PCR (Polymerase Chain Reaction) primer, kit and detection method for rapidly identifying whether sugarcane contains saccharum arundinaceum chromosome 4 or not

Abstract

The invention discloses a PCR (Polymerase Chain Reaction) primer, a kit and a detection method for rapidly identifying whether sugarcane contains a saccharum arundinaceum chromosome 4 or not. The PCR primer is TaChr04-F / R, the nucleotide sequence of the PCR primer is shown as SEQ ID NO: 1-2, and through the PCR primer, whether a sugarcane material contains the saccharum arundinaceum chromosome 4 or not can be rapidly detected only by adopting a common PCR technology. The detection method disclosed by the invention is high in efficiency, good in stability, simple and convenient to operate, and very high in practicability and generalization performance.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a PCR primer, a kit and a detection method for quickly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala. Background Art

[0002] Sugarcane is an important sugar crop and energy crop, and its yield and quality are of great significance to the global sugar industry and bioenergy production. As a wild germplasm resource closely related to sugarcane, Imperata sphaerocephala has the advantages of high biomass, wide adaptability, drought resistance, pest and disease resistance, vigorous growth, and good perennial rooting. It is considered to be an important germplasm resource for creating new sugarcane germplasm and breeding breakthrough new sugarcane varieties. However, the precise composition and chromosome inheritance of Imperata sphaerocephala chromosomes in the hybrid offspring of sugarcane and Imperata sphaerocephala are still unclear. In the hybrid breeding process of sugarcane and Imperata sphaerocephala, Imperata sphaerocephala chromosomes cannot be completely paired with sugarcane chromosomes, and there is a phenomenon of chromosome loss. With the increase of backcrossing generations, Imperata sphaerocephala chromosomes will gradually decrease. Therefore, establishing a method for rapid and efficient identification of Imperata sphaerocephala genetic material has important application value in the hybrid breeding of sugarcane and Imperata sphaerocephala.

[0003] Traditional chromosome identification methods, such as cytogenetics, can provide detailed chromosome structure information, but their operation is complex, time-consuming and requires professional equipment and personnel. In recent years, with the rapid development of molecular biology technology, polymerase chain reaction (PCR) technology has gradually become the preferred method for identifying specific chromosomes or genes due to its high sensitivity, specificity and rapidity. However, the PCR identification method for whether sugarcane contains chromosome 4 of Echinochloa crusgalli has not yet been developed. Therefore, the development of a fast, accurate and easy-to-operate PCR primer, kit and detection method has important theoretical and practical significance for improving sugarcane breeding efficiency and accelerating the selection of superior varieties. Summary of the invention

[0004] The purpose of the present invention is to provide a PCR primer, a kit and a detection method for quickly identifying whether sugarcane contains chromosome 4 of Ampelopsis fasciata. The present invention can stably detect whether sugarcane materials contain chromosome 4 of Ampelopsis fasciata through a conventional PCR reaction procedure, and the effect is remarkable.

[0005] In order to achieve the above object, the present invention adopts the following technical solution: The present invention provides a PCR primer for quickly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala. The sequence of the PCR primer is: TaChr04-F: CTGCACCAGAATTTGAGATACAG; TaChr04-R:CTAATCCAACTGGGGACTATACTG.

[0006] The present invention also provides a kit for rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala, and the kit comprises the above-mentioned PCR primers.

[0007] The present invention also provides the use of the PCR primers and the kit in rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala.

[0008] The present invention also provides the use of the PCR primers and the kit in sugarcane breeding.

[0009] A method for rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa crusgalli, comprising the following steps: (1) Extract genomic DNA from sugarcane leaves using the CTAB method; (2) PCR amplification: Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using primers TaChr04-F and TaChr04-R. The results of agar gel electrophoresis were used to identify whether sugarcane contained chromosome 4 of Echinochloa crusgalli.

[0010] Furthermore, the reaction system of the PCR amplification is 12.5 μL of 2×PCR Mix, 2 μL of TaChr04-F, 2 μL of TaChr04-R, 2 μL of 100 ng / μL genomic DNA and 6.5 μL of ddH2O.

[0011] Furthermore, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 35 cycles; final extension at 72°C for 3 min, and storage at 4°C.

[0012] Furthermore, when the agar gel electrophoresis result shows a 1270 bp band, it indicates that the sugarcane contains the Echinochloa crusgalli chromosome 4. If the agar gel electrophoresis result does not show a 1270 bp band, it indicates that the sugarcane does not contain the Echinochloa crusgalli chromosome 4.

[0013] The beneficial effects of the present invention are: (1) High efficiency: The method of the present invention can be used to quickly detect whether the sugarcane material contains chromosome 4 of Ampelopsis fasciata by simply extracting DNA from seedling leaves.

[0014] (2) Good stability: With the use of Imperata sphaerocephala in sugarcane breeding, there is no stable molecular marker for the authenticity of the hybrid offspring of sugarcane and Imperata sphaerocephala in higher generations. However, the method of the present invention can stably detect whether the sugarcane material contains Imperata sphaerocephala chromosome 4 after preliminary experiments.

[0015] (3) Low cost and easy operation: Ordinary PCR technology can be used to detect whether the sugarcane material contains chromosome 4 of Echinochloa crusgalli. In the early stage, it only needs to extract genomic DNA and then perform ordinary PCR amplification detection. It is highly practical and easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the result of chromosome identification of the offspring of Imperata sphaerocephala 1849-10 using GISH and Oligo-FISH; a: red Chr1 and green Chr2; b: red Chr3 and green Chr4; c: red Chr5 and green Chr6; d: red Chr7 and green Chr8; e: red Chr9 and green Chr10; f: Imperata sphaerocephala and Imperata sphaerocephala, the scale bar is 5 μm.

[0017] Figure 2 The results of TaChr04-F / R specific detection; 1~10 correspond to different templates, M: 2000bpMarker; 1: 1723-13; 2: 1849-10; 3: 1849-14; 4: 1891-27; 5: 1891-67; 6: Hainan 92-77; 7: Yunnan 82-114; 8: Badila; 9: ROC22; 10: ddH2O.

[0018] Figure 3 For the stability test of TaChr04-F / R primers, 1-24 correspond to different templates, M: 2000bpMarker; 1: 1723-02; 2: 1723-05; 3: 1723-13; 4: 1723-28; 5: 1723-42; 6: 1849-09; 7: 1849-10; 8: 1849-14; 9: 1849-32; 10: 1849-54; 11:1891-06; 12:1891-12; 13:1891-16; 14:1891-27; 15:1891-71; 16:Hainan92-77; 17:Hainan92-105; 18:Yunnan82-114; 19:Yunnan82-110; 20:Badila; 21:Heicheliben; 22:ROC22; 23:Liucheng05-136; 24:ddH2O. DETAILED DESCRIPTION

[0019] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific embodiments. The embodiments are intended to illustrate the present invention by way of example, rather than to limit the present invention in any form.

[0020] Example 1 1. Test materials Table 1 shows the original species of Ampelopsis sphaerocephala, tropical species, large-stemmed wild species, thin-stemmed wild species and 9 sugarcane materials with sugarcane bloodline, which were used to detect the specificity of primer TaChr04-F / R in Ampelopsis sphaerocephala and sugarcane materials.

[0021] Table 2 shows 23 sugarcane materials, including the original species of Ampelopsis sphaerocephala, tropical species, large-stemmed wild species, thin-stemmed wild species and sugarcane related materials, which were used to detect the stability of primer TaChr04-F / R in Ampelopsis sphaerocephala and sugarcane materials.

[0022] The results of GISH and Oligo-FISH have been used to test whether the hybrid offspring of the sedge have chromosome 4. Taking 1849-10 as an example, the specific detection technology results are as follows: Figure 1 shown.

[0023] Table 1 Specific detection materials Table 2 Stability test materials 2. Detection steps (1) Extraction of gDNA from sugarcane materials: The genomic DNA of sugarcane leaves in Tables 1 and 2 was extracted by the CTAB method. The extracted genomic DNA was detected by an ELISA reader, and its OD260 / OD280 ratio should be between 1.8 and 2.0. It was stored in a -20°C refrigerator for later use.

[0024] (2) PCR amplification and detection: The sequences of PCR primers are as follows: TaChr04-F: CTGCACCAGAATTTGAGATACAG (SEQ ID NO: 1); TaChr04-R: CTAATCCAACTGGGGACTATACTG (SEQ ID NO: 2).

[0025] The above primers were used for PCR amplification. The total PCR amplification reaction system was 25 μl. The specific reaction system was: 2×PCRMix 12.5 μL, 2 μL TaChr04-F, 2 μL TaChr04-R, 2 μL genomic DNA of 100 ng / μL, and 6.5 μL ddH2O. The reaction system was prepared on ice. The PCR reaction procedure was as follows: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 35 cycles; final extension at 72°C for 3 min, storage at 4°C. Detection was performed using 1.5% agarose gel electrophoresis, and photographic analysis was performed using a gel imager. Samples that could amplify the target fragment contained chromosome 4 of Echinops sphaerocephala.

[0026] (3) Analysis of gel electrophoresis results The PCR amplification results of 9 sugarcane materials in Table 1 are as follows Figure 2 As shown, TaChr04-F / R was found to be specific, and all materials with chromosome 4 of Echinochloa crusgalli produced an obvious target band at 1270 bp (TaChr04, SEQ ID NO: 3).

[0027] The PCR amplification results of 23 sugarcane materials and water are shown in Table 2. Figure 3 As shown, the results showed that a specific fragment (SEQ ID NO: 3) was amplified in all the Echinochloa crusgalli materials, but the fragment was not amplified in the Saccharum materials that did not have Echinochloa crusgalli bloodline, indicating that the Echinochloa crusgalli-specific molecular marker TaChr04-F / R has good specificity and can be used as an Echinochloa crusgalli-specific molecular marker to determine whether the sugarcane material contains Echinochloa crusgalli chromosome 4.

[0028] The nucleotide sequence of TaChr04 is as follows:

[0029] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A PCR primer for rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala, characterized in that: The sequences of the PCR primers are: TaChr04-F:CTGCACCAGAATTTGAGATACAG; TaChr04-R:CTAATCCAACTGGGGACTATACTG.

2. A kit for rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala, characterized in that: The kit comprises the primers according to claim 1.

3. Use of the PCR primers according to claim 1 and the kit according to claim 2 in rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala.

4. Use of the PCR primers according to claim 1 and the kit according to claim 2 in sugarcane breeding.

5. A method for rapidly identifying whether sugarcane contains chromosome 4 of Echinochloa sphaerocephala, characterized in that: The following steps are involved: (1) Extract genomic DNA from sugarcane leaves using the CTAB method; (2) PCR amplification: Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using primers TaChr04-F and TaChr04-R. The results of agar gel electrophoresis were used to identify whether sugarcane contained chromosome 4 of Echinochloa crusgalli.

6. The method for rapidly identifying whether sugarcane contains Chromosome 4 of Echinochloa crusgalli according to claim 5, characterized in that: The PCR amplification reaction system was 12.5 μL of 2×PCR Mix, 2 μL of TaChr04-F, 2 μL of TaChr04-R, 2 μL of 100 ng / μL genomic DNA, and 6.5 μL of ddH2O.

7. The method for rapidly identifying whether sugarcane contains Chromosome 4 of Echinochloa crusgalli according to claim 5, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 35 cycles; final extension at 72°C for 3 min, and storage at 4°C.

8. The method for rapidly identifying whether sugarcane contains Chromosome 4 of Echinochloa crusgalli according to claim 5, characterized in that: When the agar gel electrophoresis result shows a 1270 bp band, it indicates that the sugarcane contains chromosome 4 of Echinochloa crusgalli. If the agar gel electrophoresis result does not show a 1270 bp band, it indicates that the sugarcane does not contain chromosome 4 of Echinochloa crusgalli.

Images