Phytophthora sojae ADF protein as well as coding gene and application thereof

Abstract

The invention discloses an ADF protein from phytophthora as well as a coding gene and application thereof. According to the present invention, the PsADF protein provided by the present invention is the protein represented by sequences 2 and 5 in Phytophthora sojae (Phytophthora sojae); the coding gene is shown as a sequence 3 and a sequence 4. Tests prove that the protein provided by the invention plays an important role in the growth and development process of phytophthora sojae, specifically, after the 64-site mutation of the key amino acid functional site of the protein, the sporangium abnormality and zoospore quantity of the phytophthora sojae are reduced, and the pathogenicity is reduced. The protein provided by the invention has very high application value in control of epidemic disease occurrence and epidemic caused by phytophthora, and provides a molecular target for research and development of novel bactericides in the future. The corresponding ADF inhibitors have different degrees of activity on typical plant pathogenic oomycetes such as phytophthora sojae, phytophthora capsici and phytophthora infestans. The protein provided by the invention has great application potential in the aspect of preventing and controlling the crop epidemic diseases caused by phytophthora plant pathogenic oomycetes, and a novel bactericide developed based on the protein as an action target has important practical significance in controlling the occurrence and prevalence of the crop epidemic diseases caused by phytophthora.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to an ADF (Actin-depolymerizing factor) protein PsADF from Phytophthora sojae and its encoding gene and application; in particular, it relates to an ADF from Phytophthora spp. in plant pathogenic oomycetes and its encoding gene and application. Background Art

[0002] Oomycetes are a class of eukaryotic microorganisms that are morphologically similar to filamentous fungi. They have a wide range of hosts and infect plants, insects, crustaceans, and vertebrates. More than 800 species of oomycetes have been reported, including Phytophthora, Pythium, Plasmopara, and Sclerospora. Among them, Phytophthora oomycetes infect a wide variety of crops, causing serious economic losses by infecting a variety of agricultural, forest, ornamental, and ecological plants. Due to the differences in phylogeny between oomycetes and filamentous fungi and the increasingly serious problem of drug resistance, the development of oomycete fungicides based on new targets is particularly important and urgent. In addition, with the continuous in-depth analysis of the mechanism of action of fungicides, people have begun to pay more attention to the development of new oomycete inhibitors targeting key binding sites of proteins.

[0003] Phytophthora sojae is one of the top ten plant pathogenic oomycetes. The soybean root rot and stem rot caused by it cause huge economic losses every year. Phytophthora sojae can cause soybean seeds to rot, roots to rot, stems to rot, and seedlings to wilt. The typical symptoms of infected soybean plants are rot from the roots, gradually spreading from bottom to top along the stem, and forming brown spots at the base of the stem. The life cycle of Phytophthora sojae is divided into an asexual stage and a sexual stage. In the sexual reproduction stage, Phytophthora sojae can form oospores through homothallic mating. The oospores have thick walls and rich contents. Under suitable conditions, as the primary infection source, they can directly germinate to produce hyphae to infect host plants. In the asexual reproduction stage, the sporangium of Phytophthora sojae can directly germinate to form hyphae, or differentiate to form zoospores, indirectly carrying out the infection cycle of the disease. Zoospores have a short lifespan and quickly form resting spores, which then germinate into hyphae. They invade the roots directly through germinated hyphae or through wounds or natural openings. Once they enter the plant, they parasitize the plant body in the form of hyphae and continue to expand, forming lesions. In view of the widespread occurrence of soybean root rot, complex causes, and difficulty in monitoring and prevention, on February 13, 2023, the Crop Production Management Department of the Ministry of Agriculture and Rural Affairs first recommended that the disease be added as a Class I crop disease in my country, which urgently needs attention. Drug control is a key strategy for controlling oomycetes such as soybean phytophthora, but the small number of effective agents and the increasing resistance to drugs are practical problems facing oomycetes. Therefore, the development of new oomycete inhibitors is particularly important.

[0004] ADF protein is a type of actin depolymerization factor and the main regulator of the existence form of actin. It has a long conserved α-helix that plays a role in binding to actin and promoting the depolymerization of actin filaments. Eukaryotic microorganisms (such as Saccharomyces cerevisiae) generally contain only one ADF protein, while mammals express 5 ADF proteins in humans and 6 ADF proteins in mice. Plants can express multiple ADF proteins, such as 12 in Arabidopsis, 11 in soybeans, and 15 in rice. They can play an important role in cytoplasmic division, cell movement, cell elongation, cell stress response, and resistance to pathogen invasion. However, there has been no systematic report on the function of ADF proteins in plant pathogenic oomycetes.

[0005] In summary, the formation of sporangia and zoospores of Phytophthora is an important factor affecting the occurrence and development of diseases. If the formation of sporangia and zoospores of Phytophthora can be blocked and the ability of pathogens to infect host plants can be reduced, the root rot and other hazards caused by Phytophthora can be controlled. Compared with fungi, there are fewer drugs used for the prevention and treatment of oomycete diseases. In addition, due to the increasingly serious problem of drug resistance in the field, it is urgent to develop oomycete fungicides with new drug targets. The present invention has important guiding significance for the creation of new oomycete inhibitors with ADF as molecular targets. Summary of the invention

[0006] The inventors found through their research that there is only one ADF gene in Phytophthora sojae, which is difficult to knock out. However, the amino acid mutation at the key 64 sites of PsADF protein is closely related to the formation of sporangium and the production of zoospores and pathogenicity of Phytophthora sojae. In addition, the overexpression of PsADF protein affects the formation of sporangium and the production of zoospores of Phytophthora sojae, while the normal infection cycle of plant diseases is positively correlated with sporangium, zoospores and survival time. Therefore, the function of the key amino acid sites of PsADF protein can be regulated to block the normal sporangium formation, reduce the number of zoospores, and weaken the ability of Phytophthora sojae to infect the host, thereby controlling the occurrence and development of Phytophthora sojae root rot. Combined with the high similarity and genetic conservation of ADF protein sequences of three common Phytophthora plant pathogenic oomycetes, such as Phytophthora sojae, Phytophthora capsici, and Phytophthora infestans, it is fully demonstrated from a biological level that this type of protein plays an important role in Phytophthora plant pathogenic oomycetes. In order to test the potential of ADF protein as a target for fungicides against plant pathogenic oomycetes of the genus Phytophthora, the protein structures of three plant pathogenic oomycetes ADF of the genus Phytophthora were predicted by homology modeling Alpha fold2. The virtual screening software Schrodinger Maestro 12.8 was used to conduct virtual screening of small molecule active compounds. The small molecule compound ligands were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). Based on the binding ability of ADF protein with small molecule compounds, the structure of small molecule compounds, and their inhibitory activity on the mycelial growth of three Phytophthora fungi, a small molecule inhibitor lead compound was screened out. Molecular docking of this small molecule inhibitor lead compound with the ADF proteins of Phytophthora capsici, Phytophthora sojae, and Phytophthora infestans showed that it had good binding affinity with the ADF proteins of these three Phytophthora. The above results fully demonstrate that ADF protein has the potential to be a molecular agent target for plant pathogenic oomycetes of the genus Phytophthora and has important application prospects.

[0007] Therefore, one of the purposes of the present invention is to provide a class of soybean Phytophthora ADF and its protein after the key amino acid mutation at position 64, named PsADF, PsADF N64A , derived from soybean Phytophthora strain P6497, is as follows A1) or A2) or A3) or A4):

[0008] A1) The amino acid sequence is the protein shown in SEQ ID NO: 2,5;

[0009] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NOs. 2 and 5;

[0010] A3) a protein derived from the protein shown in SEQ ID NO: 2 or 5 having the same function as the protein shown in SEQ ID NO: 2 or 5, obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2 or 5;

[0011] A4) An amino acid sequence that has a similarity of more than 85%, preferably more than 90%, and more preferably more than 95% with the amino acid sequence shown in SEQ ID NO: 2 or 5 and has the same function as the amino acid sequence shown in SEQ ID NO: 2 or 5.

[0012] In order to facilitate the purification of the protein in A1), tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) can be connected to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in sequence 2, 5 in the sequence table.

[0013] The proteins in A1)-A4) above can be synthesized artificially, or their coding genes can be synthesized first and then expressed biologically. The coding genes of the proteins in A2)-A4) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in sequence 3 in the sequence table, and / or performing missense mutations of one or several nucleotide pairs, and / or connecting the coding sequence of the above tag at its 5' end and / or 3' end.

[0014] Among them, in A1), sequences 2 and 5 (PsADF, PsADF N64A ) consists of 143 amino acid residues.

[0015] The second object of the present invention is to provide a nucleic acid molecule encoding the PsADF and its key amino acid site mutated protein. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA, hnRNA or tRNA.

[0016] Among them, the coding genes of the above-mentioned PsADF and its key amino acid site mutated proteins are as follows B1) or B2) or B3):

[0017] B1) a DNA molecule represented by the nucleotide sequence described in Sequence 1, 3, or 4 in the sequence listing;

[0018] B2) a cDNA molecule or a DNA molecule having 85% or more, 90% or more, or 95% or more identity with the nucleotide sequence shown in B1), and encoding the above-mentioned PsADF and proteins after mutation of key amino acid sites thereof;

[0019] B3) a cDNA molecule or a DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the above-mentioned PsADF and proteins after mutation of key amino acid sites thereof.

[0020] The above coding gene, sequence 3 and 4 in the sequence list are composed of 432 nucleotides; the nucleotides 1-432 from the 5' end of sequence 3 and 4 are coding sequences, encoding the proteins shown in sequence 2 and 5 in the sequence list (PsADF, PsADF N64A ). Sequence 1 in the sequence list consists of 2001 nucleotides, and sequences 699-702, 812-1063, 1177-1336 from the 5' end of sequence 1 in the sequence list are exon sequences, namely sequence 3 in the sequence list, encoding the protein shown in sequence 2 in the sequence list.

[0021] The RNA molecule is an RNA molecule transcribed from the coding gene;

[0022] Preferably, the sequence of the RNA molecule is as follows C1) or C2):

[0023] C1) an RNA sequence transcribed from the DNA sequence shown in SEQ ID NOs. 3 and 4, which has a similarity of 85% or more, preferably 90% or more, and more preferably 95% or more, and has the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID NOs. 3 and 4;

[0024] C2) RNA sequence transcribed from the DNA sequence shown in sequences 3 and 4.

[0025] The DNA sequence of the present invention can be molecularly hybridized with the DNA sequences shown in sequences 3 and 4 under stringent conditions and encode the DNA sequences of PsADF and proteins after mutation of key amino acid sites as shown in sequences 2 and 5. The stringent conditions can be hybridization at 65°C with a solution of 6×SSC, 0.5% SDS, and then washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0026] The third object of the present invention is to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, a cosmid, a phage or a viral vector; the microorganism can be a yeast, a bacterium, an algae or a fungus, such as Agrobacterium; the transgenic plant cell line does not include a propagation material. Specifically, it can be any one of the following D1) to D10):

[0027] D1) an expression cassette containing the encoding gene;

[0028] D2) a recombinant vector containing the coding gene, or a recombinant vector containing the expression cassette described in D1);

[0029] D3) a recombinant microorganism containing the encoding gene, or a recombinant microorganism containing the expression cassette described in D1), or a recombinant microorganism containing the recombinant vector described in D2);

[0030] D4) a transgenic plant cell line containing the encoding gene, or a transgenic plant cell line containing the expression cassette described in D1);

[0031] D5) transgenic plant tissue containing the encoding gene, or transgenic plant tissue containing the expression cassette described in D2);

[0032] D6) a transgenic plant organ containing the encoding gene, or a transgenic plant organ containing the expression cassette described in D2);

[0033] D7) a nucleic acid molecule that alters the expression of the coding gene;

[0034] D8) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7); The recombinant vector may include a CRISPR / Cas9-based gene site-directed mutagenesis method, which is to express the Donor vector of the target gene and a plasmid expressing sgRNA and Cas9 protein; The Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of the site to be mutated, a sequence of the site to be mutated and a sequence of 800-1500bp downstream of the site to be mutated connected in sequence. The sgRNA and Cas9 protein co-expression plasmid is a vector encoding an sgRNA fragment targeting the site gene to be mutated and a DNA sequence expressing the Cas9 protein, wherein the site gene to be mutated is the PsADFM0 gene, and the sgRNA sequence (coding sequence) targeting the PsADFM0 gene is GCTGTCCCTCGAGTCCATCG. Preferably, the sgRNA and Cas9 co-expression plasmid is based on the pYF515 vector as the starting vector, and the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PsADF gene is inserted between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector to obtain the sgRNA and Cas9 co-expression plasmid;

[0035] D9) a nucleic acid molecule that alters the translation of the above RNA molecule;

[0036] D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

[0037] The fifth purpose of the present invention is to provide the application of soybean Phytophthora PsADF and its proteins after mutation of key amino acid sites, nucleic acid molecules encoding PsADF and its proteins after mutation of key amino acid sites, or biological materials containing nucleic acid molecules encoding PsADF and its proteins after mutation of key amino acid sites.

[0038] The application is any one or more of the following 1)-3):

[0039] 1) Application in regulating sporangium formation and / or zoospore production of Phytophthora;

[0040] 2) Application in regulating the pathogenicity of Phytophthora;

[0041] 3) Application in inhibiting and / or killing Phytophthora pathogens;

[0042] Preferably, the oomycete is preferably Phytophthora, preferably Phytophthora sojae.

[0043] Wherein, the application includes realizing the application described in 1)-3) by changing the nucleotide molecule encoding the gene described in sequence 3, or changing the RNA molecule, and the function of the PsADF protein described in sequence 2.

[0044] In the application, the sporangium formation of Phytophthora is regulated by changing the DNA or RNA sequence of the encoding gene as mentioned above, or changing the function of the PsADF protein as mentioned above, thereby reducing the number of zoospores and pathogenicity, thereby inhibiting and / or killing the growth of Phytophthora sojae.

[0045] Preferably, the application is achieved by mutating the 64th amino acid N from the 5' end of the PsADF protein of Phytophthora sojae as shown in Sequence 2 to A, so as to achieve the applications described in 1) to 3).

[0046] The sixth object of the present invention is to provide PsADF shown in sequences 2 and 5 in the sequence list, PsADF N64A The protein and the coding genes shown in sequences 3 and 4 in the above sequence table are used as targets of antibacterial or fungicidal agents to screen antibacterial or fungicidal agents for Phytophthora.

[0047] The seventh object of the present invention is to provide a method for screening or assisting in screening antibacterial and / or fungicidal agents for Phytophthora, the method comprising applying the substance to be detected to the Phytophthora, when the substance to be detected can change the DNA sequence as above, or change the RNA sequence as above, or change the function of the PsADF protein as shown above, then the substance to be detected is a candidate antibacterial and / or fungicidal agent for the plant Phytophthora.

[0048] The eighth object of the present invention is to provide a method for reducing the activity of Phytophthora, comprising the following steps: changing the nucleotide molecular sequence of the coding gene as described above, or changing the RNA molecular sequence as described above, or changing the function of the PsADF protein as described above;

[0049] Wherein, the reducing the activity of Phytophthora is to prevent the normal formation of sporangia of Phytophthora, and reduce the number of zoospores and pathogenicity;

[0050] In the above method, the change of protein function is achieved by changing the nucleotide sequence of the coding gene, and specifically, it can be achieved by gene site-directed mutagenesis.

[0051] The gene site-directed mutagenesis refers to the phenomenon that the key amino acid sites in the key functional domain are mutated through homologous recombination. Gene site-directed mutagenesis is to change the function of a specific target gene by changing the key amino acid sites.

[0052] The gene shown in sequence 3 in the sequence list of Phytophthora is subjected to site-directed mutation, so that the function of the protein shown in sequence 2 in the sequence list is changed.

[0053] The above-mentioned Phytophthora is preferably Phytophthora sojae.

[0054] Preferably, the activity of Phytophthora is reduced by mutating the 64th amino acid from the 5' end of the protein sequence shown in Sequence 2 of Phytophthora from N to A;

[0055] Preferably, the coding gene of the protein shown in Sequence 2 of Phytophthora is mutated from AAC to GCC at nucleotides 190 to 192 of the 5' end of Sequence 3 in the sequence list to achieve mutation of the protein sequence shown in Sequence 2, thereby reducing the activity of Phytophthora.

[0056] In one embodiment of the present invention, the method for subjecting the above-mentioned gene to site-directed mutagenesis is a CRISPR / Cas9-based site-directed mutagenesis method.

[0057] Specifically, the CRISPR / Cas9-based site-directed mutagenesis method is to transfect the Donor vector of the target gene and the sgRNA and Cas9 co-expression plasmid into soybean phytophthora to screen for recombinant bacteria with mutations in the target key amino acid sites.

[0058] The Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of the amino acid site to be mutated in the target gene, the amino acid sequence of the target gene after mutation (usually mutated to alanine), and a sequence of 800-1500bp downstream of the amino acid site to be mutated in sequence. The sgRNA and Cas9 co-expression plasmid is a vector that co-expresses the sgRNA fragment targeting the target gene to be mutated and the encoding of Cas9, wherein the target gene to be mutated is the PsADF gene, and the sgRNA sequence targeting the PsADF gene is GCTGTCCCTCGAGTCCATCG.

[0059] Preferably, the sgRNA and Cas9 co-expression plasmid is based on the PYF515 vector as the starting vector, and the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PsADF gene is inserted between the Nhe I and Bsa I enzyme recognition sites of the PYF515 vector to obtain the sgRNA and Cas9 co-expression plasmid.

[0060] The use of substances that change the function of ADF protein in the preparation of plant soybean phytophthora fungicide also falls within the protection scope of the present invention.

[0061] In the above application, the substance that changes the function of the PsADF protein is a substance that changes the sequence of the gene encoding the PsADF protein and / or changes the translation of the RNA molecule transcribed from the gene encoding the PsADF protein.

[0062] Experiments have shown that the PsADF protein provided by the present invention plays a role in the growth and development of soybean phytophthora itself. The site-directed mutation transformants obtained by CRISPR / Cas9 gene editing technology have obvious changes in growth and development compared with the wild-type parent strain, mainly including: the transformants with a single point mutation in the 64th amino acid in the key functional domain of PsADF have abnormal sporangia, and the number of zoospores and pathogenicity are reduced. In addition, overexpression of PsADF protein affects the sporangium formation and zoospore yield of soybean phytophthora. Therefore, PsADF protein in soybean phytophthora pathogen plays an important role in the asexual reproduction process of soybean phytophthora. The present invention provides technical support for the study of the growth and development and pathogenic mechanism of soybean phytophthora pathogen, and provides a potential molecular target for the research and development of new phytophthora fungicides in the future.

[0063] Sequence analysis of the ADF proteins in plant pathogenic oomycetes and those in humans, mice, Arabidopsis thaliana and yeast revealed that most oomycetes contain only one ADF protein, and the ADF proteins in Phytophthora sojae and other oomycetes have a high homology of more than 78%, and both contain a novel N-glycosylation site, namely N glyco-D site, (taking soybean phytophthora as an example, site 64). Humans, mice, Arabidopsis thaliana and yeast contain 5, 6, 12 and 1 ADF proteins respectively, and the ADF protein in soybean phytophthora has a low homology with them ( Figure 1 Although there are multiple ADF proteins in the above mammals and plants, only one protein in these species contains N glyco -D novel glycosylation site, which is the same place as oomycetes. It has been reported in the literature that the ADF inhibitor LIMK1 attenuates ADF-mediated apoptosis by reducing the formation of ADF, and may therefore be used as a drug target for ischemic stroke in future studies (Bin Chen et al, 2020). The small molecule inhibitor lead compound S3 Fragment, screened by the virtual screening software Schrodinger Maestro 12.8, is a biologically active peptide that has been widely used as an effective competitive inhibitor of LIMK1. Based on the above, it is speculated that ADF in oomycetes may serve as a potential molecular target for future new fungicides of Phytophthora. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 The structure of the ADF protein of plant pathogens ( Figure 1 (B), cluster analysis ( Figure 1 (A).

[0065] Figure 2 The soybean Phytophthora strain P6497 (WT), pBluescript II SK + empty vector control transformant CK1, and the transformant with a single point mutation at amino acid position 64 of PsADF ( Figure 2 PsADF- N64A ), pTOR empty vector control transformant CK2, PsADF overexpression transformant ( Figure 2 PsADF-O) sporangium ( Figure 2 Middle A), phenotype of zoospores ( Figure 2 (B).

[0066] Figure 3 The soybean Phytophthora strain P6497 (WT), pBluescript II SK + empty vector control transformant CK1, and the transformant with a single point mutation at amino acid position 64 of PsADF ( Figure 3 PsADF- N64A ), pTOR empty vector control transformant CK2, PsADF overexpression transformant ( Figure 3 Figure 5. Pathogenicity phenotype of PsADF-O.

[0067] Figure 4These are the growth rate measurement results of soybean Phytophthora strain P6497 (WT), pepper Phytophthora strain LT1534 (WT), and infestation Phytophthora strain DH50 (WT) under the treatment of 50 μg / mL lead compound S3 Fragment (C73H120N18O24S2).

[0068] Figure 5 These are the molecular docking results of soybean Phytophthora ADF (PsADF), pepper Phytophthora ADF (PcADF), and Phytophthora infestans ADF (PiADF) proteins with the lead compound S3 Fragment. DETAILED DESCRIPTION

[0069] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0070] Soybean Phytophthora strain P6497 (Tyler BM, Tripathy S, Zhang X, Dehal P, Jiang RH, Aerts A, Arredondo FD, Baxter L, Bensasson D, Beynon JL, et al. 2006. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313: 1261-1266): a standard strain donated by Professor Brett M. Tyler of Oregon State University, USA, stored in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University, and available to the public from China Agricultural University.

[0071] Culture medium or reagent formula:

[0072] 10% V8 solid medium: 100 ml V8 vegetable juice, 1.4 g CaCO3, stir to mix, dilute 10 times with deionized water, i.e. add 900 ml deionized water, add 15 g agar, and sterilize at 121°C for 20 min.

[0073] 10% V8 liquid culture medium: 100 ml V8 vegetable juice, 1.4 g CaCO3, stir and mix, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute 10 times with deionized water, and sterilize at 121°C for 20 min.

[0074] Nutrient pea broth (NPB): 125g peas were added to 1l deionized water, sterilized at 121℃ for 20min, and filtered through gauze to obtain pea nutrient solution; 2.0g yeast extract, 5.0g glucose, 5.0g mannitol, 5.0g sorbitol, 2.0g CaCO3, 0.1g CaCl2, 0.5g MgSO4, 3.0g KNO3, 1.0g K2HPO4, 1.0g KH2PO4 were weighed, mixed, centrifuged at 3000rpm for 10min or allowed to stand for 30min, the supernatant was taken, and the volume was adjusted to 1l with pea nutrient solution, 15g agar powder was added to the solid culture medium (NPBA), and sterilized by wet heat for 20min. Before use, 2ml vitamin stock solution (Biotin 6.7×10 -7 g / ml; Folic acid 6.7×10 -7 g / ml; L-inositol 4.0×10 -5 g / ml; Nicotinic acid 4.0×10 -5 g / ml; Pyridoxine-HCl 6.0×10 -4 g / ml; Riboflavin 5.0×10 - 5 g / ml; Thiamine-HCl 1.3×10 -3 g / ml) and 2 ml of trace element stock solution (FeC6H5O7·3H2O 5.4×10 -4 g / ml; ZnSO4·7H2O 3.8×10 -4 g / ml; CuSO4·5H2O 7.5×10 -4 g / ml; MgSO4·H2O 3.8×10 -5 g / ml; H3BO3 2.5×10 -5 g / ml; Na2MoO4·H2O 3.0×10 -5 g / ml).

[0075] Pea Mannitol Medium (PM): Accurately weigh 91.1g mannitol, 1g CaCl2, 2g CaCO3, add about 900ml pea nutrient solution, stir and mix for about 30min, centrifuge at 3000rpm for 10min or let stand for 30min, take the supernatant, make up to 1l with pea nutrient solution, add 15g agar powder to the solid culture medium (PMA), and sterilize with wet heat for 20min.

[0076] Mycelial hydrolysate (20 ml): 10 ml 0.8 M mannitol, 0.8 ml 0.5 M KCl, 0.8 ml 0.5 M 4-morpholineethanesulfonic acid, 0.4 ml 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyase (Sigma, cat. No. L1412), dilute to 20 ml with sterile ultrapure water, mix gently to dissolve, filter and sterilize with 0.22 μm filter membrane, prepare before use.

[0077] MMG solution (250 ml): 18.22 g mannitol, 0.76 g MgCl2·6H2O, 2.0 ml 0.5 M 4-morpholineethanesulfonic acid (pH=5.7), dilute to 250 ml with ultrapure water, and sterilize by filtration with a 0.22 μm filter membrane.

[0078] W5 solution: 0.1 g KCl, 4.6 g CaCl2·2H2O, 2.25 g NaCl, 7.8 g glucose, dissolved in ultrapure water to 250 ml, and sterilized by filtration with a 0.22 μm filter membrane.

[0079] PEG-CaCl2 solution (40% w / v): 12 g PEG 4000, 3.75 ml 0.5 M CaCl2, 3 ml sterile ultrapure water, sterilized by filtration through a 0.22 μm filter membrane.

[0080] Example 1. Obtaining genes encoding overexpression of Phytophthora sojae PsADFM0 and PsADF

[0081] In this embodiment, the gene encoding Phytophthora sojae PsADFM0 can be amplified by using the DNA of the standard strain P6497 of Phytophthora sojae using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloni ng_Resources / Online_In-Fusion_Tools) to design primers for amplifying the target gene PsADFM0 sequence (Sequence 1 in the sequence list consists of 2001 nucleotides, obtained by amplification with primers PsADF-F and PsADF-R as shown in Table 3, and the 699-702, 812-1063, 1177-1336 from the 5' end of Sequence 1 in the sequence list are exon sequences, and 703-811, 1064-1176 are intron sequences). The material for DNA or RNA extraction can be the mycelium of the standard strain P6497 of Phytophthora sojae.

[0082] use HD Cloning Kit sequentially fused and connected the amplified fragments into the cloning vector pBluescript II SK+ (EcoR V digestion), and the ligation products were transferred into E. coli DH5α competent cells. After overnight culture at 37°C, universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') were used for amplification and sequencing to verify the clones. The recombinant expression vector with the verified correct connection of the 1000bp sequence upstream of the PsADF self-glycosylation site, the glycosylation site sequence and the 1000bp sequence downstream of the PsADF self-glycosylation site was named pBS-PsADFM0. Sequence 3 in the sequence list encodes the protein PsADF shown in sequence 2 in the sequence list.

[0083] By analyzing the sequence of ADF proteins in plant pathogenic oomycetes and ADF proteins in humans, mice, Arabidopsis and yeast, we found that most oomycetes contain only one ADF protein, and soybean phytophthora has also evolved only one ADF protein. After using four sgRNAs for knockout, a total of 1,121 transformants were verified, and no homozygous knockout transformants were obtained, all of which were heterozygous transformants. Further self-pollination experiments of heterozygous transformants were carried out, and no offspring with the gene missing appeared in the self-pollinated offspring, indicating that the gene knockout is lethal. In addition, we also found that the ADF proteins in soybean phytophthora and other oomycetes have a high homology of more than 78%, and both contain a new N-glycosylation site, namely N glyco -D site, (taking soybean phytophthora as an example, site 64). Human, mouse, Arabidopsis and yeast contain 5, 6, 12 and 1 ADF proteins respectively, and the ADF protein in soybean phytophthora has low homology with them (Table 1, Table 2, Figure 1 Although there are multiple ADF proteins in the above mammals and plants, only one protein in these species contains N glyco -D Novel glycosylation site, which is the same as that in oomycetes.

[0084] Table 1.

[0085]

[0086] Table 2.

[0087]

[0088] In this embodiment, the gene (cDNA) encoding the overexpression of Phytophthora sojae PsADF is shown in Sequence 3 in the sequence list, which consists of 432 nucleotides and encodes the protein PsADF shown in Sequence 2 in the sequence list. Sequence 3 can be obtained by using the cDNA of the standard strain of Phytophthora sojae P6497 as a template, and using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloni ng_Resources / Online_In-Fusion_Tools) to design primers to amplify the PsADF-pTOR sequence (PsADF-pTOR-F: 5'-CCTTGAGGTTGCTAGCATGTCGTCCGGTGTCGGTG-3', PsADF-pTOR-R: 5'-AGAAGTAGGCACCCCGCGGCTACAGGAACTTGGACACGCCG-3'), wherein the material for cDNA extraction can be the mycelium of the standard strain of Phytophthora sojae P6497.

[0089] use The amplified fragments were sequentially fused and connected into the cloning vector pTOR-3XFLAG (cut with SacII and NheI) using the HD Cloning Kit. The ligation products were transferred into Escherichia coli DH5α competent cells and cultured overnight at 37°C. The universal primers pTOR-F (sequence: 5'-CCAAGTCCCAACCGACTCTT-3') / pTOR-R (sequence: 5'-GTTCTACAAACGGCCTTCTT-3') were used for amplification and sequencing to verify the clones. The recombinant expression vector with the correctly connected PsADF sequence was named PsADF-pTOR.

[0090] The pTOR-3XFLAG vector plasmid used in this example is based on the pTOR241 vector as the original backbone, with 3×FLAG tag replacing Avh241, which was transformed and preserved by the Pathogen and Fungicide Interaction Laboratory of China Agricultural University, and the pTOR vector was donated by Professor Wang Yuanchao's laboratory of Nanjing Agricultural University. (Gao, J and Cao, M. (2015). PsMPK7, astress-associated mitogen-activated protein kinase (MAPK) in Phytophthora sojae, is required for stress tolerance, reactive oxygenated species detoxification, cyst germination, sexual reproduction and infection of soybean. Mol Plant Pathol. Jan; 16 (1): 61-70.)

[0091] Sequence 4 in the sequence list consists of 432 nucleotides and encodes the protein PsADF shown in Sequence 5 in the sequence list. N64A The above-mentioned proteins or genes can also be synthesized artificially.

[0092] Table 3. Primers for amplification of PsADFM0 coding gene

[0093]

[0094] Example 2: Construction of site-directed mutagenesis vector for the PsADF gene of Phytophthora sojae

[0095] The present invention performs point mutation on the PsADF protein, specifically:

[0096] The 64th amino acid of the amino acid sequence described in sequence 2 in the sequence list is mutated from N to A, that is, the protein PsADF shown in sequence 5 in the sequence list N64A ; The coding gene is mutated from AAC to GCC at the 190th to 192th nucleotides of the 5' end of sequence 3 in the sequence list, that is, sequence 4 in the sequence list.

[0097] Sequence 4 in the sequence list consists of 432 nucleotides and encodes the protein PsADF shown in Sequence 5 in the sequence list. N64A .

[0098] The above proteins or genes can be artificially synthesized.

[0099] The above-mentioned point mutations were performed as described below using a CRISPR / Cas9-based method.

[0100] The method for constructing a gene point mutation vector based on CRISPR / Cas9 and the sequences of the related vectors in this embodiment are disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of aneffector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.” The pBluescript II SK+ homology arm vector plasmid (Donor vector) and sgRNA and Cas9 co-expression plasmid PYF515 used in this example were donated by Professor Brett M. Tyler of Oregon State University, USA.

[0101] The Donor vector pBS-PsADF after point mutation used in this embodiment N64A , sgRNA and Cas9 co-expression plasmid PYF515-ADF; the specific construction method is as follows:

[0102] PsADF N64A Point mutation vector pBS-PsADF N64A Construction: 4 M1 mutation primers were manually designed. F1 and R1 share a 10 bp sequence including the mutation site (as shown in Table 4), where the site-directed mutation site is generally selected to mutate to alanine. FM and RM share a 10 bp sequence including the synonymous mutation site (as shown in Table 4), where about 4 synonymous mutation sites are selected, and the specific mutation method is selected according to the codon preference during point mutation of Phytophthora (Sucheta Tripathy, and Brett M. Tyler, 2006). The length of the above 4 primers is about 30 bp (F1 is Pbs-PsADF in Table 4). N64A -F1, R1 is Pbs-PsADF in Table 4 N64A -R1,FM is Pbs-PsADF in Table 4 N64A-FM, RM is Pbs-PsADF in Table 4 N64A -RM). Using the pBS-PsADFM0 homologous recombination vector as a template, forward primer F1 and reverse primer RM were used for amplification to obtain pBS-PsADFM0. N64A The short fragment was amplified with reverse primer R1 and forward primer FM to obtain pBS-PsADF N64A The PCR product was then purified and recovered, and the Infusion ligase was used for ligation and transformation. After that, colony PCR was performed (the primers were universal primers M13-F / R) and sent to the company for sequencing to ensure that the target site had mutated. The recombinant expression vectors after the point mutation of the verified correct expression sequence 4 were named pBS-ADF N64A .

[0103] Construction of PYF515-ADF: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the RNA structure online analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), we selected a sgRNA sequence that specifically targeted the PsADF1 gene and had a weak secondary structure (sgADF: GTTCGCCCTCGATCTTCTGG, targeting positions 265-284 of SEQ ID No.1 of the PsADF gene) and sent it to the company to synthesize forward and reverse sgRNA sequence primers with NheI and BsaI restriction sites and HH ribozyme. Dissolved in sterile water to a 100 μM solution. Annealing reaction was used to synthesize double-stranded sgRNA sequences. The reaction system was as follows: 3 μl forward chain solution, 3 μl reverse chain solution, 3 μl 10×T4 DNA Ligase Buffer (NEB), 4 μl 0.5 M NaCl, and 21 μl ultrapure sterile water. Mix by pipetting, react at 100°C for 2 min, cool naturally at room temperature for 4 h, and then dilute the reaction solution 500 times. Then take 2 μl 10×T4 DNA Ligase Buffer (NEB), 50 ng PYF515 vector (Nhe I / Bsa I double enzyme digestion), 4 μl diluted double-stranded sgRNA solution, 1 μl T4 DNA Ligase, and make up to 20 μl with sterile ultrapure water. React at room temperature for 30 min, use 5 μl of ligation product to transform Escherichia coli DH5α competent cells, and culture at 37°C overnight. Use primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGAC TG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') for colony PCR verification, and sequence to verify the positive clones. The recombinant vector that can correctly express the above sgRNA is named PYF515-ADF.

[0104] Table 4. Primer sequences used for construction of site-directed mutagenesis vectors

[0105]

[0106] Example 3: Obtaining site-directed mutation transformants and overexpression transformants of the PsADF gene of Phytophthora sojae

[0107] The PsADF gene site-directed mutagenesis transformants were prepared by a CaCl2-PEG-mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the document “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139.”

[0108] pBS-PsADF N64A The site-directed mutagenesis transformants were obtained by transforming the site-directed mutagenesis gene pBS-PsADF obtained in Example 2 into N64A Donor vector, sgRNA and Cas9 co-expression plasmid (pBS-PsADF N64A PsADF was co-transformed into the protoplasts of P. sojae P6497, and the grown transformants were screened by culturing on G418-resistant V8 solid medium plates at 25°C. The mycelia of the suspected transformants were collected, and DNA was extracted for PCR sequencing verification to obtain PsADF. N64A The transformant strain with a single point mutation was named PsADF N64A At the same time, the transformants that were transferred with the same vector plasmid and underwent the same transformation steps but without homologous replacement were used as CK control transformants, namely CK1.

[0109] The PsADF overexpression transformant was obtained by transferring the pTOR vector of the overexpression gene PsADF obtained in Example 1 into the protoplasts of Phytophthora sojae P6497, culturing and screening the grown transformants on a G418-resistant V8 solid medium plate at 25°C, collecting the mycelium of the suspected transformants, extracting DNA for PCR sequencing verification, and obtaining the PsADF overexpression transformant strain, named PsADF-O. At the same time, the transformant transferred with an empty overexpression vector plasmid and subjected to the same transformation steps was used as a CK control transformant, i.e., CK2.

[0110] Example 4: Biological morphology analysis of site-directed mutation transformants and overexpression transformants of PsADF gene of Phytophthora sojae

[0111] 1. Detection of the number of sporangia and zoospores

[0112] 10% V8 solid and liquid culture medium was prepared, and wild-type soybean Phytophthora strain P6497 (WT), empty vector control transformants CK1, CK2, and site-directed mutation transformants obtained in Example 3: pBS-PsADFN64A Strains and overexpression transformants: pTOR-PsADF-O strain was inoculated on V8 solid culture medium and cultured in the dark at 25°C for 5-7 days. Ten bacterial cakes were punched out with a 5mm puncher for each strain and placed in a sterile culture dish (9 cm in diameter) containing 20 ml of V8 juice liquid culture medium. After culturing in the dark at 25°C for 3 days, the cakes were rinsed with 20 ml of sterile deionized water, once every 30 minutes for a total of 5 times, and then 10 ml of deionized water was added to the volume. After being placed in the dark at 25°C for 4-6 hours, the number and morphology of sporangia produced on the bacterial cakes were observed under a microscope; after 8-10 hours, the number and morphology of zoospores produced in sterile water were observed under a microscope, and this was repeated 3 times.

[0113] The results showed that compared with the wild-type soybean Phytophthora strain P6497 (WT) and the empty vector control transformant CK1, the PsADF obtained in Example 3 N64A The sporangium of the gene site-directed mutation transformants showed abnormalities, and the number of zoospores decreased significantly. Compared with the empty vector control transformant CK2, the number of sporangium and zoospores of the PsADF gene overexpression transformants obtained in Example 3 increased slightly, which indicates that the PsADF protein, especially the 64th site (Table 5, Figure 2 ) mutations mainly affected the sporangium formation and zoospore number of soybean Phytophthora.

[0114] Table 5. PsADF in Phytophthora sojae strain P6497 N64A Sporangium and zoospore yields of single-point mutation transformants and overexpression transformants

[0115]

[0116] 2. Pathogenicity Detection

[0117] Soybean seeds (Japanese green, commercially available) were sown in moist vermiculite and cultured at 25°C in the dark for 7-9 days to obtain tender, fresh yellow flower seedlings, which were then cleaned. Wild-type soybean Phytophthora strain P6497 (WT), empty vector control transformants CK1 and CK2, and site-directed mutagenesis transformants obtained in Example 3: pBS-PsADF N64A Strains and overexpression transformants: pTOR-PsADF-O strain was inoculated on V8 solid medium and cultured in the dark at 25°C for 5-7 days. Ten bacterial cakes were punched out with a 5mm borer for each strain and inoculated on the hypocotyls of healthy and fresh etiolated seedlings with uniform growth. The seedlings were cultured in the dark at 25°C for 3 days, and the length of the lesions on the etiolated seedlings was measured. In each biological replicate, 10 etiolated seedlings were inoculated with each strain.

[0118] The results showed that compared with the wild-type soybean Phytophthora strain P6497 (WT) and the empty vector control transformant CK1, the PsADF obtained in Example 3N64A The lesions of the gene site-directed mutation transformants were reduced and the pathogenicity was significantly reduced. Compared with the empty vector control transformant CK2, the pathogenicity of the PsADF gene overexpression transformants obtained in Example 3 did not change significantly, which indicates that the 64th site of the PsADF protein (Table 6, Figure 3 ) mutations mainly affect the pathogenicity of soybean Phytophthora.

[0119] Table 6 PsADF in soybean Phytophthora strain P6497 N64A Pathogenicity of single-point mutation transformants and overexpression transformants

[0120]

[0121] 3. Protein structure of Phytophthora ADF and the inhibitory effect of the lead compound S3 Fragment on Phytophthora

[0122] 1. Alpha fold2 was used to predict the structure of ADF proteins of various representative phytophthora fungi, such as soybean phytophthora, pepper phytophthora, and infestation phytophthora ( Figure 1 ). It has been reported in the literature that S3 Fragment is a biologically active peptide and has been widely used as an inhibitor of ADF protein. Based on the crystal structures of the three Phytophthora ADF proteins, virtual screening of small molecule active compounds was carried out using the virtual screening software Schrodinger Maestro 12.8. The ligand small molecule compounds were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). In this study, S3 Fragment was selected as the lead small molecule inhibitor based on the binding ability of ADF protein with small molecule compounds, the structure of small molecule compounds and their inhibitory activity on the mycelial growth of three Phytophthora fungi.

[0123] Wild-type soybean Phytophthora strain P6497 and wild-type pepper Phytophthora strain LT1534 were inoculated in the center of a 90 mm V8 solid plate containing 50 μg / mL lead compound S3 Fragment, and wild-type infestation Phytophthora strain DH50 was inoculated in the center of a 90 mm tomato rye solid plate containing 50 μg / mL lead compound S3 Fragment. Wild-type pepper Phytophthora strain LT1534 and wild-type soybean Phytophthora strain P6497 were cultured at 25°C in the dark for 5 days, and wild-type infestation Phytophthora strain DH50 was cultured at 18°C ​​in the dark for 7 days. The colony diameter of each strain was measured by the cross method, and three technical replicates were recorded for each treatment. Three biological replicates were performed to determine the inhibitory activity against the mycelial growth of the three Phytophthora fungi.

[0124] The lead compound S3 Fragment (C73H120N18O24S2), the result is shown in Formula I.

[0125]

[0126] The inhibitory effect of the lead compound S3 Fragment on a variety of representative Phytophthora at a concentration of 50ppm was determined. Figure 4 ), compared with the control DMSO, the colony diameters of P6497, LT1534 and DH50 treated with 50μg / mL S3 Fragment decreased significantly. By calculation, the mycelial growth inhibition rate of 50μg / mL S3 Fragment on P6497 was 25.0%, the mycelial growth inhibition rate of 50μg / mL S3 Fragment on LT1534 was 31.4%, and the mycelial growth inhibition rate of 50μg / mL S3 Fragment on DH50 was 36.7%, indicating that some lead compounds targeting ADF can have certain antibacterial activity against fungi such as pepper phytophthora, soybean phytophthora, and infestation phytophthora. The above test results prove that the ADF protein of the plant pathogenic oomycete of the genus Phytophthora has the potential to be developed as a new type of fungicide target.

[0127] VII. Molecular docking of Phytophthora sojae ADF (PsADF), Phytophthora capsici ADF (PcADF), and Phytophthora infestans ADF (PiADF) proteins with compound S3 Fragment

[0128] Auto Dock Vina software was used for molecular docking analysis. The ligands were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ), and the receptors were protein structures predicted by AlphaFold 2. First, the ligand molecules obtained from PubChem were preprocessed, including removing water molecules, adding hydrogen atoms, and converting to PDBQT format; similarly, the receptor structure generated by AlphaFold 2 was preprocessed accordingly. The processed ligand and receptor molecules were imported into Auto Dock Vina, and a grid box was set to cover the active site of the receptor. Then, the simulation was run and the binding free energy (binding affinity) of each ligand binding to the receptor was recorded. Molecular docking results ( Figure 5) showed that the binding free energies of the lead compound S3 Fragment with the ADF protein receptors of soybean phytophthora, pepper phytophthora, and infestation phytophthora were -164.39Kcal / mol, -153.24Kcal / mol, and -152.89Kcal / mol, respectively, indicating that it has a certain binding affinity with the three phytophthora ADF proteins. In addition, the results of molecular docking are consistent with the results of biological activity experiments, indicating the effectiveness of molecular docking predictions. These results provide important structural information support for further optimization and improvement of the lead compound S3 Fragment, and also provide a theoretical basis for the design of more specific and efficient agricultural inhibitors.

Claims

1. A class of soybean phytophthora sojae ADF proteins, which are proteins of A1) or A2) or A3) or A4) as follows: A1) The amino acid sequence is the protein shown in SEQ ID NO: 2 or 5; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2 or 5; A3) a protein derived from the protein shown in SEQ ID NO: 2, obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2 or 5 and having the same function as that of the protein shown in SEQ ID NO: 2; A4) An amino acid sequence that has a similarity of more than 85%, preferably more than 90%, and more preferably more than 95% to the amino acid sequence shown in SEQ ID NO: 2 or 5 and has the same function as the amino acid sequence shown in SEQ ID NO:

2.

2. A gene encoding the PsADF protein as claimed in claim 1; preferably, the gene encoding the PsADF protein is as follows B1) or B2) or B3): B1) a DNA molecule or cDNA molecule represented by the nucleotide sequence described in Sequence 1, 3 or 4 in the sequence listing; B2) a cDNA molecule or a DNA molecule that has 85% or more, 90% or more, or 95% or more identity with the nucleotide sequence shown in B1), and encodes the PsADF protein of claim 1; B3) a cDNA molecule or a DNA molecule which hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the PsADF protein of claim 1.

3. The RNA molecule obtained by transcription of the coding gene according to claim 2; preferably, the sequence of the RNA molecule is as follows C1) or C2): C1) an RNA sequence having a similarity of 85% or more, more preferably 90% or more, and more preferably 95% or more to the RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1 and having the same function as the RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1; C2) RNA sequence transcribed from the DNA sequence shown in SEQ ID NO:

1.

4. A biological material containing a nucleic acid molecule related to the coding gene as described in claim 2 or the RNA molecule as described in claim 3, which is any one of the following D1) to D10): D1) an expression cassette containing the coding gene according to claim 2; D2) a recombinant vector containing the coding gene according to claim 2, or a recombinant vector containing the expression cassette according to D1); D3) a recombinant microorganism containing the coding gene according to claim 2, or a recombinant microorganism containing the expression cassette according to D1), or a recombinant microorganism containing the recombinant vector according to D2); D4) a transgenic plant cell line containing the coding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1); D5) transgenic plant tissue containing the coding gene of claim 2, or transgenic plant tissue containing the expression cassette of D2); D6) A transgenic plant organ containing the coding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2); D7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 2; D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7); D9) a nucleic acid molecule that inhibits the translation of the RNA molecule according to claim 3; D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

5. Use of the PsADF protein according to claim 1, the coding gene according to claim 2, the RNA molecule according to claim 3, or the biomaterial according to claim 4, characterized in that: The application is any one or more of the following 1)-3): 1) Application in regulating the normal development of sporangium and / or zoospore production of Phytophthora; 2) Application in regulating the pathogenicity of Phytophthora; 3) Application in inhibiting and / or killing Phytophthora pathogens. Preferably, the oomycete is preferably Phytophthora, preferably Phytophthora sojae.

6. The use according to claim 5, wherein: The method comprises achieving the use described in 1)-3) by changing the sequence in the coding gene as described in claim 2, or changing the translation of the RNA molecule as described in claim 3, or changing and / or inactivating the function of the PsADF protein as described in claim 1; Preferably, the application is achieved by mutating the 64th amino acid N from the 5' end of the PsADF protein of Phytophthora sojae as shown in Sequence 2 to A, so as to achieve the applications described in 1) to 3).

7. Use of the PsADF protein of claim 1, the coding gene of claim 2, the RNA molecule of claim 3, the biological material of claim 4, or the protein combination or DNA combination of claim 5 as a target of an antibacterial or fungicide to screen for antibacterial or fungicide against Phytophthora.

8. A method for screening or auxiliary screening of antibacterial and / or bactericidal agents for Phytophthora, the method comprising applying the object to be detected to the soybean Phytophthora pathogen. When the object to be detected can change the sequence of the coding gene as claimed in claim 2, or change the translation of the RNA molecule as claimed in claim 3, or change the function and activity of the PsADF protein as claimed in claim 1, then the object to be detected is an antibacterial and / or bactericidal agent for the Phytophthora.

9. A method for reducing the activity of Phytophthora, comprising the steps of: changing the sequence of the coding gene as claimed in claim 2, or changing the translation in the RNA molecule as claimed in claim 3, or changing the function and activity of the PsADF protein as claimed in claim 1; in, The reducing the activity of Phytophthora is to reduce the normal formation of sporangia of Phytophthora pathogens and / or reduce the production of zoospores, thereby reducing the pathogenicity of Phytophthora; Preferably, the nucleotide sequence of the gene shown in sequence 1 in the sequence list of Phytophthora is subjected to site-directed mutagenesis to change the function of the protein shown in sequence 2 in the sequence list; Preferably, the activity of Phytophthora is reduced by mutating the 64th amino acid from the 5' end of the protein sequence shown in Sequence 2 of Phytophthora from N to A; Preferably, the coding gene of the protein shown in Sequence 2 of Phytophthora is mutated from AAC to GCC at nucleotides 190 to 192 of the 5' end of Sequence 3 in the sequence list to achieve mutation of the protein sequence shown in Sequence 2, thereby reducing the activity of Phytophthora.

10. Use of a substance that changes the function of the PsADF protein according to claim 1 in the preparation of a plant phytophthora fungicide; preferably, the substance that changes the function of the PsADF protein is a substance that changes the function of the PsADF protein and / or changes the sequence of the gene encoding the PsADF protein and / or changes the translation of the RNA molecule transcribed from the gene encoding the PsADF protein; the substance that inhibits the expression and / or activity of the ADF protein of the plant pathogenic oomycete of the genus Phytophthora is preferably a compound as shown in Formula I;

Images