Binding proteins that specifically bind to mycoplasma pneumoniae p1 protein, methods of making and use

By preparing a binding protein that specifically binds to the P1 protein of Mycoplasma pneumoniae, the problems of complex operation and unstable results in the diagnosis of Mycoplasma pneumoniae in the existing technology have been solved, and efficient and stable diagnosis and purification effects of Mycoplasma pneumoniae have been achieved.

CN119661704BActive Publication Date: 2026-04-28ZHUHAI LIHE MEDICAL DIAGNOSTIC PROD CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHUHAI LIHE MEDICAL DIAGNOSTIC PROD CO LTD
Filing Date
2024-12-20
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Current technologies for diagnosing Mycoplasma pneumoniae pneumonia lack high-affinity and scalable anti-Mycoplasma pneumoniae antibodies, resulting in complex diagnostic methods, unstable results, and difficulty in achieving positive quality control.

Method used

We developed a binding protein that specifically binds to the Mycoplasma pneumoniae P1 protein, expressed it in mammalian cells using recombinant technology, and prepared a high-affinity MpP1 binding protein for the identification and diagnostic assistance of Mycoplasma pneumoniae antigens.

Benefits of technology

It provides a binding protein that is easy to operate, has small batch-to-batch variation, and good stability. It can efficiently recognize and bind to Mycoplasma pneumoniae P1 protein for rapid diagnosis and purification, reducing production costs and improving the reliability of diagnostic results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119661704B_ABST
    Figure CN119661704B_ABST
Patent Text Reader

Abstract

The application provides a binding protein specifically binding to Mycoplasma pneumoniae P1 protein, a preparation method and application, and relates to the technical field of biotechnology.The binding protein contains a heavy chain variable region and a light chain variable region, the complementarity determining region of the heavy chain variable region includes an amino acid sequence identical to VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; the complementarity determining region of the light chain variable region includes an amino acid sequence identical to VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO.2 or 3.The binding protein has good specific binding capacity to the Mycoplasma pneumoniae P1 protein, can also bind to Mycoplasma pneumoniae whole bacteria, and can be used for detection of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein, and detection and diagnosis of Mycoplasma pneumoniae or Mycoplasma pneumoniae infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a binding protein that specifically binds to the P1 protein of Mycoplasma pneumoniae, its preparation method, and its application. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] Mycoplasma pneumoniae (MP) is one of the important pathogens causing respiratory infections in humans. The lung inflammation caused by its infection is called mycoplasma pneumoniae pneumonia (MPP), which can affect the bronchi, bronchioles, alveoli, and lung interstitium. Mycoplasma pneumoniae pneumonia (MPP) is the most common community-acquired pneumonia in children aged 5 years and older in my country. Mycoplasma pneumoniae (CAP) is currently diagnosed primarily by combining clinical manifestations, imaging findings, and etiological analysis. Etiological analysis includes isolation and culture methods, serological testing, and nucleic acid testing. Because Mycoplasma pneumoniae grows slowly, culture methods cannot meet the needs of rapid clinical diagnosis. While nucleic acid testing improves sensitivity, it requires standardized procedures and strict quality control; otherwise, nonspecific reactions are prone to occur. Therefore, serological diagnosis remains the most commonly used method in clinical practice. In serological antibody testing, especially in semi-quantitative or quantitative detection, positive control is essential. However, positive serum is difficult to obtain and exhibits significant batch-to-batch variability. Therefore, developing high-affinity recombinant monoclonal antibodies against Mycoplasma pneumoniae that are easy to obtain, can be mass-produced, and can be widely applied in clinical diagnosis is of great significance for the diagnosis and treatment of Mycoplasma pneumoniae infection.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a binding protein that specifically recognizes the P1 protein of Mycoplasma pneumoniae, and has been verified to possess the same recognition and binding activity as whole Mycoplasma pneumoniae bacteria. Based on the binding protein provided by this invention, another objective is to provide its applications. A further objective of this invention is to develop a binding protein with good binding activity for the P1 protein of Mycoplasma pneumoniae using a simpler method, which can be used for the identification of Mycoplasma pneumoniae antigens and to assist in the diagnostic detection of Mycoplasma pneumoniae infection.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0007] Mycoplasma pneumoniae P1 protein, also known as Mycoplasma pneumoniae P1 protein or MpP1, is a major protein on the surface of Mycoplasma pneumoniae. It is approximately 170 kDa. P1 protein is mainly concentrated at the apex of organelles and contains multiple antigenic determinants. P1 protein plays an adhesive role in the binding of Mycoplasma pneumoniae to host receptors and possesses strong immunogenicity. While antibody screening using whole Mycoplasma pneumoniae bacteria as targets is challenging due to their complex composition, the application of P1 protein as an antigenic component in clinical serum antibody detection is continuously being developed. Therefore, P1 protein is considered a target for screening binding proteins.

[0008] The binding protein provided by this invention can specifically bind to the Mycoplasma pneumoniae P1 protein, hereinafter referred to as MpP1 binding protein. The MpP1 bound by the MpP1 binding protein includes proteins having the natural MpP1 sequence and its variants, including but not limited to those containing at least one subunit that has been mutated, truncated, or fused with other domains. Variants retain the necessary antigenic epitopes for binding to the binding protein provided by this invention.

[0009] In this document, the technical term "binding protein" refers to a protein that binds to a specific antigen, broadly encompassing all proteins and protein fragments containing a complementarity-determining region (CDR). Binding proteins can be antibodies; the terms "antibody" and "full-length antibody" include both polyclonal and monoclonal antibodies. Furthermore, the term "antibody" includes both naturally occurring and non-naturally occurring antibodies, including, for example, chimeric, bifunctional, and humanized antibodies, as well as related synthetic isoforms. Non-naturally occurring antibodies are also referred to as "recombinant antibodies" in this document. The term "antibody" is used interchangeably with "immunoglobulin."

[0010] Binding proteins can also be antigen-binding fragments containing part or all of the antibody CDR, lacking at least some amino acids present in the full-length antibody chain but still capable of specifically binding to antigens. Such fragments are biologically active because they bind to the target antigen and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. These fragments are selected from, but are not limited to, F(ab')2, Fab', Fab, Fv (composed of VH and VL), ScFv (single-chain antibody with VH and VL linked by a linker peptide), dsFv (disulfide-stabilized Fv fragments, dsFv)), bispecific antibodies, nanobodies, and the smallest recognition unit of an antibody. In addition to the functional fragments mentioned above, any fragment with an extended half-life is also included.

[0011] The term "variable region" or "variable domain" refers to the amino-terminal domain of an antibody's heavy or light chain that recognizes and binds to antigens. The composition and arrangement of the amino acids in this region determine the antibody's specificity in recognizing antigens. The heavy chain variable domain can be referred to as "VH," and the light chain variable domain as "VL." Variable domains contain antigen-binding sites. Both the heavy and light chain variable regions consist of three complementarity-determining regions (CDRs) (also known as hypervariable regions) connected by four framework regions (FRs). The extent of the backbone region and CDRs has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest, E. Kabat et al.) and Chothia. Any CDR determination method well-known in the art, including combinations of methods, can identify CDRs of variable domains. CDRs in each chain are held together closely by FRs to form variable regions. Typically, the variable regions VL / VH of the heavy and light chains can be obtained by linking the following numbered CDRs with FRs in the following combination: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0012] The term "constant region" or "constant domain" refers to the constant region of a single antibody light chain or a constant region of an antibody heavy chain. An antibody heavy chain has a variable domain (VH) followed by one or more constant domains or regions, such as a hinge, CH1, CH2, CH3, and CH4. The CH1 domain is adjacent to the VH domain and is located at the amino terminus of the hinge region of the antibody heavy chain, and does not form a portion of the Fc region of the antibody. The hinge region includes the portion of the heavy chain molecule that links the CH1 domain to the CH2 domain. The N-terminus of CH2 is typically a CH3 domain, which usually forms the C-terminal portion of the antibody. In some antibody types, such as IgM and IgE, the constant region also includes a CH4 domain. The constant region of an antibody can originate from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD, as well as the constant regions of their subclasses and mutant forms.

[0013] This invention does not limit the method of obtaining the MpP1 binding protein. In some optional embodiments, the corresponding antibody can be obtained by linking a polynucleotide encoding the binding protein to a vector and expressing it in cells. The vector can be introduced into eukaryotic cells, especially mammalian cells, to construct a structure capable of expressing the binding protein. In other optional embodiments, the binding protein can also be obtained by recombinant genetic techniques known to those skilled in the art or by peptide synthesis, such as automated peptide synthesizers (e.g., automated peptide synthesizers sold by Applied BioSystems, etc.); the antigen-binding fragment can also optionally be generated by enzymatic cleavage of antigen-binding molecules (including intact antibodies), such as pepsin or papain cleavage; or by chemical cleavage, such as by chemical reduction of disulfide bonds to obtain the above-mentioned antigen-binding fragment.

[0014] The terms "specific recognition," "selective binding," "selective binding," and "specific binding," or similar expressions, refer to the binding of a binding protein to an epitope on a pre-determined antigen. Typically, binding proteins bind at a rate of approximately less than 10... -5 M, for example, approximately less than 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 M or smaller K D Value binding. The K value of the antibody can be determined using methods well-established in the art. D Values. Other standard assays for evaluating the binding ability of ligands, such as antibodies, to targets are known in the art, including, for example, ELISA, Western blotting, RIA, and flow cytometry.

[0015] In this document, the term "signaling substance" refers to a substance that can provide a detectable signal, which can be directly observed by the naked eye or detected by conventional instruments acceptable in the art. The signaling substance can provide a signal directly, such as color (e.g., colloidal gold, colored microspheres), fluorescence (fluorescent molecules), magnetism, radiation, or luminescence; or it can provide a signal indirectly through a reaction in which the signaling substance participates, such as catalyzing a specific substrate reaction to produce any of the above signals.

[0016] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. Polynucleotides encode the aforementioned binding proteins, optionally encoding either the sense or antisense strand. Polynucleotides can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein.

[0017] In this article, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into cells through transformation, transduction, or transfection, allowing the genetic material they carry to be expressed in the cells.

[0018] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, episome plasmids, microcircular DNA, phage particles, and Cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses. In some embodiments, the vectors of this invention contain regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

[0019] The terms “cell,” “cell line,” and “cell culture” used herein are used interchangeably, and all such names include progeny. Progeny may not be identical to primary cells due to natural, accidental, or intentional mutations, and may differ morphologically and / or in genomic DNA. “Transformation” and “transformed cell” include primary test cells and cultures derived therefrom. Cells may be prokaryotic or eukaryotic, with prokaryotic cells including, but not limited to, *Escherichia coli*, *Bacillus*, or *Staphylococcus*. Eukaryotic cells include, but are not limited to, mammalian cells, insect cell lines, plant cells, and fungal cells. Mammalian host cells include human, mouse, rat, dog, monkey, pig, goat, cattle, horse, and hamster cells, including but not limited to Chinese hamster ovary (CHO) cells, NSO, HeLa cells, young hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, 3T3 cells, and HEK-293 cells.

[0020] In this document, the terms “purified” or “isolated” associated with peptides or nucleic acids mean that the peptide or nucleic acid is not in its native medium or in its native form. Therefore, the term “isolated” includes peptides or nucleic acids removed from their original environment, such as if they are naturally occurring. For example, isolated peptides typically do not contain at least some proteins or other cellular components that are normally bound to or mixed with or in solution with them. Isolated peptides include naturally produced peptides contained in cell lysates, peptides in purified or partially purified forms, recombinant peptides, peptides expressed or secreted by cells, and peptides in heterologous cells or cultures. As associated with nucleic acids, the terms “isolated” or “purified” indicate, for example, that the nucleic acid is not in its native genomic background (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into heterologous cells).

[0021] In this document, unless otherwise stated, any numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order or importance between these entities or behaviors, such as numbers (Ⅰ), (Ⅱ)...(Ⅶ).

[0022] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0023] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0024] Firstly, a binding protein (MpP1 binding protein) that specifically binds to Mycoplasma pneumoniae P1 protein is provided, comprising a heavy chain variable region and a light chain variable region.

[0025] The variable region of the heavy chain includes complementarity-determining regions VH-CDR1, VH-CDR2, and VH-CDR3; the variable region of the light chain includes complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3.

[0026] The VH-CDR1 comprises an amino acid sequence identical to that of the VH-CDR1 of the heavy chain variable region shown in SEQ ID NO.1; the VH-CDR2 comprises an amino acid sequence identical to that of the VH-CDR2 of the heavy chain variable region shown in SEQ ID NO.1; and the VH-CDR3 comprises an amino acid sequence identical to that of the VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; and the VL-CDR1 comprises an amino acid sequence identical to that of the VL-CDR1 of the light chain variable region shown in SEQ ID NO.2; the VL-CDR2 comprises an amino acid sequence identical to that of the VL-CDR2 of the light chain variable region shown in SEQ ID NO.2; and the VL-CDR3 comprises an amino acid sequence identical to that of the VL-CDR3 of the light chain variable region shown in SEQ ID NO.2.

[0027] Alternatively, VH-CDR1 may comprise an amino acid sequence consistent with VH-CDR1 of the heavy chain variable region shown in SEQ ID NO.1, VH-CDR2 may comprise an amino acid sequence consistent with VH-CDR2 of the heavy chain variable region shown in SEQ ID NO.1, and VH-CDR3 may comprise an amino acid sequence consistent with VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; and VL-CDR1 may comprise an amino acid sequence consistent with VL-CDR1 of the light chain variable region shown in SEQ ID NO.3, VL-CDR2 may comprise an amino acid sequence consistent with VL-CDR2 of the light chain variable region shown in SEQ ID NO.3, and VL-CDR3 may comprise an amino acid sequence consistent with VL-CDR3 of the light chain variable region shown in SEQ ID NO.3.

[0028] It is understood that the amino acid sequences of the variable regions shown in SEQ ID NO. 1-3, excluding the CDR region, are not intended to limit the MpP1 binding protein provided by this invention. For example, if the MpP1 binding protein provided by this application contains a backbone region, it may differ from the backbone region in the variable regions shown in SEQ ID NO. 1-3. The CDR region in the variable regions shown in SEQ ID NO. 1-3 can be divided according to any optional method known in the art. Optionally, the VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2, and VL-CDR3 of the variable regions are defined by any one or a combination of multiple definition systems such as Kabat, Chothia, IMGT, ABM, or Contact. Taking Kabat, Chothia, IMGT, ABM, or Contact as examples, the amino acid sequences of the CDR region are shown in Tables 1-3 respectively:

[0029] Table 1 shows the heavy chain CDRs of VH as indicated by SEQ ID NO.1.

[0030]

[0031] Table 2 shows the light chain CDRs of VL as indicated by SEQ ID NO.2. Table 3 shows the light chain CDRs of VL as indicated by SEQ ID NO.3.

[0032]

[0033] In an optional embodiment, the MpP1 binding protein has VH-CDR1, VH-CDR2, and VH-CDR3, the heavy chain variable regions defined in Table 1, and VL-CDR1, VL-CDR2, and VL-CDR3, the light chain variable regions defined in Table 2. Taking the IMGT definition as an example: the amino acid sequence of VH-CDR1 is shown in SEQ ID NO.12, the amino acid sequence of VH-CDR2 is shown in SEQ ID NO.17, and the amino acid sequence of VH-CDR3 is shown in SEQ ID NO.20; the amino acid sequence of VL-CDR1 is shown in SEQ ID NO.23, the amino acid sequence of VL-CDR2 is SGS, and the amino acid sequence of VL-CDR3 is shown in SEQ ID NO.26.

[0034] In an optional embodiment, the MpP1 binding protein has VH-CDR1, VH-CDR2, and VH-CDR3, the heavy chain variable regions defined in Table 1, and VL-CDR1, VL-CDR2, and VL-CDR3, the light chain variable regions defined in Table 3. Taking the IMGT definition as an example: the amino acid sequence of VH-CDR1 is shown in SEQ ID NO.12, the amino acid sequence of VH-CDR2 is shown in SEQ ID NO.17, and the amino acid sequence of VH-CDR3 is shown in SEQ ID NO.20; the amino acid sequence of VL-CDR1 is shown in SEQ ID NO.30, the amino acid sequence of VL-CDR2 is KVS, and the amino acid sequence of VL-CDR3 is shown in SEQ ID NO.33.

[0035] In an optional implementation, the antibody sequence, excluding the CDR region, is derived from one or more species including rabbit, cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, fighting cock, human, and mutants thereof.

[0036] In an optional implementation, the heavy chain variable region further includes at least one skeleton region, such as one skeleton region, two skeleton regions, three skeleton regions, or four skeleton regions.

[0037] In an optional implementation, the light chain variable region further includes at least one skeleton region, such as one skeleton region, two skeleton regions, three skeleton regions, or four skeleton regions.

[0038] In an optional embodiment, the backbone region VH-FR1 of the heavy chain variable region includes an amino acid sequence consistent with VH-FR1 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the backbone region VH-FR2 includes an amino acid sequence consistent with VH-FR2 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the backbone region VH-FR3 includes an amino acid sequence consistent with VH-FR3 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the backbone region VH-FR4 includes an amino acid sequence consistent with VH-FR4 of the heavy chain variable region shown in SEQ ID NO.1.

[0039] In an optional embodiment, the backbone region VL-FR1 of the light chain variable region includes an amino acid sequence consistent with the VL-FR1 of the light chain variable region shown in SEQ ID NO. 2 or 3; and / or, the backbone region VL-FR2 includes an amino acid sequence consistent with the VL-FR2 of the light chain variable region shown in SEQ ID NO. 2 or 3; and / or, the backbone region VL-FR3 includes an amino acid sequence consistent with the VL-FR3 of the light chain variable region shown in SEQ ID NO. 2 or 3; and / or, the backbone region VL-FR4 includes an amino acid sequence consistent with the VL-FR4 of the light chain variable region shown in SEQ ID NO. 2 or 3.

[0040] In an optional embodiment, the amino acid sequence of the heavy chain variable region of the MpP1 binding protein is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2.

[0041] In an optional embodiment, the amino acid sequence of the heavy chain variable region of the MpP1 binding protein is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.3.

[0042] In an optional implementation, the MpP1 binding protein is an antibody or antigen-binding fragment including a constant region.

[0043] In an optional implementation, at least a portion of the constant region sequence of the MpP1 binding protein is a human constant region sequence.

[0044] In an optional embodiment, the constant region sequence of the MpP1 binding protein is selected from the sequence of part or all of the constant regions of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD, wherein IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD include their subclasses and mutant forms.

[0045] In an optional embodiment, the MpP1 binding protein contains a heavy chain constant region.

[0046] In an optional embodiment, the heavy chain constant region sequence of the MpP1 binding protein is selected from part or all of the constant region sequence of human IgG1, preferably including at least one of CH1, CH2 and CH3, which are constant regions of human IgG1.

[0047] In an optional embodiment, the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.4.

[0048] In an optional embodiment, the MpP1 binding protein contains a light chain constant region.

[0049] In an optional implementation, the light chain constant region sequence is selected from the light chain constant region of a mouse.

[0050] In an optional embodiment, the amino acid sequence of the light chain constant region is shown in SEQ ID NO.5.

[0051] In an optional embodiment, the MpP1 binding protein is Fab, and the amino acid sequence of the heavy chain variable region of Fab is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2.

[0052] In an optional embodiment, the MpP1 binding protein is Fab, and the amino acid sequence of the heavy chain variable region of Fab is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.3.

[0053] In an optional embodiment, the MpP1 binding protein is a human-mouse chimeric antibody, and the heavy chain amino acid sequence of the MpP1 binding protein is shown in SEQ ID NO.6, and the light chain amino acid sequence is shown in SEQ ID NO.7.

[0054] In a second aspect, a biological material is also provided, comprising a polynucleotide, a carrier, or a cell; wherein the polynucleotide encodes the aforementioned MpP1 binding protein; the carrier carries the polynucleotide; and the cell carries the polynucleotide, or contains the carrier, or is capable of expressing the MpP1 binding protein.

[0055] By linking the vector with a polynucleotide encoding the MpP1 binding protein, the vector can be introduced into eukaryotic cells, especially mammalian cells, to construct a cell line that can express the MpP1 binding protein, and the corresponding protein can be obtained through cell expression.

[0056] In an optional embodiment, the cells used to express the MpP1 binding protein are 293 cells (human kidney epithelial cell line), preferably 293F cells.

[0057] In an optional implementation, the cells used to express the MpP1 binding protein are CHO cells (Chinese hamster ovary cells).

[0058] Thirdly, a method for preparing the MpP1 binding protein of the first aspect is also provided, including culturing cells of the second aspect capable of expressing the MpP1 binding protein.

[0059] In an optional embodiment, the preparation method further includes converting and expressing a polynucleotide encoding the MpP1 binding protein into cells, and obtaining the MpP1 binding protein through purification.

[0060] In an optional embodiment, the preparation method further includes synthesizing a polynucleotide containing the gene encoding the MpP1 binding protein as needed, and / or preparing a suitable expression vector as needed, transforming the expression vector into the desired cells and expressing it, and obtaining the MpP1 binding protein through purification.

[0061] In an optional embodiment, the cell is prepared by converting a polynucleotide encoding a MpP1 binding protein as described in the first aspect into the cell, the polynucleotide comprising a heavy chain expression plasmid and a light chain expression plasmid, and the conversion comprising co-converting the heavy chain expression plasmid and the light chain expression plasmid into the cell.

[0062] In an optional implementation, the C-terminus of the heavy chain variable region is fused with a constant region fragment to construct a complete heavy chain expression plasmid.

[0063] In an optional embodiment, the constant region segment includes one or more of CH1, CH2 and CH3, preferably including CH1, CH2 and CH3.

[0064] In an optional embodiment, the cell is a eukaryotic cell, preferably a mammalian cell.

[0065] In an optional embodiment, the mammalian cells include 293 cells or CHO cells, preferably 293F cells.

[0066] Fourthly, the application of the MpP1 binding protein of the first aspect or the biological material of the second aspect in any of the following (I) to (VII) is also provided:

[0067] (I) Non-diagnostic and treatment-oriented detection of anti-Mycoplasma pneumoniae antibodies;

[0068] (II) Preparation of products for detecting antibodies against Mycoplasma pneumoniae;

[0069] (III) Prepare products for the diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection;

[0070] (IV) Detection of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein for non-diagnostic and treatment purposes;

[0071] (V) Prepare products for detecting Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein;

[0072] (VI) Used for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein;

[0073] (VII) Prepare products for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein.

[0074] In the applications described in (I) to (III) above, MpP1 binding protein can be used as a standard and / or quality control material for detection to provide a reliable reference for the detection results, and can also be used to construct a standard curve.

[0075] In an optional embodiment, the anti-Mycoplasma pneumoniae antibody includes an anti-Mycoplasma pneumoniae P1 protein antibody.

[0076] In an optional implementation, the Mycoplasma pneumoniae infection includes Mycoplasma pneumoniae pneumonia.

[0077] The applications described in aspects (IV) to (VII) above can utilize the ability of MpP1-binding proteins to specifically target and bind to MpP1, thereby enabling the detection, isolation, enrichment, and / or purification of Mycoplasma pneumoniae or MpP1. In an optional embodiment, when the MpP1-binding protein is an immunoconjugate, such as one linked to a signal, the location or real-time detection of Mycoplasma pneumoniae or MpP1 can be achieved by detecting the signal. In another optional embodiment, the detection, isolation, enrichment, and / or purification of Mycoplasma pneumoniae or MpP1 can be achieved by separating the MpP1-binding protein-MpP1 immune complex.

[0078] In optional embodiments, in aspects (II), (III), (V) or (VII) above, those skilled in the art can prepare corresponding products (such as the immunoconjugates mentioned above) according to actual uses, and select other reagent components in the product, including but not limited to one or more of the following: signaling agents, solid-phase carriers, buffer reagents, salts, secondary antibodies, chromogenic substrates, blocking solutions, washing solutions, solvents, elution solutions, conjugates, negative controls, positive controls, standards, quality control products, and markers.

[0079] Fifthly, a reagent or kit is also provided, the reagent or kit comprising the MpP1 binding protein of the first aspect or the biological material of the second aspect.

[0080] In an optional embodiment, the kit is used to detect anti-Mycoplasma pneumoniae antibodies or Mycoplasma pneumoniae infection; the kit includes standards and / or quality control products, the standards and / or quality control products containing the MpP1 binding protein.

[0081] In an optional embodiment, the kit is used to detect Mycoplasma pneumoniae, and the binding protein is used to capture Mycoplasma pneumoniae or MpP1.

[0082] In an optional embodiment, the kit further includes a solid support.

[0083] In optional embodiments, the MpP1 binding protein in the reagent or kit is coupled to a solid-phase carrier; or the MpP1 binding protein and the solid-phase carrier are packaged separately. By coupling the MpP1 binding protein to the solid-phase carrier, it can be used to capture Mycoplasma pneumoniae or MpP1 in the sample to be tested. Alternatively, by coupling the MpP1 binding protein to the solid-phase carrier, it can be used to purify Mycoplasma pneumoniae or MpP1.

[0084] In an optional implementation, the kit may further include a signaling agent.

[0085] In optional embodiments, the MpP1 binding protein in the reagent or kit is coupled to the signaling molecule; or the MpP1 binding protein and the signaling molecule in the reagent or kit are packaged separately. By coupling the MpP1 binding protein to the signaling molecule, it can be used to locate and detect Mycoplasma pneumoniae or MpP1, or to detect MpP1 in a sample by Western blotting.

[0086] The reagents or kits described above may also optionally include reagents and / or consumables well known to those skilled in the art for use in detecting reactions or purifying proteins, including but not limited to one or more of buffers, salts, secondary antibodies, chromogenic substrates, blocking solutions, washing solutions, solvents, elution solutions, coupling agents, negative controls, positive controls, standards, quality controls, and markers.

[0087] The above-described reagents or kits can be used in general immunoassay methods acceptable in the art, including but not limited to immunofluorescence staining, flow cytometry, immunoblotting, immunohistochemistry, ELISA, immunochromatography, or immunomagnetic beads. Those skilled in the art can formulate other reagents in the reagents or kits according to the corresponding detection methods, and the present invention does not limit this.

[0088] The signaling agents in any of the above embodiments include, but are not limited to, one or more of the following: enzymes, luminescent labels, fluorescent microspheres, colored microspheres, latex microspheres, colloidal gold, quantum dots, biotin, streptavidin, radionuclides, radioactive contrast agents, paramagnetic ions, metals, and photosensitizers.

[0089] Examples of enzymes include, but are not limited to, alkaline phosphatase or horseradish peroxidase. Luminescent labels include, but are not limited to, fluorescent proteins, synthetic small molecules, or polymer dyes. Specific examples include, but are not limited to, Alexa 350, Alexa 405, Alexa 430, Alexa 488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY630 / 650, BODIPY650 / 665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein, 5-carboxy-2′,4′,5′,7′-tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxyrhodamine, 6-carboxytetramethylrhodamine, and Cascade. Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, Dansyl chloride, Fluorescein, HEX, 6-JOE, NBD (7-nitrobenzo-2-oxa-1,3-diazole), Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, Phthalic acid, Terephthalic acid, Isophthalic acid, Cresol Violet, Cresol Blue Violet, Brilliant Cresol Blue, p-Aminobenzoic acid, Erythrosine, Phthalocyanine, Azocyanine, Anthocyanin, Xanthine, Succinyl fluorescein, Rare earth metal cavitation compounds, Tribispyridyldiamine europium, europium cavitation compounds or chelates, Diamine, Dianthocyanin, LaJolla Blue dye, Allococyanin B. Phycocyanin C, Phycocyanin R, Thiamine, Phycoerythrin, Phycoerythrin R, REG, Rhodamine Green, Rhodamine Isothiocyanate, Rhodamine Red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine, and Texas Red, one or more of these. Fluorescent microspheres, colored microspheres, and latex microspheres are each independently selected from products acceptable in the art, such as those derived from commercially available products. Radionuclides include, but are not limited to, those derived from... 110 In、 111 In、 177 Lu、 18 F, 52 Fe、 62 Cu、 64 Cu、 67 Cu、 67 Ga、 68 Ga、 86 Y、 90 Y、 89 Zr、 94 mTc, 94 Tc, 99 mTc, 120 I,123 I, 124 I, 125 I, 131 I, 154-158 Gd, 32 P, 11 C 13 N、 15 O、 186 Re、 188 Re、 51 Mn, 52 mMn, 55 Co、 72 As、 75 Br、 76 Br、 82 mRb and 83 One or more of Sr. Paramagnetic ions include, but are not limited to, one or more of chromium (III), manganese (II), iron (III), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and erbium (III).

[0090] The solid-phase support in any of the above embodiments includes, but is not limited to, microtubes, columns, microparticles, nitrocellulose membranes, chromatography matrices, or side-flow devices; more specifically, it can be, but is not limited to, enzyme-labeled wells, immunochromatographic test strips, or magnetic beads. The chromatography matrix can be any known chromatography matrix acceptable in the art, including but not limited to polystyrene, polysaccharide polymers, or silica gel. In optional embodiments, the chromatography matrix includes gel particles.

[0091] This invention discloses an MpP1 binding protein, which is further used to prepare a human-mouse chimeric recombinant monoclonal antibody. This invention has the following beneficial effects:

[0092] (1) This invention discloses a sequence-known MpP1 binding protein and its preparation method. It can be recombinantly expressed in vitro, and has the advantages of simple operation, short time consumption, controllable production process, small batch-to-batch variation of products, and good stability. It has good application prospects.

[0093] (2) The MpP1 binding protein prepared in this invention can effectively bind to Mycoplasma pneumoniae or MpP1, with an optimal EC50 of 2.5 nM and excellent affinity. It can be used for the detection of natural Mycoplasma pneumoniae or MpP1, including but not limited to the use of chemiluminescence, liquid chromatography-mass spectrometry, immunofluorescence staining, flow cytometry, fluorescent microspheres, and other techniques to identify natural Mycoplasma pneumoniae or MpP1; the MpP1 binding protein can also be coupled with a chromatographic matrix for immunoaffinity chromatography purification of Mycoplasma pneumoniae or MpP1 to improve antigen purity.

[0094] (3) The MpP1 binding protein can be used as a quality control and / or standard for anti-Mycoplasma pneumoniae antibody (such as anti-MpP1 antibody detection) products; when MpP1 binding protein is used as a quality control in the test kit, it can alleviate the problems of complicated operation of polyclonal antibodies and low subsequent conjugation efficiency; it can reduce production costs, stabilize product quality, and significantly improve reaction values; on the other hand, compared with directly using human serum, it can also avoid the problems of difficult sample sources and high costs. Attached Figure Description

[0095] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0096] Figure 1 This is an electrophoresis diagram of the heavy chain (Fd) and light chain (L) used to construct the library in Example 1;

[0097] Figure 2 This is an electrophoresis image of the Fab gene fragment used to construct the library in Example 1;

[0098] Figure 3 This is an SDS-PAGE protein electrophoresis image of the anti-Mp P1 recombinant Fab monoclonal antibody in Example 2. The heavy and light chains are approximately 25 kDa.

[0099] Figure 4 In Example 3, the binding activity of recombinant Fab monoclonal antibody to Mp P1 protein was determined by ELISA. Ab01-MpP1 represents the binding activity of recombinant Fab monoclonal antibody to Mp P1 antigen, and Ab01-BSA represents the non-specific binding activity of recombinant Fab monoclonal antibody to control protein BSA.

[0100] Figure 5 To analyze the binding of the optimized recombinant Fab monoclonal antibody to the Mp P1 protein using ELISA in Example 4, Ab02-Mp P1 represents the binding activity of the recombinant monoclonal antibody to the Mp P1 antigen, and Ab02-BSA represents the non-specific binding activity of the recombinant monoclonal antibody to the control protein BSA.

[0101] Figure 6 This is an SDS-PAGE protein electrophoresis image of the anti-Mp P1 recombinant IgG monoclonal antibody in Example 5. The Mp P1-Ab-non-reduced to non-reduced SDS-PAGE electrophoresis result shows a size of approximately 150 kDa. The Mp P1-Ab-reduced to reduced SDS-PAGE electrophoresis result shows heavy chain and light chain sizes of 50 kDa and 25 kDa, respectively.

[0102] Figure 7 In Example 6, the ELISA assay was used to determine the binding of recombinant IgG monoclonal antibody to Mp P1 protein. Ab03-MpP1 represents the binding activity of the recombinant monoclonal antibody to the Mp P1 antigen, and Ab03-BSA represents the non-specific binding activity of the recombinant monoclonal antibody to the control protein BSA. Detailed Implementation

[0103] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0104] Example 1: Screening of Mp P1 binding proteins

[0105] (I) Preparation of phage display library

[0106] 1) Spleens were harvested from mice immunized with Mp P1 antigen (purchased from Maiyue Biotechnology Co., Ltd., catalog number MR220102), and lymphocytes were separated using mouse lymphocyte separation solution.

[0107] 2) RNA extraction: Take 1×10 6 Total RNA was extracted from lymphocytes using the RNAsimple Total RNA Extraction Kit.

[0108] 3) Reverse transcription: The extracted total RNA is reverse transcribed to synthesize cDNA.

[0109] 4) Antibody gene fragment amplification: Using cDNA as a template, specific amplification primers are used to amplify the κ and λ light chains and the VH-CH1(Fd) region of the heavy chain of the antibody.

[0110] 20 μL reaction system: 1 μL cDNA, 0.8 μL Lime F, 0.8 μL Lime R, 10 μL 2×phanta maxmaster mix, 7.4 μL Nuclease-Free Water;

[0111] Reaction procedure: Depolymerization at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 45 seconds, 30 cycles.

[0112] After the reaction was complete, loading buffer was added to the system, and the mixture was identified by 1% agarose gel electrophoresis. The electrophoresis results are shown below. Figure 1 As shown, the target band is approximately 750 bp.

[0113] The target band was excised, and the antibody heavy chain (Fd) gene fragment and light chain gene fragment (L) were recovered separately.

[0114] 5) Antibody light chain and heavy chain gene fragments are combined into complete Fab gene fragments by overlapping PCR.

[0115] 25 μL reaction system and procedure: 30 ng light chain, 4.3 ng linker, 30 ng heavy chain, 0.5 μL sfi IF (upstream primer), 0.5 μL sfi IR (downstream primer), 12.5 μL 2×phantamax master mix, Nuclease-Free Water to bring the total system to 25 μL.

[0116] Reaction procedure: Depolymerization 95℃ for 30 s, annealing 55℃ for 30 sec, extension 72℃ for 90 s, 30 cycles. After the reaction, loading buffer was added to the system, and the mixture was identified by 1% agarose gel electrophoresis. The electrophoresis pattern is shown below. Figure 2 As shown, the target band is approximately 1500 bp. The target band was excised, and the antibody Fab fragment was recovered.

[0117] Upstream primer sfi IF: 5'>GAGCAGGAGCATAGGAGGATCGGGCGGCGGCC<3' (SEQ ID NO.35);

[0118] Downstream primer sfiⅠR: 5'>CCATGGCAATGGTGATTCTGCTGCGCGGCCTGGCC<3' (SEQ ID NO. 36).

[0119] 6) Plasmid construction: Digest the antibody Fab fragment and pComb3xSS plasmid with sfiI enzyme, mix them at a molar ratio of 3:1 between the digested fragment and the plasmid, add T4 DNA ligase, and ligate overnight at 16°C.

[0120] 7) Library Construction: Recover the ligation product from the previous step. Take 1.5 μl of the recovered product, add TG1 competent cells, mix well, and transfer to an electroporation cuvette for electroporation. Parameter selection: Bac-Ec1. After electroporation, activate and incubate at 37°C for 1 h. Transfer the activated bacterial culture to 200 mL of 2×YT medium, add 1 / 1000 ampicillin antibiotic and a final concentration of 2% glucose solution, and incubate at 37°C and 220 rpm until OD600 = 0.6. Add 20 times the number of helper phage M13K07 cells. Mix well and place in a shaker at 37°C for static infection for 45 min. Centrifuge for 15 min to collect the bacteria, resuspend the pellet in 200 mL of fresh 2×YT+Amp+Kana medium, and incubate at 30°C and 220 rpm for 14 h for phage amplification. The next day, centrifuge to collect the supernatant, add 1 / 4 volume of 20% PEG6000 to precipitate the phage, and resuspend in PBS to obtain the phage display library.

[0121] (II) Screening for anti-MpP1 antibodies using a phage display library

[0122] 1) Using biotin-conjugated Mp P1 protein as the target antigen, after incubating with SA magnetic beads for 1 hour, 1×10⁻⁶ ppm of the protein was added to the reaction system. 12 The obtained phages were incubated for 1 hour. Specific phages were captured by the antigen and washed with PBST (PBS + 0.05% Tween-20).

[0123] 2) Add the antigen-binding magnetic beads to the TG1 bacterial culture, incubate at 37°C for 45 min, then activate and culture at 37°C and 220 rpm for 1 h. Take an appropriate amount of the incubated bacterial culture, serially dilute it and spread it on ampicillin plates. Add glucose (final concentration 2%) and 1 / 1000 ampicillin antibiotic to the remaining bacterial culture, and shake at 37°C and 220 rpm for 3 h.

[0124] 3) Add 10 μL M13K07 to the bacterial culture and incubate at 37°C for 45 min for infection.

[0125] 4) Centrifuge at 6000×g for 10 min, resuspend in 10 mL of 2×YT+Amp+Kana medium, and amplify the phage by shaking at 30℃ and 220 rpm for 14 h. On the second day, centrifuge to collect the supernatant, add 1 / 4 volume of 20% PEG6000 to precipitate the phage, and resuspend in PBS to obtain the phages selected in the first round of screening.

[0126] 5) Using the phages obtained in the first round of screening, repeat steps 1 to 4 to perform the second round of screening.

[0127] 6) Single clone identification: Single clones were selected from the second round of screening and plated onto 96-well deep-well plates, and the phages were amplified by overnight shaking.

[0128] Plate coating: ELISA plates were coated with Mp P1 antigen, and BSA was used as a control protein for plate coating. The plates were incubated overnight at 4°C.

[0129] Blocking: On the second day, discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 hours.

[0130] Primary antibody preparation: Centrifuge 96-well deep-well plates, take the supernatant and dilute it in a final concentration of 1% milk, mix well and use it as the primary antibody for later use.

[0131] Primary antibody incubation: Discard the blocking solution, wash the plate with PBST, pat dry, add the primary antibody, and incubate at 37°C for 2 hours.

[0132] Secondary antibody incubation: Discard the primary antibody, wash the plate with PBST, blot dry, add 1:5000 diluted Anti-M13 Antibody (HRP) secondary antibody, and incubate at 37°C for 1 hour. Discard the secondary antibody, wash the plate with PBST, blot dry, add the chromogenic substrate for color development, and add stop solution after 15 minutes to stop the reaction. Read the value using a microplate reader.

[0133] 7) Select clones with high read values ​​(Mp P1 antigen well OD value > 1) and low nonspecific binding (BSA control protein well OD value < 0.5) for sequencing.

[0134] Light chain sequencing primers: Bomp: 5'>GTGTGGAATTGTGAGCGG<3' (SEQ ID NO.37);

[0135] Heavy chain sequencing primers: PELB: 5'>ACCTATTGCCTACGGCAGCCG<3' (SEQ ID NO.38).

[0136] Twenty single clones were selected for sequencing, and the sequencing results yielded an MpP1 binding protein sequence including an antigen-binding domain.

[0137] The heavy chain variable region sequence is shown in SEQ ID NO.1, and the light chain variable region sequence is shown in SEQ ID NO.2; further analysis revealed that the antigen-binding domain comprises the following light and heavy chain CDRs:

[0138] Table 1 shows the heavy chain CDRs of VH as indicated by SEQ ID NO.1.

[0139]

[0140]

[0141] Table 2 shows the light chain CDRs of VL as indicated by SEQ ID NO.2.

[0142]

[0143] Example 2: Prokaryotic expression and purification of anti-Mp P1 recombinant monoclonal antibody

[0144] 1) Based on the sequencing results, select single clones with the corresponding sequence from the deep well plate and transfer them to 2 ml of 2×YT+Amp medium. Shake for 12 h and extract plasmids.

[0145] 2) Transform HB2151 competent cells with plasmid, select single spots from overnight cultured Amp resistance plates and inoculate them into 2 ml of 2×YT+Amp medium, shake at 37℃ for 3-4 h, transfer to 200 ml of 2×YT+Amp medium, shake at 37℃ for 3-4 h, add IPTG to induce expression overnight;

[0146] 3) Collect the bacteria: Resuspend the bacterial cells in 20 ml PBS, add 200 μl PB for lysis, and incubate with shaking at room temperature for 1 h. Centrifuge to collect the supernatant.

[0147] 4) Protein affinity chromatography purification: Ni packing material was added to the supernatant to purify the Fab monoclonal antibody. The eluent was replaced with PBS buffer in an ultrafiltration centrifuge tube and concentrated. The protein concentration was determined, and 3 μg was taken for electrophoresis identification. Figure 3 .

[0148] Example 3: ELISA determination of the binding activity of Fab monoclonal antibody to Mp P1 antigen.

[0149] 1) Coat Mp P1 protein (2 μg / mL) onto an ELISA plate, and simultaneously coat it with BSA as a non-specific binding control. Incubate overnight at 4°C.

[0150] 2) Discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 hours.

[0151] 3) Discard the blocking solution, wash the plate with PBST, pat dry, add 1000 nM of antibody initially diluted 2-fold, and incubate at 37°C for 1.5 h.

[0152] 4) Discard the primary antibody, wash the plate with PBST, pat dry, add horseradish peroxidase (HRP)-labeled anti-his secondary antibody, and incubate at 37°C for 1 hour.

[0153] 5) Discard the secondary antibody, wash the plate with PBST, pat dry, add the chromogenic substrate for color development, add the stop solution after 15 min to stop the reaction, and measure the OD value with an ELISA reader.

[0154] A nonlinear fitting plot was created with OD values ​​on the ordinate and the logarithm of antibody molar concentration on the x-axis. For example... Figure 4 The EC50 value of the antibody is approximately 53 nM.

[0155] Example 4 Antibody Optimization

[0156] 1) Replace the light chain of the original clone: ​​Take the plasmid from Example 2, add Sac1 and Not1 for double digestion, recover the vector, and ligate it with the light chain mix (derived from multiple immunized mice) that has also been double digested. Recover the ligation product according to the steps in Example 1 and transfer it into competent cells to construct a phage display library with light chain replacement.

[0157] 2) Perform the screening according to the steps of Example 1 (II); the purpose of this screening is to select antibodies with high binding activity, and the amount of antigen used during screening is halved.

[0158] 3) Based on the monoclonal results, positive clones with read values ​​higher than the original clone were selected for sequencing analysis, yielding an antibody sequence with a light chain different from the original clone. The light chain variable region sequence is shown in SEQ ID NO.3; further analysis revealed that the antigen-binding domain contains the following light chain CDRs:

[0159] Table 3 shows the light chain CDRs of VL as indicated by SEQ ID NO.3.

[0160]

[0161] 4) The binding activity of the optimized clone was determined according to the steps in Examples 2 and 3, and the results are as follows: Figure 5 The optimized Fab monoclonal antibody has an EC50 value of approximately 8 nM, which is about 6.6 times higher than that of the original clone.

[0162] Example 5: Expression and purification of anti-Mp P1 recombinant IgG monoclonal antibody

[0163] After obtaining the optimized antibody Fab region sequence through sequencing, gene synthesis was performed.

[0164] The PTT5 plasmid was selected as the vector, and the EcoRI+BamHI gene fragment was inserted at the cloning site. The light chain constant region sequence is shown in SEQ ID NO.5, which is a mouse-derived sequence; the complete light chain sequence is shown in SEQ ID NO.7.

[0165] The CH1 region of the heavy chain was replaced with the CH1 region of human IgG1, and the Fc region of human IgG1 was fused at the C-terminus. Using EcoRI+BamHI as the cloning site, the complete heavy chain fragment was inserted into the PTT5 plasmid. The heavy chain constant region sequence is shown in SEQ ID NO.4, which is a human sequence, and the complete heavy chain sequence is shown in SEQ ID NO.6.

[0166] Expression was performed using the mammalian cell 293F expression system.

[0167] 1) Plasmid extraction: The synthesized plasmids were transformed into TOP10 competent cells, activated for 1 hour, and then transferred to LB medium. The cells were cultured overnight at 37°C. The plasmids were extracted the next day using an endotoxin-free plasmid extraction kit to obtain the corresponding heavy chain plasmids and light chain plasmids.

[0168] 2) One day before transfection, 293F cells were seeded into suspension cell culture flasks, and the cell density was controlled at 1×10⁻⁶ cells / year. 6 per mL.

[0169] 3) On the second day, dilute 40 μg of heavy chain plasmid and 80 μg of light chain plasmid in 6 mL of transfection buffer and mix gently. Add 480 μL of PEI and mix gently. Incubate at room temperature for 20 minutes. Add the mixture dropwise to the cells and place the cells in an incubator for suspension culture at 98 rpm, 37°C, and 5% CO2.

[0170] 4) After 6 days, collect the culture supernatant and purify IgG using rProtein A packing material. Elute with 0.1M Glycine (pH 3.0) and neutralize with 1M Tris (pH 8.0). After elution, replace the supernatant with PBS buffer in an ultrafiltration centrifuge tube and concentrate the protein. Determine the protein concentration and verify its purity by SDS-PAGE. Figure 6 .

[0171] Example 6: ELISA determination of the binding activity of recombinant monoclonal antibody to Mp P1 antigen.

[0172] Further testing was conducted to determine the binding activity of the optimized recombinant antibody obtained through screening with the Mp P1 protein:

[0173] 1) Coat Mp P1 protein (2 μg / mL) onto an ELISA plate, and simultaneously coat it with BSA as a non-specific binding control. Incubate overnight at 4°C.

[0174] 2) Discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 hours.

[0175] 3) Discard the blocking solution, wash the plate with PBST, pat dry, add 1000 nM of antibody (prepared in Example 5) in a 5-fold serial dilution, and incubate at 37°C for 1.5 h.

[0176] 4) Discard the primary antibody, wash the plate with PBST, pat dry, add horseradish peroxidase (HRP)-labeled mouse anti-human IgG secondary antibody, and incubate at 37°C for 1 hour.

[0177] 5) Discard the secondary antibody, wash the plate with PBST, pat dry, add the chromogenic substrate for color development, add the stop solution after 15 min to stop the reaction, and measure the OD value with an ELISA reader.

[0178] 6) Plot a nonlinear fit graph with OD value on the ordinate and the logarithm of antibody molar concentration on the abscissa. For example... Figure 7 The EC50 value of the antibody in Example 5 was approximately 2.5 nM.

[0179] Example 7: Chemiluminescence assay for the detection performance of recombinant monoclonal antibodies

[0180] The method is as follows:

[0181] 1) The initial antibody concentration is 1 mg / ml. Dilute the antibody 15 times, and then dilute it sequentially in a 2-fold gradient.

[0182] 2) First incubation: The antibody to be tested (prepared in Example 5) was incubated with magnetic beads coated with Mp natural antigen (purchased from Saitukang Biotechnology, catalog number CTA-4010) at 37°C for 15 min, and unbound substances were washed away.

[0183] 3) Second incubation: Add alkaline phosphatase-labeled mouse anti-human IgG antibody, incubate at 37°C for 15 min, and then wash to remove unbound substances.

[0184] 4) Result interpretation: The instrument detects the luminescence intensity of the corresponding complex.

[0185] Table 4. Chemiluminescence assay for the reactivity of recombinant monoclonal antibodies to Mp whole bacterial antigen.

[0186] Dilution factor RLU COI 15 92,850 3.10 30 93,871 3.13 60 87,569 2.92 120 80,665 2.69 240 66,716 2.22 480 47,668 1.59 960 29,264 0.98 1920 16,864 0.56 3840 9,307 0.31 7680 4,691 0.16

[0187] The test results are shown in Table 4. The antibody to be tested showed good reactivity with the natural antigen Mp. The critical value of the reference positive serum was RLU = 30000. When the recombinant antibody was diluted 240 times, the COI was >2, and the titer was qualified. It can be used as a raw material for calibrators and quality control products.

[0188] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An antibody that specifically binds to the P1 protein of Mycoplasma pneumoniae, characterized in that, It includes variable regions for heavy chains and variable regions for light chains; The heavy chain variable region includes complementarity-determining regions VH-CDR1, VH-CDR2, and VH-CDR3; the light chain variable region includes complementarity-determining regions VL-CDR1, VL-CDR2, and VL-CDR3. The VH-CDR1, VH-CDR2, and VH-CDR3 are amino acid sequences identical to those of the VH-CDR1, VH-CDR2, and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; The VL-CDR1, VL-CDR2, and VL-CDR3 are amino acid sequences identical to those of the VL-CDR1, VL-CDR2, and VL-CDR3 of the light chain variable region shown in SEQ ID NO.2; or, they are amino acid sequences identical to those of the VL-CDR1, VL-CDR2, and VL-CDR3 of the light chain variable region shown in SEQ ID NO.

3. The antibodies VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2, and VL-CDR3 are defined by any one of the systems Kabat, Chothia, IMGT, ABM, or Contact.

2. The antibody according to claim 1, characterized in that, According to the IMGT definition: the amino acid sequence of VH-CDR1 is shown in SEQ ID NO.12, the amino acid sequence of VH-CDR2 is shown in SEQ ID NO.17, and the amino acid sequence of VH-CDR3 is shown in SEQ ID NO.20; The amino acid sequence of VL-CDR1 is shown in SEQ ID NO.23, the amino acid sequence of VL-CDR2 is SGS, and the amino acid sequence of VL-CDR3 is shown in SEQ ID NO.26; optionally, the amino acid sequence of VL-CDR1 is shown in SEQ ID NO.30, the amino acid sequence of VL-CDR2 is KVS, and the amino acid sequence of VL-CDR3 is shown in SEQ ID NO.

33.

3. The antibody according to claim 1, characterized in that, The antibody sequence, excluding the CDR region, is derived from one or more of the following species: rabbit, cattle, horse, pig, sheep, goat, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, human, and mutants thereof.

4. The antibody according to claim 1, characterized in that, At least one backbone region of the heavy chain variable region includes an amino acid sequence consistent with the backbone region of the heavy chain variable region shown in SEQ ID NO.

1.

5. The antibody according to claim 1, characterized in that, At least one backbone region of the light chain variable region includes an amino acid sequence consistent with the backbone region of the light chain variable region shown in SEQ ID NO.2, or at least one backbone region of the light chain variable region includes an amino acid sequence consistent with the backbone region of the light chain variable region shown in SEQ ID NO.

3.

6. The antibody according to claim 1, characterized in that, The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2; or, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

3.

7. The antibody according to any one of claims 1 to 6, characterized in that, The antibody is a complete antibody, F(ab')2, Fab', Fab, Fv, scFv, dsFv, or a bispecific antibody.

8. The antibody according to claim 7, characterized in that, The antibody is Fab, and the amino acid sequence of the heavy chain variable region of the Fab is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, or the amino acid sequence of the heavy chain variable region of the Fab is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

3.

9. The antibody according to any one of claims 1 to 6, characterized in that, It also includes constant regions.

10. The antibody according to claim 9, characterized in that, At least a portion of the constant region sequence is a human constant region sequence.

11. The antibody according to claim 9, characterized in that, The constant region sequence is selected from a portion or all of the constant region sequence of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD.

12. The antibody according to claim 9, characterized in that, The antibody contains a heavy chain constant region, and the heavy chain constant region sequence is selected from the human heavy chain constant region.

13. The antibody according to claim 12, characterized in that, The amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.

4.

14. The antibody according to claim 9, characterized in that, The antibody contains a light chain constant region.

15. The antibody according to claim 14, characterized in that, The light chain constant region sequence is selected from the light chain constant region of mice, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.

5.

16. The antibody according to claim 9, characterized in that, The antibody is a complete antibody, with the heavy chain amino acid sequence shown in SEQ ID NO.6 and the light chain amino acid sequence shown in SEQ ID NO.

7.

17. A biomaterial, characterized in that, For polynucleotides, carriers, or cells; The polynucleotide encodes the antibody according to any one of claims 1 to 16; The vector carries the polynucleotide; The cell carries the polynucleotide, or contains the carrier, or is capable of expressing the antibody according to any one of claims 1 to 16.

18. The method for preparing the antibody according to any one of claims 1 to 16, characterized in that, This includes culturing the cells as described in claim 17.

19. The preparation method according to claim 18, characterized in that, The cells are prepared by converting a polynucleotide encoding an antibody as described in any one of claims 1 to 16 into the cells, wherein the polynucleotide includes a heavy chain expression plasmid and a light chain expression plasmid, and the conversion includes co-converting the heavy chain expression plasmid and the light chain expression plasmid into the cells.

20. The preparation method according to claim 18, characterized in that, The cells in question are eukaryotic cells.

21. The preparation method according to claim 20, characterized in that, The cells in question are mammalian cells.

22. The preparation method according to claim 21, characterized in that, The mammalian cells include 293 cells or CHO cells.

23. The preparation method according to claim 22, characterized in that, The mammalian cells in question are 293F cells.

24. The use of the antibody according to any one of claims 1 to 16, or the biological material according to claim 17, in any one of the following (I) to (VII): (I) Testing for anti-Mycoplasma pneumoniae antibodies for non-diagnostic and non-treatment purposes; (II) Preparation of products for detecting antibodies against Mycoplasma pneumoniae; (III) Preparation of products for the diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection; (IV) Detection of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein for non-diagnostic and non-therapeutic purposes; (V) Prepare products for detecting Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; (VI) Used for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; (VII) Prepare products for the isolation, enrichment and / or purification of Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; The anti-Mycoplasma pneumoniae antibody is an anti-Mycoplasma pneumoniae P1 protein antibody; In any of (I) to (III), the antibody is used as a standard or quality control product.

25. The application according to claim 24, characterized in that, The Mycoplasma pneumoniae infection includes Mycoplasma pneumoniae pneumonia.

26. A reagent or kit, characterized in that, The reagent or kit comprises the antibody as described in any one of claims 1 to 16, or the biological material as described in claim 17.

27. The reagent or kit according to claim 26, characterized in that, The kit is used to detect antibodies against Mycoplasma pneumoniae P1 protein or Mycoplasma pneumoniae infection; the kit includes standards and / or quality control products, and the standards and / or quality control products contain the antibody. Alternatively, the kit may be used to detect Mycoplasma pneumoniae, and the antibody may be used to capture Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein.

28. The reagent or kit according to claim 27, characterized in that, The antibody is conjugated with a signaling agent.

Citation Information

Patent Citations

  • Antibodies for resisting human mycoplasma pneumoniae P1 protein and immunochromatographic kit applying antibodies

    CN105585635A

  • Mycoplasma pneumoniae recombinant antigen and application thereof

    CN116903752A