Application of TaAPO1 protein or coding gene thereof in regulating and controlling phenotype and yield of wheat

Abstract

The invention relates to the technical field of plant molecular biology, in particular to application of TaAPO1 protein or a coding gene thereof in regulating and controlling phenotype and yield of wheat. It is found for the first time that the TaAPO1 gene regulates and controls the wheat yield by regulating and controlling ear and grain development of wheat, a new thought is provided for improving the wheat yield, wheat development molecule regulation and control technical means are widened, and the TaAPO1 gene has wide market application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular biology, and in particular to the application of TaAPO1 protein or its encoding gene in regulating wheat phenotype and yield. Background Art

[0002] Wheat is the second largest food crop after rice and the staple food of 35% to 40% of the world's population. Therefore, it is crucial to analyze the genetic and molecular mechanisms that regulate wheat yield formation. The three elements of wheat yield are the number of spikes per unit area, the number of grains per spike, and the grain weight. The number of grains per spike and the grain weight are mainly controlled by the development of the spike type, and are also the final manifestation of floret differentiation, development, and fruiting. Therefore, the study of wheat spike and grain development is of great significance. However, due to the allohexaploid characteristics of wheat, as well as the duplication of homologous genes, functional redundancy and differentiation, and expression silencing produced during the polyploidization process, the study of wheat spike development is relatively lagging behind.

[0003] The F-box gene family is one of the largest and fastest evolving gene / protein families in the plant kingdom. It is a class of genes that play an important role in plant growth and development, and plays an important role in regulating plant growth and reproductive stage transitions, floral organ and grain development, and other developmental processes. Currently, there is little analysis and research on the structure and function of the F-box gene family in wheat, and the biological function and molecular mechanism of this gene family in wheat are still unclear. Summary of the invention

[0004] The present invention discovered a gene from the F-box gene family that can regulate wheat phenotype and yield. TaAPO1 Gene, based on this, the following technical solution is proposed.

[0005] First, the present invention provides the use of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a gene encoding the same, or a biological material containing the gene encoding the same, in regulating wheat phenotype; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No.1 to SEQ ID No.3; (b) A sequence having the function of regulating wheat phenotype by replacing, and / or deleting, and / or adding one or more amino acid residues in the sequence shown in any one of SEQ ID NO.1 to SEQ ID No.3.

[0006] In some embodiments, the fusion protein is an amino acid sequence obtained by connecting a tag, an enzyme cleavage site and / or a connecting peptide sequence to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 1.

[0007] In the art, substitution with amino acids with similar or close properties usually does not change the function of the protein; adding one or more amino acids to the C-terminus and / or N-terminus usually does not change the function of the protein.

[0008] In the present invention, the wheat phenotype includes at least one aspect of plant height, ear length, number of spikelets per ear, grain length, grain width, thousand-grain weight, and number of grains per ear.

[0009] At the same time, the present invention provides the use of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a gene encoding it, or a biological material containing a gene encoding it in regulating wheat yield; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No.1 to SEQ ID No.3; (b) A sequence having the function of regulating wheat yield by replacing, and / or deleting, and / or adding one or more amino acid residues in the sequence shown in any one of SEQ ID NO.1 to SEQ ID No.3.

[0010] The present invention found that TaAPO1 Wheat yield can be regulated by adjusting wheat plant height, ear length, number of spikelets per ear, grain length, grain width, thousand-grain weight, and number of grains per ear.

[0011] Furthermore, the present invention provides the use of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a gene encoding the same, or a biological material containing the gene encoding the same, in wheat variety improvement; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No.1 to SEQ ID No.3; (b) A sequence having the function of regulating wheat phenotype or yield by replacing, and / or deleting, and / or adding one or more amino acid residues in the sequence shown in any one of SEQ ID NO.1 to SEQ ID No.3.

[0012] Preferably, wheat variety improvement is carried out by transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0013] Preferably, the amino acid sequence of the TaAPO1 protein is the sequence shown in any one of SEQ ID No.7, SEQ ID No.8, SEQ ID No.11, SEQ ID No.12, and SEQ ID No.13.

[0014] Preferably, the gene encoding the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID Nos. 4 to 6; (b) A DNA molecule capable of affecting wheat phenotype or yield formed by substitution of one or several bases and / or insertion and / or deletion of one or several bases or insertion / deletion / shift / inversion of a large fragment of nucleotide sequence based on any one of SEQ ID NOs. 4 to 6.

[0015] More preferably, the gene encoding the TaAPO1 protein is a sequence shown in any one of SEQ ID No.9, SEQ ID No.10, SEQ ID No.14, SEQ ID No.15, and SEQ ID No.16.

[0016] In a specific implementation process, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or non-renewable plant cells or tissues.

[0017] In the specific implementation process, the wheat phenotype or wheat yield can be regulated by adjusting the expression level or activity of TaAPO1 protein or gene.

[0018] In the specific implementation process, the expression level or activity of TaAPO1 protein or gene can be regulated by hybridization technology, transgenic technology or gene editing technology.

[0019] Compared with the prior art, the present invention has the following beneficial effects: The present invention first discovered TaAPO1 Genes regulate wheat yield by regulating the development of wheat ears and grains. The present invention provides a new idea for increasing wheat yield, broadens the technical means for molecular regulation of wheat development, and has broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 yes TaAPO1 Map of the designed locations of gene target sites.

[0021] Figure 2 This is a test result chart of wheat plant height, ear length, and number of spikelets per ear.

[0022] Figure 3 This is a test result chart of wheat grain length, grain width, number of grains per ear and thousand-grain weight.

[0023] Figure 4 yes TaAPO1 Statistical chart of gene specific expression in various wheat tissues.

[0024] Figure 5 yes TaAPO1 Gene expression in spikelet primordium. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0027] The present invention relates to molecular biology experiments. If not otherwise specified, reference can be made to the book Molecular Cloning (J. Sambrook, EF Fritsch, T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used reference books for those skilled in the art to guide the experimental operations related to molecular biology. In addition, according to different experimental purposes, those skilled in the art complete the corresponding experiments under the guidance of the operating manuals attached to various commercial kits (Kits) or entrust specialized companies to perform the experiments, such as gene sequencing.

[0028] Example 1 Construction and detection of gene editing strains The wheat in this example TaAPO1 The construction method of gene editing strain is as follows: 1. sgRNA target site selection: Select appropriate sgRNA on the CRISPR design website (http: / / www.ecrisp.org / E CRISP / CRISP / ), where the nucleotide sequences of the sgRNA action sites are target 1: 5'-CTCCCGACGCCGTCCTTCCTCCGCGCCCGCG -3' and target 2: 5'- CGTTCCTCTCCGACGCGTCCGGCCACAAGACGCT -3', and screen based on efficiency and specificity. Use the BLAST function in Ensembl Plants to align the sgRNA with the sequence of the wheat genome and select specific fragments.

[0029] 2. Design primers for connecting vectors according to sgRNA, use APO1-411-CRISPR-F, APO1-411-CRISPR-R, APO1-411-CRISPR-F0, APO1-411-CRISPR-R0 to amplify sequences with target sites, the concentration of F / R primers is 10μM, F0 / R0 is diluted 20 times, and the primers are mixed with the intermediate vector for use. The primer sequences are as follows: APO1-411-CRISPR-F: (SEQ ID No. 17) AATAATGGTCTCTGGCGACCTGCAACTCCAACTCACAGG APO1-411-CRISPR-F0: (SEQ ID No. 18) GACCTGCAACTCCAACTCACAGGGTTTTAGAGCTAGAAATAGC APO1-411-CRISPR-R0: (SEQ ID No.19)GCTTGAGGGATGCATCTATTTGGCCGTCTCTTGGTGCC APO1-411-CRISPR-R: (SEQ ID No. 20) ATTATTGGTCTCTAAACCCAAATAGATGCATCCCTCAAGC 3. Use the connection system shown in Table 1.

[0030] Table 1

[0031] 4. Take 5 μl of the product and add it to 50 μl of competent medium for transformation, and use F / R primers for detection.

[0032] TaAPO1 The target site of the gene is designed as Figure 1 As shown. TaAPO1 The primers TaAPO1-AF / TaAPO1-AR, TaAPO1-BF / TaAPO1-BR, TaAPO1-DF / TaAPO1-DR were designed for the sequence of the gene target site, as shown in SEQ ID No. 21 to 26, respectively. The PCR system used is shown in Table 2. 10 μl of the product was subjected to 1.2% agarose electrophoresis, and the remaining product was sequenced.

[0033] Table 2

[0034] The wheat in this example TaAPO1 The identification results of gene-edited strains are shown in Table 3.

[0035] Table 3

[0036] Among them, the amino acid sequence of the wild-type TaAPO1-A protein is shown in SEQ ID No.1, and the gene sequence is shown in SEQ ID No.4; the amino acid sequence of the wild-type TaAPO1-B protein is shown in SEQ ID No.2, and the gene sequence is shown in SEQ ID No.5; the amino acid sequence of the wild-type TaAPO1-D protein is shown in SEQ ID No.3, and the gene sequence is shown in SEQ ID No.6. The amino acid sequence of strain one TaAPO1-A protein is shown in SEQ ID No.7, and the gene sequence is shown in SEQ ID No.9; the amino acid sequence of strain one TaAPO1-B protein is shown in SEQ ID No.8, and the gene sequence is shown in SEQ ID No.10; the amino acid sequence of strain two TaAPO1-A protein is shown in SEQ ID No.11, and the gene sequence is shown in SEQ ID No.14; the amino acid sequence of strain two TaAPO1-B protein is shown in SEQ ID No.12, and the gene sequence is shown in SEQ ID No.15; the amino acid sequence of strain two TaAPO1-D protein is shown in SEQ ID No.13, and the gene sequence is shown in SEQ ID No.16.

[0037] Example 2 Phenotypic Statistics of Gene Edited Strains Wild-type wheat plants and the gene-edited strains of Example 1 were selected, with 2 plants of each type, and the phenotypes of plant height, ear length, number of spikelets per ear, grain length, grain width, number of grains per ear and 1000-grain weight were statistically analyzed and photographed. The grain phenotype was statistically analyzed by Wanshen SC-G automatic seed analysis and 1000-grain weight system software, and the obtained data was analyzed using Graphpad Prism Version software.

[0038] The test results of plant height, ear length, and number of spikelets per ear are as follows: Figure 2 As shown, compared with wild-type wheat plants, the plant height, ear length, and number of spikelets per ear of the gene-edited strains were significantly reduced or shortened.

[0039] The test results of grain length, grain width, number of grains per ear and thousand-grain weight are as follows: Figure 3 As shown, compared with wild-type wheat plants, the grain length, grain width, number of grains per ear and thousand-grain weight of the gene-edited strains were significantly reduced or decreased.

[0040] Example 3 In situ hybridization detection TaAPO1 Expression in young panicles 1. Material fixation and embedding: Prepare materials: freshly prepared plant tissue fixative, scissors, tweezers, wax cups, wax bowls and RNase-free centrifuge tubes sterilized at 180°C. Prepare drugs (all for RNA experiments, RNase-free): DEPC water, glacial acetic acid, ethanol, formaldehyde, xylene, chloroform, wax blocks.

[0041] Material fixation: Select fresh wheat plants, use high-temperature sterilized scissors and tweezers to remove the leaves of the plants that wrap the young ears, leaving only a few layers of tender leaves to protect the young ears, and put them into the freshly prepared formalin-acetic acid-ethanol fixative. Then vacuum evacuate for 15 minutes and then slowly release the air. Repeat this 2-3 times until the material sinks to the bottom, replace with fresh fixative, and store in a refrigerator at 4℃ overnight. Fixative formula (50% FAA): 50 mL of 100% anhydrous ethanol (final concentration 50%), 5 mL of 100% glacial acetic acid (final concentration 5%), 10 mL of 37% formaldehyde (final concentration 3.7%), and 35 mL of DEPC water.

[0042] Dehydration and transparency: Dehydrate the samples in freshly prepared ethanol with different concentration gradients, in the order of 50%, 70%, 80%, 90%, 95%, 100%, 100%, 100%, 30 minutes each. Move the samples to different gradients of xylene solutions for treatment, in the order of 25% xylene / 75% ethanol, 40 minutes, 50% xylene / 50% ethanol, 40 minutes, 75% xylene / 25% ethanol, 40 minutes, 100% xylene, 1 hour, 100% xylene, 1 hour, 100% xylene, 1 hour. Finally, move the samples to 10% chloroform / 90% xylene solution, add about 20 wax pieces to it, and place it in a fume hood overnight.

[0043] Wax dipping: Place the sample in a 42℃ thermostat to melt the wax block, then add a new wax block to it and melt it completely at 42℃. Add wax flakes in small amounts and multiple times until the wax flakes no longer melt. Pour out the wax liquid in the container, pour in the new wax liquid melted in advance at 60℃, and place it in a 60℃ thermostat overnight. After 2-3 days: Repeat the wax change. Replace the new wax liquid every 12 hours or so.

[0044] Embedding: Pour fresh wax liquid into the folded paper box, place the materials neatly in it, and put it into cold water to accelerate coagulation after the wax liquid solidifies on the surface. After the wax block is completely solidified, dry it and store it at 4℃.

[0045] 2. Slicing Use a blade to trim the wax block into a column, and stick the trimmed wax block to the rootstock. Set the slicer thickness to 8 µm. Put the cut wax strip into 42℃ DEPC water, and stick it on the slide after it stretches and flattens. Use absorbent paper to absorb the residual water, and place the slide on the baking machine to dry it. Then transfer it to a 42℃ constant temperature incubator and continue drying for 2-3 days.

[0046] 3. Probe Preparation The gene-specific fragment was connected to the pGEMT-easy (Promega, USA) vector. According to the gene sequence and the restriction sites on the vector, the sense probe and antisense probe were respectively digested with T7 reverse transcriptase to digest the plasmid. After the plasmid was extracted, the corresponding enzyme was used for digestion, and agarose gel electrophoresis was used to detect whether the digestion was complete. After digestion, an equal volume of chloroform was added for extraction, centrifuged at 12,000 rpm for 5 minutes, and the supernatant was taken into a centrifuge tube. An equal volume of chloroform was added for extraction, centrifuged at 12,000 rpm at 4°C for 5 minutes, and the supernatant was taken into a centrifuge tube. The chloroform extraction was repeated once and the supernatant was taken. 3 M sodium acetate solution was added to the above aqueous phase to make the final concentration reach 0.3 M, and then 2 times the volume of pre-cooled anhydrous ethanol was added and placed at -20°C overnight. After taking out the sample, centrifuged at 12,000 rpm at 4°C for 10 minutes and the supernatant was discarded. Add 500 μl of 70% ethanol solution, centrifuge at 12,000 rpm, 4°C for 5 minutes, and discard the supernatant; repeat once. After removing the residual liquid with a pipette tip, dry it and add an appropriate amount of DEPC water to dissolve it. The primer sequences used in the probe preparation are shown in SEQ ID No. 27~30, which are YW-APO1-F, YW-APO1-R, YW-APO1-F-T7 and YW-APO1-R-T7 respectively.

[0047] IV. In vitro transcription In vitro transcription was performed according to the instructions of the Roche DIG RNA Labeling Kit (Roche, Switzerland) and slightly modified according to the experiment. All materials and drugs were RNase-free. The steps are as follows: Add the following system to an RNase-free centrifuge tube: 1 μg of DNA and DEPC water to 13 μl. Then add the following reagents to the system: 2 μl of 10× NTP Labeling mixture, 2 μl of 10× transcription buffer, 1 μl of RNase inhibitor, 2 μl of RNA polymerase, mix gently and centrifuge, and incubate at 37°C for 2 hours. Then add 2 μl of DNase I, RNase-free, incubate at 37°C for 15 minutes, and add 2 μl of 0.2 M EDTA (pH 8.0) to terminate the reaction. Then add 2.5 μl of 4M LiCl and 75 μL of pre-cooled anhydrous ethanol, mix well, and incubate at -20°C overnight. After centrifugation at 4°C, 12,000 rpm for 20 minutes, discard the supernatant, add 500 μl of 70% ethanol, centrifuge at 4°C, 12,000 rpm for 5 minutes, discard the supernatant, use a pipette to absorb the residual liquid, and air dry. Finally, add DEPC water, check the quality of the probe by gel electrophoresis, aliquot, and store at -80°C.

[0048] V. In situ hybridization 1. Processing slices 1) Dewaxing and rehydration. Dewaxing the sections in different concentration gradients of xylene, in the following order: 100% xylene for 10 minutes, 100% xylene for 10 minutes, 75% xylene / 25% ethanol for 20 minutes, and 25% xylene / 75% ethanol for 10 minutes.

[0049] The sections were rehydrated in different concentrations of ethanol, in the following order: 100% ethanol for 2 minutes, 95% ethanol for 2 minutes, 80% ethanol for 2 minutes, 60% ethanol for 2 minutes, and 30% ethanol for 2 minutes. Finally, the sections were treated in DEPC water for 2 minutes.

[0050] 2) Treat the sections in 0.25 M hydrochloric acid solution for 20 minutes.

[0051] 3) Treat the sections in DEPC water for 5 minutes.

[0052] 4) Treat the sections in 2×SSC solution for 20 minutes.

[0053] 5) Treat the sections in DEPC water for 5 minutes.

[0054] 6) Move the slices to 4 μg / μl proteinase K solution and incubate at 37°C for 30 minutes. Be sure to preheat the proteinase K buffer and add proteinase K just before placing the slices.

[0055] 7) Treat the sections in 1× PBS solution for 2 minutes.

[0056] 8) Treat sections in 0.2% glycine (dissolved in 1× PBS, add immediately before use) for 2 minutes.

[0057] 9) Treat the sections twice in 1× PBS solution for 2 minutes each.

[0058] 10) Treat the sections in 4% formaldehyde solution (prepared in 1× PBS) for 10 min.

[0059] 11) Treat the sections twice in 1× PBS solution for 5 minutes each.

[0060] 12) Add 536 μl of triethanolamine, 160 μl of concentrated hydrochloric acid, and 200 μl of acetic anhydride to every 40 mL of 1× PBS solution, mix well, and then put the slices in for 5 minutes.

[0061] 13) Treat the sections twice in 1× PBS solution for 5 minutes each.

[0062] 2. Hybridization 1) Preheat hybridization solution and 50% formamide to 80°C.

[0063] 2) Prepare the probe: Add 60 μl of 50% formamide to 5 μl of the probe, denature it in an 80°C water bath for 2 minutes, and immediately place on ice to prevent renaturation.

[0064] 3) Add 120 μl of hybridization solution to the probe and mix well.

[0065] 4) Apply all the above solutions evenly onto the corresponding slides, cover with sealing film, and place in a wet box.

[0066] 5) Place the wet box in a 50°C incubator overnight away from light.

[0067] 3. Wash the film 1) Place the slices in 0.2× SSC solution preheated at 50℃ and incubate at 50℃ for 1 hour, twice.

[0068] 2) Transfer the slices to 37℃ preheated NTE solution and incubate at 37℃ twice, 5 minutes each time.

[0069] 3) Move the sections to 5 μg / μl RNase A solution (preheated at 37°C in NTE) and incubate at 37°C for 30 min.

[0070] 4) Transfer the slices to NTE solution preheated at 37°C and incubate at 37°C twice for 5 minutes each time.

[0071] 5) Place the slices in 0.2×SSC solution preheated at 50℃ and incubate at 50℃ for 1 hour.

[0072] 4. Detection 1) Place the slices in 1× TBS solution for 5 minutes.

[0073] 2) Place the sections in 1% blocking solution for 45 minutes.

[0074] 3) Place the slices in BSA / Triton / TBS for 45 minutes.

[0075] 4) Take 0.6 μL of biotin antibody and 600 μL of BSA / Triton / TBS solution, apply them evenly on each slide, cover with sealing film, put into a wet box, keep at room temperature and avoid light for 2 hours.

[0076] 5) Treat the sections in BSA / Triton / TBS solution for 15 minutes, for a total of 4 times.

[0077] 6) Use TE H 2 Wash slides twice, 5 minutes each time.

[0078] 7) Add 2 μL NBT / BCIP and 100 μL TE H 2O, cover with sealing film, place in a humidified box, away from light, at room temperature, and leave overnight.

[0079] 8) Observe and take photos under a microscope.

[0080] Figure 4 for TaAPO1 Statistical diagram of gene specific expression in various wheat tissues. Figure 5 for TaAPO1 Gene expression in spikelet primordium.

[0081] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a gene encoding the same, or a biological material containing the gene encoding the same, in regulating wheat phenotype; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No.1 to SEQ ID No.3; (b) A sequence having the function of regulating wheat phenotype by replacing, and / or deleting, and / or adding one or more amino acid residues in the sequence shown in any one of SEQ ID NO.1 to SEQ ID No.

3.

2. The use according to claim 1, characterized in that The wheat phenotype includes at least one aspect of plant height, ear length, number of spikelets per ear, grain length, grain width, thousand-grain weight, and number of grains per ear.

3. Application of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a gene encoding the same, or a biological material containing the gene encoding the same, in regulating wheat yield; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No.1 to SEQ ID No.3; (b) A sequence having the function of regulating wheat yield by replacing, and / or deleting, and / or adding one or more amino acid residues in the sequence shown in any one of SEQ ID NO.1 to SEQ ID No.

3.

4. Application of TaAPO1 protein or a fusion protein of TaAPO1 protein, or a gene encoding the same, or a biological material containing the gene encoding the same in wheat variety improvement; the amino acid sequence of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No.1 to SEQ ID No.3; (b) A sequence having the function of regulating wheat phenotype or yield by replacing, and / or deleting, and / or adding one or more amino acid residues in the sequence shown in any one of SEQ ID NO.1 to SEQ ID No.

3.

5. The use according to any one of claims 1 to 4, characterized in that: The amino acid sequence of the TaAPO1 protein is any one of SEQ ID No.7, SEQ ID No.8, SEQ ID No.11, SEQ ID No.12, and SEQ ID No.

13.

6. The use according to any one of claims 1 to 4, characterized in that: The coding gene of the TaAPO1 protein is at least one of the following: (a) a sequence as shown in any one of SEQ ID No. 4 to 6; (b) A DNA molecule capable of affecting wheat phenotype or yield formed by substitution of one or several bases and / or insertion and / or deletion of one or several bases or insertion / deletion / shift / inversion of a large fragment of nucleotide sequence based on any one of SEQ ID NOs. 4 to 6.

7. The use according to claim 6, characterized in that: The coding gene of the TaAPO1 protein is a sequence shown in any one of SEQ ID No.9, SEQ ID No.10, SEQ ID No.14, SEQ ID No.15, and SEQ ID No.

16.

8. The use according to any one of claims 1 to 7, characterized in that: The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineered bacteria or non-renewable plant cells or tissues.

9. The use according to any one of claims 1 to 7, characterized in that: Wheat phenotype or wheat yield is regulated by adjusting the expression level or activity of TaAPO1 protein or gene.

10. The use according to claim 9, characterized in that: The expression level or activity of TaAPO1 protein or gene is regulated through hybridization technology, transgenic technology or gene editing technology.

Images