] Mitochondrial DNA (mtDNA) has highly conserved gene sequences, high copy numbers, and maternal inheritance, which makes it a very useful tool in forensic medicine when dealing with damaged, old, or trace samples. In the field of forensic medicine, mitochondrial DNA sequencing can achieve the following applications:

[0004] Individual identification: In some cases, especially when only small or damaged physical evidence is available, such as hair, bones, and teeth, nuclear DNA may be difficult to analyze due to degradation. In these cases, mitochondrial DNA, due to its high copy number in cells, is more likely to be successfully extracted and analyzed, thus helping to confirm or exclude the identity of an individual.

[0005] Maternal genetic information: Mitochondrial DNA is strictly inherited through the maternal line, not through the paternal line. This means that all people with the same maternal lineage have almost the same mitochondrial DNA sequence. Therefore, in forensic medicine, mitochondrial DNA can be used to trace the maternal lineage of an individual, which is particularly important in the search for missing persons, the identification of unidentified bodies or historical remains.

[0006] Disaster victim identification: In large-scale disasters (such as plane crashes, mass deaths after natural disasters, etc.), traditional identification methods may become unfeasible due to environmental impacts and the condition of the body. Mitochondrial DNA testing has become an important method for identifying victims in such situations due to its stability and high copy number.

[0007] Court Evidence: The results of a mitochondrial DNA analysis can be used as evidence in court to support or refute legal arguments related to a case.

[0008] First-generation sequencing technology (Sanger sequencing) and second-generation sequencing technology (high-throughput sequencing, NGS) are the two main sequencing methods in the field of gene sequencing. They have significant differences in principles, processes, steps, advantages and disadvantages.

[0009] The first generation sequencing technology is based on the chain termination method (Sanger method), which uses the 2' and 3' ends of ddNTP (dideoxynucleotide) to interrupt the DNA synthesis reaction because both ends do not contain hydroxyl groups and cannot form phosphodiester bonds. The complete sequencing process is divided into 4 steps, including DNA fragmentation, PCR amplification and in vitro cloning, ddNTP cycle sequencing, and gel electrophoresis to obtain sequences. Its advantages are high accuracy and it is called the "gold standard" in the sequencing industry; each reaction can obtain a sequence of 700 to 1000bp, and the sequence length is higher than that of the second generation sequencing; it is low in price and the equipment has a short operating time. However, its disadvantages are also obvious, low throughput, high sequencing cost, and high cost of obtaining a large amount of sequence information.

[0010] The second-generation sequencing technology pioneered the introduction of reversible termination ends to achieve sequencing while synthesizing. During the DNA replication process, the special markers (such as fluorescent molecular markers) carried by the newly added bases are captured to determine the DNA sequence. Taking the Illumina sequencing method as an example, it includes two main stages: library construction and on-machine sequencing. Library construction also includes steps such as end modification, adding adapters, and PCR amplification; on-machine sequencing involves the binding of single-stranded library DNA fragments to oligonucleotides on the surface of the circulation pool, bridge amplification, and sequencing while synthesizing. The advantages of the second-generation sequencing technology are high throughput, which can sequence tens or millions of DNA molecules in parallel at a time; the read length is short, but longer continuous sequences can be obtained by splicing; the sequencing cost is greatly reduced and the sequencing speed is increased. However, its disadvantages are short read length (no more than 500bp), which may limit some applications; sequence deviation and high error rate are also problems. For example, in the Chinese patent application with publication number CN106520945A, a non-invasive targeted mitochondrial sequencing method based on the second-generation sequencing platform is disclosed, which mainly includes the following steps: sample preparation; DNA extraction; PCR amplification and product detection; library construction and quality inspection; on-machine sequencing and result analysis. In this method, ultrasound is used to randomly interrupt the mitochondrial genomic DNA, the band is less than 800bp, and the main band is concentrated at 300bp; the constructed library is sequenced on the second-generation sequencing platform, the read length is 250bp, the sequencing depth is required to reach 3000×, and each sample generates about 90M of data; the sequencing data is analyzed to obtain the mitochondrial full genome sequence. This method randomly destroys the sample DNA, breaking it into short fragments. The length of the DNA sequence obtained after sequencing is 300 to 800bp, and bioinformatics methods are required to splice the sequencing results. The errors caused by data splicing will lead to errors in the full-length sequence information of mitochondria. At the same time, different splicing tools are used, and the splicing results obtained are also different. Therefore, the accuracy of the full-length mitochondrial information sequenced by this method is greatly reduced.

[0011] The core principle of the third-generation sequencing technology is to directly read the sequence of a single DNA molecule based on real-time monitoring technology of nanopores or fluorescent labels. Taking PacBio's SMRT technology as an example, it uses a special zero-mode waveguide structure. When a fluorescently labeled nucleotide is incorporated into the DNA chain being synthesized, the base type is identified by detecting the change in the fluorescent signal. The operation process is as follows: library preparation, breaking the DNA sample to be tested into small fragments, and adding specific adapter sequences to both ends of the fragments to form a DNA library suitable for sequencing. Template loading, loading the prepared DNA library onto the SMRT chip containing the zero-mode waveguide structure. Sequencing reaction, performing a reaction of sequencing while synthesizing on the SMRT chip. Whenever a nucleotide is added to the newly synthesized DNA chain, a fluorescent signal is emitted, and the type of nucleotide added is determined by detecting these fluorescent signals. Data analysis, collecting the fluorescent signal data generated during the sequencing process, and converting these signals into DNA sequences through bioinformatics analysis software. The advantage of the third-generation sequencing technology is that it can produce very long read lengths (up to tens of kb or even longer), which is very useful for applications such as genome assembly and structural variation detection. Real-time sequencing: The sequencing process is carried out in real time, and sequencing data can be obtained instantly. The third-generation sequencing is very suitable for bioinformatics analysis of human mitochondrial sequences. However, its disadvantage is the high error rate: compared with the first and second generation sequencing technologies, the error rate of the third-generation sequencing is relatively high, and multiple sequencing and error correction algorithms are required to improve accuracy.

[0012] In summary, how to use third-generation sequencing technology to achieve accurate sequencing information analysis of human mitochondrial sequences is still a hot topic in this field. Summary of the invention

[0013] The primary technical problem to be solved by the present invention is to provide a human mitochondrial genome sequencing primer set based on the third-generation sequencing technology.

[0014] Another technical problem to be solved by the present invention is to provide a use of the above primer set in human mitochondrial genome sequencing.

[0015] Another technical problem to be solved by the present invention is to provide a sequencing kit containing the above primer set.

[0016] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0017] A primer set for sequencing the human mitochondrial genome based on third-generation sequencing technology, the primer set comprising a primer F sequence as shown in SEQ ID No.1 and a primer R sequence as shown in SEQ ID No.2.

[0018] The primer set is used in preparing a human mitochondrial genome sequencing kit based on the third-generation sequencing technology.

[0019] A human mitochondrial genome sequencing kit based on third-generation sequencing technology comprises the above-mentioned primer set.

[0020] Preferably, the concentration of the primer set is: primer F 10uM, primer R 10uM.

[0021] Preferably, the kit also includes amplification reagents, product purification reagents, library construction and sequencing reagents.

[0022] A method for sequencing the human mitochondrial genome based on third-generation sequencing technology comprises the following steps:

[0023] (1) amplifying the sample using the primer set described in claim 1;

[0024] (2) agarose gel electrophoresis detection;

[0025] (3) Purification of amplified products;

[0026] (4) Library construction and sequencing.

[0027] Preferably, the amplification system in step (1) is: 2xKeyPo SE Master 25 μL, primer F (10 uM) 1.5 μL, primer R (10 uM) 1.5 μL, DNA 10-200 ng, and sterile double distilled water to 50 μL; the primer F sequence is shown in SEQ ID No. 1, and the primer R sequence is shown in SEQ ID No. 2

[0028] Preferably, the amplification procedure in step (1) is: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, and 35 cycles.

[0029] Preferably, the steps of constructing the library of the amplified products are: adding tags and adapters to the amplified products to construct a sequencing library.

[0030] Compared with the prior art, the present invention can use a pair of primers to complete the sequencing of the full-length sequence of human mitochondria at one time, without the need to splice the sequencing results, and the operation is simple and convenient. Based on the bioinformatics analysis of 24 human mitochondrial sequences, the present invention effectively solves the problem of low accuracy of the third-generation sequencing platform by carefully selecting the conserved regions and optimizing the primer set, and realizes the accurate sequencing of human mitochondrial sequences, significantly improving the accuracy of the sequencing results. This provides a new technical means for the application of mitochondrial sequencing in individual identification, determination of kinship, etc. in the field of forensic science. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Agarose gel electrophoresis quality inspection diagram of PCR products of 12 pairs of primers designed for the present invention;

[0032] Figure 2 This is the screening result diagram of the allele ladder of the Identifiler plus kit (six colors);

[0033] Figure 3 This is a graph showing the mass of the amplified product detected by agarose electrophoresis in an embodiment of the present invention. DETAILED DESCRIPTION

[0034] The present invention is further described below in conjunction with specific examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any method and material similar or equivalent to the described content can be applied to the method of the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0035] Example 1 Design and development of amplification primers in the present invention

[0036] In the present invention, a pair of universal amplification primers for the full length of human mitochondria were designed based on the 24 human mitochondrial DNA data published by NCBI. The 24 human mitochondrial DNA data information is as follows:

[0037] (1)>MH553861.1 Homo sapiens isolate 244 haplogroup A14 mitochondrion, complete genome

[0038] (2)>MH553720.1 Homo sapiens isolate 096 haplogroup A19 mitochondrion, complete genome

[0039] (3)>MH553762.1 Homo sapiens isolate 141 haplogroup A5 mitochondrion, complete genome

[0040] (4)>MH449242.1 Homo sapiens isolate LoLo483 haplogroup B4cmitochondrion,complete genome

[0041] (5)>MH449193.1 Homo sapiens isolate LaHu350 haplogroup B4emitochondrion,complete genome

[0042] (6)>MH553919.1 Homo sapiens isolate 304 haplogroup B4 mitochondrion,complete genome

[0043] (7)>MG660675.1 Homo sapiens isolate Td17016 haplogroup B4jmitochondrion,complete genome

[0044] (8)>MH553899.1 Homo sapiens isolate 282 haplogroup B5 mitochondrion,complete genome

[0045] (9)>KY645759.1 Homo sapiens isolate GV30 haplogroup Cmitochondrion,complete genome

[0046] (10)>MH449555.1 Homo sapiens isolate Mang297 haplogroup D4amitochondrion,complete genome

[0047] (11)>JQ657729.1 Homo sapiens haplogroup D4j mitochondrion,completegenome

[0048] (12)>MH553916.1 Homo sapiens isolate 301 haplogroup D5 mitochondrion,complete genome

[0049] (13)>MH553920.1 Homo sapiens isolate 305 haplogroup F1 mitochondrion,complete genome

[0050] (14)>MH553881.1 Homo sapiens isolate 264 haplogroup F2 mitochondrion,complete genome

[0051] (15)>MH553873.1 Homo sapiens isolate 256 haplogroup F4 mitochondrion,complete genome

[0052] (16)>MH553907.1 Homo sapiens isolate 290 haplogroup G2 mitochondrion,complete genome

[0053] (17)>MH449023.1 Homo sapiens isolate Dao662 haplogroup Gmitochondrion,complete genome

[0054] (18)>JN657206.1 Homo sapiens haplogroup Kmitochondrion,completegenome

[0055] (19)>MH553922.1 Homo sapiens isolate 307 haplogroup M7 mitochondrion,complete genome

[0056] (20)>MH553915.1 Homo sapiens isolate 300 haplogroup M8 mitochondrion,complete genome

[0057] (21)>MH553909.1 Homo sapiens isolate 292 haplogroup M9 mitochondrion,complete genome

[0058] (22)>MH553888.1 Homo sapiens isolate 271 haplogroup N9 mitochondrion, complete genome

[0059] (23)>MH553807.1 Homo sapiens isolate 188 haplogroup R9 mitochondrion, complete genome

[0060] (24)>MT588277.1 Homo sapiens isolate poz609 haplogroup Umitochondrion, complete genome

[0061] In primer design, non-specific amplification, low target ratio and excessive GAPs are often encountered. To address the above technical issues, the inventors compared the sequences of the above 24 human mitochondria and designed a total of 12 pairs of primers in the conserved regions for testing. The agarose gel electrophoresis quality test of the PCR products of the 12 pairs of primers is as follows: Figure 1 The target proportions generated by each primer set after sequencing are shown in Table 1.

[0062] Table 1

[0063] Primer set Randomly extract data volume Reads (items) Target Reads (strips) Target percentage (target / randomly extracted data volume) GAP size (Kb) 1 1000 887 88.7 4 2 1000 579 57.9 2 3 1000 797 79.7 4.4 4 1000 591 59.1 2.4 5 1000 709 70.9 3.3 6 1000 538 53.8 2 7 1000 769 76.9 0.2 8 1000 848 84.8 3.3 9 1000 859 85.9 2.2 10 1000 812 81.2 1.7 11 1000 846 84.6 4.6 12 1000 794 79.4 3.6

[0064] comprehensive Figure 1 The agarose gel electrophoresis shown in the figure and the sequencing target ratio shown in Table 1 finally confirmed the use of primer set 7 for subsequent experiments. The primer set 7 had a bright single band with no nonspecific amplification, and the target ratio was also high, with the least GAP, so primer set 7 was selected for subsequent experiments.

[0065] Based on the above primer sequences, the present invention proposes a mitochondrial full-length sequencing method based on a third-generation sequencing platform, wherein the final selected seventh group of primer sequences are as follows:

[0066] SEQ ID No.1 F-5'CACCCTATGTCGCAGTATCTGCTTTGA3'

[0067] SEQ ID No.2 R-5'GGGTTGTGGCTCAGTGTCAGTTCG3'

[0068] like Figure 2 As shown, by using ultra-long DNA amplification enzyme to amplify the sample, the full-length amplification product of mitochondria can be obtained, and then the third-generation sequencing platform is used to sequence the full-length mitochondrial sequence at one time, without the need to splice the sequencing results.

[0069] The full-length human mitochondrial genome was amplified using ultra-long DNA amplification enzyme, and the full-length DNA sequence was obtained using third-generation sequencing technology.

[0070] Example 2 Verification of the human mitochondrial full-length sequencing method using the primers designed in Example 1 1. Reagents and samples:

[0071] Human genomic DNA-F, human genomic DNA-M (ZYAGEN); KeyPo SE Master mix (Vazyme);

[0072] Primer sequences:

[0073] SEQ ID No.1 F-5'CACCCTATGTCGCAGTATCTGCTTTGA3';

[0074] SEQ ID No. 2 R-5'GGGTTGTGGCTCAGTGTCAGTTCG3'.

[0075] 2. Equipment and instruments: third-generation sequencer, PCR instrument, agarose electrophoresis instrument. Detailed information is shown in Table 2.

[0076] Table 2

[0077] Device Name brand model VeritiPro 96well Thermal Cycler Thermal A47394 UV irradiator BIO-RAD 76S / 03905 SequelⅡ PacBio 64066

[0078] 3. Experimental steps:

[0079] 1) Sample amplification:

[0080] Prepare the amplification system as follows:

[0081] 2xKeyPo SE Master 25μL, Primer F (10uM) 1.5μL, Primer R (10uM) 1.5μL, DNA 10-200ng, add sterile double distilled water to make up to 50μL.

[0082] Amplification was performed according to the following procedure:

[0083] Pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, and the cycle number is 35 times.

[0084] 2) Agarose gel electrophoresis detection:

[0085] Take 5 μL of the amplified product from the previous step for agarose electrophoresis to detect the quality of the amplified product. It can be seen that the amplified band size is about 16k, the amplified band is single, and there is no non-specific amplified band, such as Figure 3 shown. Figure 31: human genomic DNA-F; 2: human genomic DNA-M; M: DL15000 marker.

[0086] 3) Purification of amplified products:

[0087] Purify the PCR amplification product using magnetic beads or other equivalent purification methods.

[0088] a. Take out the VAHTSTM DNA Clean Beads (hereinafter referred to as magnetic beads) from the refrigerator half an hour in advance and place them on a vertical mixer and slowly mix them at room temperature for 30 minutes;

[0089] b. Add 1 volume of DNase / RNase-Free Deionized Water to the PCR product, then add 0.8 volume of magnetic beads, flick to mix or oscillate at low speed, and leave at room temperature for 10 minutes, flicking 2 to 3 times to mix;

[0090] c. Separate the PCR tube instantly, then place it on a magnetic rack to adsorb the magnetic beads for 10 minutes. During this time, prepare 80% alcohol. The alcohol needs to be prepared before use.

[0091] d. Discard the supernatant, then add 200 μL of 80% alcohol along the opposite side of the tube where the magnetic beads are adsorbed, and be sure not to disperse the magnetic beads;

[0092] e. Repeat the previous step and perform alcohol cleaning for the second time;

[0093] f. Discard the alcohol, centrifuge the PCR tube, put it back on the magnetic rack, and discard the residual liquid;

[0094] g. Open the PCR tube and dry it for no more than 30 seconds, then add 12 μL EB Buffer;

[0095] h. Gently flick the beads to mix them evenly, keep them in a mixed state, and place them at room temperature for 10 minutes, flicking them 2 to 3 times during this period;

[0096] i. Separate the PCR tube instantly, then place it on a magnetic rack to adsorb the magnetic beads for 10 minutes;

[0097] j. Transfer 10 μL of supernatant to a new PCR tube;

[0098] 4) Library construction and sequencing:

[0099] According to the instructions of the third-generation sequencing platform, the amplified products were labeled in sequence to construct the sequencing library. Sequencing was performed on the third-generation sequencing platform, and the sequencing results are as follows:

[0100] Human genome DNA-F, sequence is shown in SEQ ID No.3. Human genome DNA-M, sequence is shown in SEQ ID No.4. By performing Blast comparison at NCBI, the comparison consistency between DNA-F and the database reached 99%, and the comparison consistency between DNA-M and the database reached 99%. The results show that the third-generation sequencing technology can be used to sequence the whole genome of human mitochondria with an accuracy rate of 99%, indicating that the present invention provides a new technical means for the application of mitochondrial sequencing in individual identification, kinship determination, etc. in the field of forensic science.

Claims

1. A human mitochondrial genome sequencing primer set based on third-generation sequencing technology, characterized in that The primer F sequence is shown as SEQ ID No.1 and the primer R sequence is shown as SEQ ID No.

2.

2. Use of the primer set according to claim 1 in preparing a human mitochondrial genome sequencing kit based on third-generation sequencing technology.

3. A human mitochondrial genome sequencing kit based on third-generation sequencing technology, characterized in that Comprising the primer set of claim 1.

4. The kit according to claim 3, characterized in that: The concentration of the primer set is: primer F 10uM, primer R 10uM.

5. The kit as claimed in claim 3, characterized in that It also includes amplification reagents, product purification reagents, library construction and sequencing reagents.

6. A method for sequencing the human mitochondrial genome based on third-generation sequencing technology, characterized in that The steps include: (1) amplifying the sample using the primer set described in claim 1; (2) agarose gel electrophoresis detection; (3) Purification of amplified products; (4) Library construction and sequencing.

7. The sequencing method according to claim 6, characterized in that: The amplification system in step (1) is: 2xKeyPo SE Master 25 μL, primer F10uM 1.5 μL, primer R10uM 1.5 μL, DNA 10-200 ng, and sterile double distilled water to 50 μL; the primer F sequence is shown in SEQ ID No.1, and the primer R sequence is shown in SEQ ID No.

2.

8. The sequencing method according to claim 6, characterized in that: The amplification program in step (1) is: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 68°C for 480 sec, and 35 cycles.

9. The sequencing method according to claim 6, characterized in that The steps of constructing the library of the amplified products are: adding tags and adapters to the amplified products to construct a sequencing library.

Images