Molecular marker and detection method for identifying Wuzhishan wild camellia oleifera

Abstract

The invention belongs to the technical field of molecular biological identification, and discloses a molecular marker for identifying Wuzhishan wild camellia oleifera as well as application and a detection method of the molecular marker. The invention provides a novel camellia abelmoschus resource InDel molecular marker, and camellia abelmoschus which is confirmed to be a new species can be distinguished and identified by using the molecular marker. According to the found InDel molecular marker, a specific primer pair for detecting the InDel sites is designed, and a detection method is created, so that the camellia oleifera abel can be accurately distinguished from other camellia oleifera abel species, and the detection result is accurate and reliable. The method disclosed by the invention has important application significance in scientifically protecting germplasm resource diversity of the camellia oleifera abel, researching genetic protection and genetic evolution of the camellia oleifera abel resources and genetic breeding of the camellia oleifera abel.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biological identification, and in particular to a molecular marker and a detection method for identifying Wuzhishan wild oil-tea tea. Background Art

[0002] Camellia Camellia ) is the most species-rich genus in the Theaceae family and has significant economic value. Species of this genus are mainly distributed in tropical and subtropical regions of East Asia, of which more than 80% are distributed in China. Some species in the genus Camellia are characterized by their high oil content in seeds, collectively known as oil tea, mainly including various species of the oil tea group. Common oil tea ( C. oleifera Abel) is the most widely planted variety and is known as one of the four major woody oil crops in the world. It has huge development potential and is the main cultivated variety for woody edible oil.

[0003] Hainan Province has a long history of camellia cultivation. However, despite the important economic value of camellia, the taxonomic research of Camellia species in Hainan still faces great challenges. Traditional classification methods have certain limitations in species identification and distribution surveys, resulting in the lack of clarity on the specific classification of camellia species in Hainan. Some studies classify Hainan native camellia as common camellia ( C. oleifera )、Vietnamese Tea( C. drupifera Loureiro) or its geographical subspecies. However, the accuracy of these classification results has been questioned due to the significant differences in morphology, ecology and economic traits among these species.

[0004] In recent years, with the development of molecular biology technology, the germplasm resources of Hainan's native oil-tea camellia have been gradually clarified. Studies have shown that the main oil-tea camellia cultivated in Hainan should be classified as a new species - Hainan oil-tea camellia ( C. hainanica YL Zhao etZG Xu, sp. nov.). In further analysis of the native Camellia oleifera population in Hainan, it was found that the wild decaploid population in Wuzhishan area was similar to that in Hainan ( C. hainanica ) have significant differences in morphological characteristics. Through comprehensive identification using morphological and molecular techniques, Wuzhishan Camellia oleifera ( C. wuzhishanensis HGLai, HYHu & C.Z.Xie, sp. nov.) was confirmed as another new species. Wuzhishan Camellia oleifera was first discovered in the core area of ​​Maorui Branch of Tropical Rainforest National Park in Changhao Township, Wuzhishan City, Hainan Province, representing the original ecological wild resources of Hainan Tropical Camellia oleifera (Mountain Pomelo), marking the first discovery of wild populations of Camellia oleifera in Hainan tropical rainforest.

[0005] The discovery of Wuzhishan Camellia oleifera germplasm has important scientific research value, especially providing new clues in the study of the origin and evolution of Camellia oleifera resources. In addition, this population has potential significance for the restoration and protection of tropical rainforest ecosystems. In order to better protect and utilize the genetic resources of Wuzhishan Camellia oleifera, it is urgent to establish a set of efficient and accurate identification technology and evaluation system. This will not only help to scientifically preserve its germplasm resources, but also promote the application research of this species in genetic diversity protection, ecological restoration and breeding. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker for identifying Wuzhishan wild oil-tea camellia, and its application and detection method in view of the above problems.

[0007] In order to achieve its purpose, the present invention adopts the following technical solution: The first aspect of the present invention provides a molecular marker for identifying Wuzhishan Camellia oleifera, wherein the molecular marker is an InDel marker, and the InDel marker includes any one or more combinations of InDel marker 1, InDel marker 2 and InDel marker 3: The InDel marker 1 is located in the trnS-GCU and trnG-GCC gene interval sequences of the chloroplast genome. For Wuzhishan Camellia oleifera, it has a characteristic sequence shown in SEQ ID NO.10, that is, the "GAAAAC" base sequence is missing after the 40th base of SEQ ID NO.11; The InDel marker 2 is located on the rpoC2 gene sequence of the chloroplast genome. For Wuzhishan oil-tea camellia, it has a characteristic sequence shown in SEQ ID NO.12, that is, the "ATACCT" base sequence is missing after the 91st base of SEQ ID NO.13; The InDel marker 3 is located on the ycf1 gene sequence of the chloroplast genome. For Wuzhishan Camellia oleifera, it has a characteristic sequence shown in SEQ ID NO.14, that is, it has a "AAAAAA" base sequence after the 165th base.

[0008] A second aspect of the present invention provides a specific primer pair for detecting the molecular marker described above: The primer pair used to detect the InDel marker 1 includes the upstream and downstream primers shown in the following nucleotide sequence: trnS-trnG-01 upstream primer: 5′-CGAGCCGTATCTATCAAAATTCC-3′; trnS-trnG-01 downstream primer: 5′-GAACAGGGAATTGGGCGTAA-3′; The primer pair used to detect the InDel marker 2 includes the upstream and downstream primers shown in the following nucleotide sequence: rpoC2-01 upstream primer: 5′-TCCCGACCTCTTTCTTCTGT-3′; rpoC2-01 downstream primer: 5′-CGAATCGTATGCACTGGTCA-3′; The primer pair used to detect the InDel marker 3 includes the upstream and downstream primers shown in the following nucleotide sequence: ycf1-02 upstream primer: 5′-TGCTACTTCTATCCGCGCTT-3′; ycf1-02 downstream primer: 5'-TCAATGCGAGCCCAAAGATG-3'.

[0009] The third aspect of the present invention provides a kit for detecting the above-mentioned molecular markers, comprising the above-mentioned specific primer pair.

[0010] Preferably, the kit further comprises a camellia oleifera genomic DNA extraction reagent and a PCR amplification reaction reagent.

[0011] The fourth aspect of the present invention provides the use of the above-mentioned molecular marker or the above-mentioned specific primer pair or the above-mentioned kit in identifying and distinguishing Wuzhishan Camellia oleifera.

[0012] The application technology scheme is used to identify and distinguish Wuzhishan oil tea from other oil tea species, and the other oil tea species include Hainan oil tea, Vietnam oil tea, common oil tea, and large-leaf tea.

[0013] A fifth aspect of the present invention provides a detection method for identifying Wuzhishan Camellia oleifera, comprising the following steps: (1) extracting genomic DNA of the tea oil sample to be tested; (2) using the genomic DNA as a template and performing PCR amplification with the above-mentioned specific primer pair; (3) Sequencing the PCR amplification product and determining whether the oil-tea camellia sample is Wuzhishan oil-tea camellia based on the sequencing result.

[0014] In the above detection method, if the PCR amplification product has the characteristic sequence shown by SEQ ID NO.10 or SEQ ID NO.12 or SEQ ID NO.14, the oil-tea camellia sample to be tested is judged to be Wuzhishan oil-tea camellia; otherwise, it is judged to be not Wuzhishan oil-tea camellia.

[0015] Preferably, the above detection method is used to identify and distinguish Wuzhishan oil-tea camellia and Hainan oil-tea camellia. If the PCR amplification product has the characteristic sequence shown in SEQ ID NO.11 or SEQ ID NO.13 or SEQ ID NO.15, the oil-tea camellia sample to be tested is judged to be Hainan oil-tea camellia.

[0016] Preferably, in the above detection method, the PCR reaction system for PCR amplification is: 30 μL of the system contains 20 ng of template DNA, 0.20 mmol / L of dNTPs, 0.13 umo1 / L of upstream / downstream primers, 2.00 U of Taq DNA polymerase, and ddH2O to a total volume of 30 μL; Amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; extension at 72°C for 10 min.

[0017] The beneficial effects of the present invention are: The present invention provides a new InDel molecular marker of Wuzhishan oil-tea resources. With the molecular marker, the Wuzhishan oil-tea that has been confirmed as a new species can be distinguished and identified. According to the found InDel molecular marker, a specific primer pair for detecting these InDel sites is designed, and a detection method is created, which can accurately distinguish Wuzhishan oil-tea from other oil-tea species, and the detection result is accurate and reliable. The present invention has important application significance for scientifically protecting the diversity of Wuzhishan oil-tea germplasm resources, studying the genetic protection and genetic evolution of Wuzhishan oil-tea resources, and the genetic breeding of Wuzhishan oil-tea. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the locations of InDel sites 1, 2, and 3 in the chloroplast genome.

[0019] Figure 2 This is the result of polymorphic sequence comparison of the products amplified by primer pair trnS-trnG-01 in the wild Wuzhishan Camellia oleifera population and the Hainan Camellia oleifera population.

[0020] Figure 3 This is the result of polymorphic sequence comparison of the products amplified by primer pair rpoC2-01 in the wild Wuzhishan Camellia oleifera population and the Hainan Camellia oleifera population.

[0021] Figure 4 This is the result of polymorphic sequence comparison of the products amplified by primer pair ycf1-02 in the wild Wuzhishan Camellia oleifera population and the Hainan Camellia oleifera population.

[0022] Figure 2-Figure 4 middle, Camellia wuzhishanensis is the reference sequence of the chloroplast genome of Wuzhishan oil-tea camellia; Camellia hainanica is the reference sequence of the chloroplast genome of Hainan oil tea; W_primer1 is the amplification product sequence of the Wuzhishan Camellia oleifera trnS-trnG-01 primer pair; H_primer1 is the amplification product sequence of the Hainan oil-tea camellia trnS-trnG-01 primer pair; W_primer2 is the amplification product sequence of the Wuzhishan Camellia oleifera rpoC2-01 primer pair; H_primer2 is the amplification product sequence of the Hainan oil-tea camellia rpoC2-01 primer pair; W_primer3 is the amplification product sequence of the Wuzhishan Camellia oleifera ycf1-02 primer pair; H_primer3 is the amplification product sequence of the Hainan oil-tea camellia ycf1-02 primer pair. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] Unless otherwise specified, the methods involved in the following embodiments are all conventional methods.

[0025] Example 1: Development of InDel Molecular Markers for Chlorsomes in Camellia oleifera L. from Wuzhishan, Hainan 1. Test materials The insertion-deletion (InDel) molecular markers of chloroplasts in Wuzhishan oil-tea leaves in Hainan were developed based on 231 samples: 14 wild Wuzhishan oil-tea leaves and 125 Hainan oil-tea leaves were collected from Hainan Province; 23 Vietnamese oil-tea leaves and 13 Hainan oil-tea leaves were collected from Guangdong; 23 Vietnamese oil-tea leaves and 11 common oil-tea leaves were collected from Guangxi; 12 Vietnamese oil-tea leaves and 10 large-leaf tea leaves from the same genus as a reference outgroup were collected from Vietnam. All samples were collected from trees over 30 years old, and the collection points of Hainan oil-tea leaves were evenly distributed in 17 regions across the island. A total of 231 germplasm samples were identified using morphological methods and subjected to chloroplast whole genome resequencing, assembly annotation and genome comparative analysis to obtain specific InDel polymorphic sites in oil-tea germplasm resources in different regions. Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd.

[0026] Table 1. Experimental materials for the development of InDel molecular markers in Wuzhishan Camellia oleifera

[0027] 2. InDel molecular marker development process Take 0.02 g of dry leaves of the sample to be tested, add liquid nitrogen to grind thoroughly, and use the modified CTAB method to extract the whole genome DNA of the sample. The second-generation sequencing platform was used to obtain the chloroplast whole genome resequencing data of Hainan Camellia oleifera, Wuzhishan Camellia oleifera, Vietnam Camellia oleifera, common Camellia oleifera and large-leaf Camellia. Before assembly, fastp software was used to filter the raw data, and the fragments with adapters and low sequencing quality data with a quality score of less than 20 were removed. GetOrganelle software was used to assemble the chloroplast genome, and CPGAVAS2 was used for annotation. The assembled chloroplast genome was aligned with mafft software, and the alignment results were imported into DnaSP software. Find the position of the highly variable region in the Excel table, open it in GENEdoc, correspond to the specific position of the corresponding InDel in the sequence itself, and locate it in the annotation GB file. A total of 3 InDel polymorphic sites unique to Wuzhishan Camellia oleifera located in the single copy region were found.

[0028] (1) InDel site 1 InDel site 1: This InDel site is a "GAAAAC" base sequence deletion, located in the trnS-GCU and trnG-GCC gene interval sequence of the chloroplast genome of Camellia oleifera. The Wuzhishan Camellia oleifera lacks the "GAAAAC" base sequence after the 206th nucleotide in the chloroplast genome sequence shown in SEQ ID NO.1, while the other four species in Table 1 have "GAAAAC" in this sequence (SEQ ID NO.1 shows the gene sequences of these four species).

[0029] (2) InDel site 2 InDel site 2: This InDel site is a deletion of the "ATACCT" base sequence and is located on the rpoC2 gene sequence of the chloroplast genome of Camellia oleifera. The Wuzhishan Camellia oleifera lacks the "ATACCT" base sequence after the 200th nucleotide of the rpoC2 gene sequence shown in SEQ ID NO.2, while the other four species in Table 1 have "ATACCT" in this sequence (SEQ ID NO.2 shows the gene sequences of these four species).

[0030] (3) InDel site 3 InDel site 3: This InDel site is an "AAAAAA" base sequence insertion, located on the ycf1 gene sequence of the chloroplast genome of Camellia oleifera. The nucleotide sequence of positions 199-204 of the ycf1 gene sequence of Wuzhishan Camellia oleifera shown in SEQ ID NO.3 is "AAAAAA" (SEQ ID NO.3 shows the gene sequence of Wuzhishan Camellia oleifera), while the other four species in Table 1 lack the "AAAAAA" sequence at this site.

[0031] The positions of InDel sites 1, 2, and 3 in the chloroplast genome are as follows: Figure 1 The sequencing results of InDel sites of 231 oil-tea camellia samples are shown in Table 2.

[0032] Table 2 Sequencing results of InDel sites of Camellia oleifera samples

[0033] 3. Design specific primer pairs for identifying InDel sites According to the positions of the above three specific InDels, the target region was extracted using the extractseq command of Linux. The web version of primer3 (https: / / bioinfo.ut.ee / primer3 / ) was used to design specific primer pairs for identifying the above InDel sites. The most preferred primer pairs are as follows: (1) Specific primer pair trnS-trnG-01 for identifying InDel site 1 trnS-trnG-01 upstream primer (SEQ ID NO.4): 5'-CGAGCCGTATCTATCAAAATTCC-3'; trnS-trnG-01 downstream primer (SEQ ID NO.5): 5′-GAACAGGGAATTGGGCGTAA-3′.

[0034] (2) Specific primer pair rpoC2-01 for identifying InDel site 2 rpoC2-01 upstream primer (SEQ ID NO.6): 5′-TCCCGACCTCTTTCTTCTGT-3′; rpoC2-01 downstream primer (SEQ ID NO.7): 5′-CGAATCGTATGCACTGGTCA-3′.

[0035] (3) Specific primer pair ycf1-02 for identifying InDel site 3 ycf1-02 upstream primer (SEQ ID NO.8): 5′-TGCTACTTCTATCCGCGCTT-3′; ycf1-02 downstream primer (SEQ ID NO.9): 5′-TCAATGCGAGCCCAAAGATG-3′.

[0036] Example 2: Molecular identification of oil-tea camellia germplasm resources in Wuzhishan, Hainan 1. Select experimental materials The test material was wild Wuzhishan Camellia oleifera from Hainan ( C. wuzhishanensis ) population and Hainan Camellia oleifera ( C. hainanica ) Seedling population, 10 Wuzhishan Camellia oleifera samples and 10 Hainan Camellia oleifera samples.

[0037] 2. Indel Marker Detection 2.1 DNA extraction: The modified CTAB method was used to extract the total DNA from the Wuzhishan Camellia oleifera and Hainan Camellia oleifera leaf samples.

[0038] 2.2 PCR amplification: The sample DNA extracted in step 2.1 was used as an amplification template, and the specific labeled primer pairs trnS-trnG-01, rpoC2-01 and ycf1-02 in Example 1 were used as amplification primers to perform PCR amplification.

[0039] PCR reaction system (30 μL): contains 20 ng template DNA, 0.20 mmol / L dNTPs, 0.13 umo1 / L upstream / downstream primers, 2.00 U Taq DNA polymerase, and ddH2O to a total volume of 30 μL; the PCR amplification reagent is 2×Phanta Max Master Mix from Nanjing Novozymes Biotech Co., Ltd.

[0040] PCR amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; extension at 72°C for 10 min.

[0041] 2.5 Sequencing of PCR amplification products: The PCR products were subjected to Sanger sequencing.

[0042] (1) Detection results of primer pair trnS-trnG-01 Test results such as Figure 2 As shown, after sequencing and analysis, the sequence of the PCR amplification products of all Wuzhishan oil-tea samples is shown in SEQ ID NO.10, and the "GAAAAC" base sequence (i.e., InDel site 1) is missing after the 40th base of the sequence shown in SEQ ID NO.10. The sequence of the PCR amplification products of all Hainan oil-tea samples is shown in SEQ ID NO.11, and the "GAAAAC" base sequence is present after the 40th base.

[0043] InDel site 1 and its flanking sequences are as follows: Wuzhishan Camellia oleifera (SEQ ID NO.10): CGAGCCGTATCTATCAAAATTCCTCCAGTAAAAGAAAAGA------TTCTTTTTTAGTTATTTAAATGAATCCTCTTTTCCGAATCTAATTAAACCCCCACGAAAAAAGTTAACACTCTAATTTTCATGATTTTTTTATGATCCTATCTTGATTACGCCCAATTCCCTGTTC.

[0044] Hainan Camellia oleifera (SEQ ID NO.11, the underlined part is the missing base sequence of Wuzhishan Camellia oleifera): CGAGCCGTATCTATCAAAATTCCTCCAGTAAAAGAAAAGA GAAAAC TTCTTTTTAGTTATTTAAATGAATCCTCTTTTCCGAATCTAATTAAACCCCCACGAAAAAAGTTAACACTCTAATTTTCATGATTTTTTTTATGATCCTATCTTGATTACGCCCAATTCCCTGTTC.

[0045] (2) Primer pair rpoC2-01 detection results Test results such as Figure 3 As shown, after sequencing and analysis, the sequence of the PCR amplification products of all Wuzhishan oil-tea camellia samples is shown in SEQ ID NO.12, and the "ATACCT" base sequence (i.e., InDel site 2) is missing after the 91st base of the sequence shown in SEQ ID NO.12. The sequence of the PCR amplification products of all Hainan oil-tea camellia samples is shown in SEQ ID NO.13, and the "ATACCT" base sequence is present at the corresponding position.

[0046] InDel site 2 and its flanking sequences are as follows: Wuzhishan Camellia oleifera (SEQ ID NO.12): TCCCGACCTCTTTCTTCTTGTATCGAGGATCATCGAAATAAGCAAGAATACTCTTTCTACGGAAAATACCATTTATGGGTATTTCAATCGAA------GAAGGGGGCATTAGTTCTTTCTCGTTCTTGAATCGAATGGAGTGGAATGATGAATCTATTTCTTCGCCTCTTTGCCAATAAATCCGAATTATCGTGGAGAATGGAAGGATAGATAAGATTATAATGACCAGTGCATACGATTCG.

[0047] Hainan Camellia oleifera (SEQ ID NO. 13, the underlined part is the missing base sequence of Wuzhishan Camellia oleifera): TCCCGACCTCTTTCTCTGTATCGAGGATCATCGAAATAAGCAAGAATACTCTTTCTACGGAAAATACATTTATGGGTATTTCAATCGAA ATACCT GAAGGGGGCATTAGTTCTTTCTCTCGTTCTTGAATCGAATGGAGTGGAATGATGAATCTATTTCTTCGCCTCTTTGCCAATAAATCCGAATTATCGTGGAGAATGGAAGGATAGATAAGATTATAATGACCAGTGCATACGATTCG.

[0048] (3) Detection results of primer pair ycf1-02 Test results such as Figure 4 As shown, after sequencing and identification analysis, the sequence of the PCR amplification products of all Wuzhishan oil-tea camellia samples is shown in SEQ ID NO.14, and there is a "AAAAAA" base sequence (i.e., InDel site 3) after the 165th base of the sequence shown in SEQ ID NO.14. The sequence of the PCR amplification products of all Hainan oil-tea camellia samples is shown in SEQ ID NO.15, and there is a missing "AAAAAA" base sequence at the corresponding position.

[0049] InDel site 3 and its flanking sequences are as follows: Wuzhishan Camellia oleifera (SEQ ID NO.14, the underlined part is the base sequence inserted into Wuzhishan Camellia oleifera): TGCTACTTCTATCCGCGCTTTCTCTTTTCTTTTGTTCTCTTCTTTTTTGTCCTTTTCCTTTTTTTCCCTTTCTTTTATTTCTTCTTCTGTATAATCTGAAATTTTGAATTCTGCTCCCTTTCCTATACAATTTCTAAAAATGAGTTTTATCAGTTTGGAGATATC AAAAAA AAAAAAAAAAGGGTGTGATTTGTCTATTCTGTCCAAAAAAAGCGGAGAATGTGCATTTGCTTGAAAAAGTTCCCAAATAACTGTTTTACATCTTTGGGCTCGCATTGA。

[0050] Camellia oleifera Abel. from Hainan (SEQ ID NO.15): TGCTACTTCTATCCGCGCTTTCTCTTTTCTTTTGTTCTCTTCTTTTTTGTCCTTTTCCTTTTTTTCCCTTTCTTTTATTTCTTCTTCTGTATAATCTGAAATTTTGAATTCTGCTCCCTTTCCTATACAATTTCTAAAAATGAGTTTTATCAGTTTGGAGATATC------AAAAAAAAAAGGGTGTGATTTGTCTATTCTGTCCAAAAAAAGCGGAGAATGTGCATTTGCTTGAAAAAGTTCCCAAATAACTGTTTTACATCTTTGGGCTCGCATTGA。

Claims

1. A molecular marker for identifying Wuzhishan Camellia oleifera, characterized in that: The molecular marker is an InDel marker, and the InDel marker includes any one or more combinations of InDel marker 1, InDel marker 2 and InDel marker 3: The InDel marker 1 is located in the trnS-GCU and trnG-GCC gene interval sequences of the chloroplast genome. For Wuzhishan Camellia oleifera, it has a characteristic sequence shown in SEQ ID NO.10, that is, the "GAAAAC" base sequence is missing after the 40th base of SEQ ID NO.11; The InDel marker 2 is located on the rpoC2 gene sequence of the chloroplast genome. For Wuzhishan oil-tea camellia, it has a characteristic sequence shown in SEQ ID NO.12, that is, the "ATACCT" base sequence is missing after the 91st base of SEQ ID NO.13; The InDel marker 3 is located on the ycf1 gene sequence of the chloroplast genome. For Wuzhishan Camellia oleifera, it has a characteristic sequence shown in SEQ ID NO. 14, that is, it has a "AAAAAA" base sequence after the 165th base.

2. A specific primer pair for detecting the molecular marker according to claim 1, characterized in that: The primer pair used to detect the InDel marker 1 includes the upstream and downstream primers shown in the following nucleotide sequence: trnS-trnG-01 upstream primer: 5′-CGAGCCGTATCTATCAAAATTCC-3′; trnS-trnG-01 downstream primer: 5′-GAACAGGGAATTGGGCGTAA-3′; The primer pair used to detect the InDel marker 2 includes the upstream and downstream primers shown in the following nucleotide sequence: rpoC2-01 upstream primer: 5′-TCCCGACCTCTTTCTTCTGT-3′; rpoC2-01 downstream primer: 5′-CGAATCGTATGCACTGGTCA-3′; The primer pair used to detect the InDel marker 3 includes the upstream and downstream primers shown in the following nucleotide sequence: ycf1-02 upstream primer: 5′-TGCTACTTCTATCCGCGCTT-3′; ycf1-02 downstream primer: 5'-TCAATGCGAGCCCAAAGATG-3'.

3. A kit for detecting the molecular marker according to claim 1, characterized in that: Comprising the specific primer pair described in claim 2.

4. The kit according to claim 3, characterized in that: It also contains Camellia oleifera genomic DNA extraction reagent and PCR amplification reaction reagent.

5. Use of the molecular marker according to claim 1, the specific primer pair according to claim 2, or the kit according to claim 3 or 4 in identifying and distinguishing Wuzhishan Camellia oleifera.

6. The use according to claim 5, characterized in that: Identify and distinguish Wuzhishan oil tea from other oil tea species, including Hainan oil tea, Vietnam oil tea, common oil tea, and large-leaf tea.

7. A detection method for identifying Wuzhishan Camellia oleifera, characterized in that: The steps include: (1) extracting genomic DNA of the tea oil sample to be tested; (2) using the genomic DNA as a template and performing PCR amplification using the specific primer pair described in claim 2; (3) Sequencing the PCR amplification product and determining whether the oil-tea camellia sample is Wuzhishan oil-tea camellia based on the sequencing result.

8. The detection method according to claim 7, characterized in that: If the PCR amplification product has the characteristic sequence shown by SEQ ID NO.10 or SEQ ID NO.12 or SEQ ID NO.14, the oil-tea camellia sample to be tested is judged to be Wuzhishan oil-tea camellia; otherwise, it is judged to be not Wuzhishan oil-tea camellia.

9. The detection method according to claim 8, characterized in that: The detection method is used to identify and distinguish Wuzhishan oil-tea camellia and Hainan oil-tea camellia. If the PCR amplification product has a characteristic sequence shown in SEQ ID NO.11 or SEQ ID NO.13 or SEQ ID NO.15, the oil-tea camellia sample to be tested is judged to be Hainan oil-tea camellia.

10. The detection method according to claim 7, characterized in that: The PCR reaction system for the PCR amplification is as follows: 30 μL of the system contains 20 ng of template DNA, 0.20 mmol / L of dNTPs, 0.13 umo1 / L of upstream / downstream primers, 2.00 U of Taq DNA polymerase, and ddH2O to a total volume of 30 μL; Amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; extension at 72°C for 10 min.

Images