Anguilla japonica testis tissue cell AJTTC as well as establishment, cryopreservation and recovery methods and application thereof

Abstract

The invention discloses an anguilla japonica testis tissue cell AJTTC as well as an establishment method, a cryopreservation method, a resuscitation method and application of the anguilla japonica testis tissue cell AJTTC. The strain is preserved in the China Center for Type Culture Collection on January 22, 2024, and the preservation number is CCTCC NO: C202430. According to the method disclosed by the invention, the Japanese eel testis tissue is subjected to isolated culture by adopting a dry sticking method, then passage and cryopreservation are carried out, and the stable Japanese eel testis cell line is finally established, so that a new strategy mode and a research model are provided for researches on analysis of a Japanese eel germ cell differentiation mechanism, sex control, genetic breeding and the like.

Description

Technical Field

[0001] The present invention relates to, in particular to, Japanese eel testicular tissue cells AJTTC and establishment, freezing, revival methods and applications thereof. Background Art

[0002] Eel (Anguilla spp) has high nutritional and economic value and is a global aquaculture species. In the past three decades, my country's eel farming output has ranked first in the world, accounting for about 70% of the global total output. In 2022, my country's eel farming output was 281,700 tons, and the annual output value of the primary industry was more than 40 billion yuan. Eels are migratory fish with a complex life history, including 6 stages: fertilized eggs, willow leaf eels, glass eels, young eels, yellow eels and silver eels. To date, large-scale artificial breeding of eel fry is still a global problem, and farmed fry are entirely dependent on natural fishing. Although Japanese scholars have achieved fully artificial breeding of Japanese eels in the laboratory and obtained second-generation newly hatched fry, their low yield and high breeding costs cannot meet the requirements of commercial production. my country's artificial breeding research on Japanese eels has bred newly hatched fry, but most of them only survive 7-20 days before dying, and although the ripened and induced spawning broodstock have a large number of eggs, the proportion of fully mature eggs is very low and the number of eggs laid is very small.

[0003] In recent years, the wild seed resources of Japanese eels (A. japonica), European eels (A. anguilla) and American eels (A. rostrata) have experienced sharp fluctuations and declines, and the import of European and American eel seedlings has been restricted, resulting in high prices and unstable supply of eel seedlings, which seriously restricts the sustainable development of eel farming. Therefore, overcoming the technical difficulties of artificial breeding of eels and obtaining a stable supply of eel seedlings is an important way to solve the bottleneck problem of the development of the eel industry.

[0004] Establishing fish cell lines can greatly facilitate the research of fish virus isolation, antiviral mechanism, vaccine development, transgenic technology, chimera tissue engineering, etc., and the requirements of facilities, manpower and other resources are relatively low compared with in vivo experiments, with good reproducibility and short research cycle. Cell culture provides an important in vitro model for conducting fish toxicology, pathology, genetic analysis and other research.

[0005] Experiments at the cell level can largely overcome many disadvantages of in vitro experiments, and the repeatability is relatively good. It provides an efficient and convenient in vitro model and method for exploring fish transgenic technology, vaccine development, toxicology and pathology related biological research. The establishment of fish cell lines can provide great convenience for fish virus isolation, antiviral mechanism, vaccine development, transgenic technology, chimera tissue engineering and other research, and the requirements for facilities, manpower and other resources are relatively low compared to in vivo experiments, with good repeatability and short research cycle. Fish cell lines provide an important in vitro model for conducting fish toxicology, pathology, genetic analysis and other research, which overcomes the above problems to a certain extent.

[0006] At present, the only cell line isolated from Japanese eel tissue is the heart cell line of adult Japanese eel reported in 2024 (Zhou Xiaoling et al., 2024). However, there are no relevant studies and reports on the cell line of Japanese eel testis tissue, which greatly limits the research on the development mechanism of Japanese eel gonads. Therefore, establishing a stable Japanese eel testis tissue cell line is a difficult problem to be solved in this field.

[0007] At present, gene transfection technology is a key step in transgenic technology, which plays an important role in determining whether transgenic technology can be successful. It has been widely used in a large number of transgenic animals including fish (Yang Xueming et al., 2006). Among them, the liposome transfection method is commonly used (Zhou Xueyan et al., 2004; Ye Hanqing, 2006), and the reporter gene is commonly used. The jellyfish green fluorescent protein gene (GFP) (Dou Liping et al., 2008). However, the transfection efficiency of liposome transfection in fish cell lines is low. For example, the transfection efficiency of the fin ray cell line (YSCF) of the Yangtze sturgeon is only 10-15% (Liu et al., 2020); the transfection efficiency of the fin ray cell line (CSTF) of the Chinese sturgeon is only 2% (Zhu et al., 2013), and the transfection efficiency of the fin ray cell line (MAF) of the amblycephala is only 5% (Zhou et al., 2008). It is reported that the liposome transfection efficiency of a newly established zebrafish embryonic cell line can also reach 40% (Jin et al., 2017). The low transfection efficiency is also the main factor restricting the development of fish cell research on gene function. However, there is no report on the technical system and method of in vitro culture of Japanese eel testis tissue, which seriously restricts the research and application of Japanese eel testis tissue cells. Therefore, it is an urgent need to construct a technical system and method for in vitro culture of Japanese eel testis tissue for the developmental biology research of Japanese eels and the establishment of new technologies for Japanese eel breeding. Summary of the invention

[0008] The invention aims to provide a stable Japanese eel testis cell line with excellent properties and stable chromosome karyotype analysis.

[0009] To achieve the above-mentioned purpose, the present invention provides a Japanese eel testicular tissue cell AJTTC (Anguilla japonica), characterized in that it was deposited in the China Center for Type Culture Collection on January 22, 2024, with a deposit number of CCTCCNO: C202430.

[0010] The present invention also provides a method for establishing the Japanese eel testicular tissue cells AJTTC (Anguilla japonica), which is characterized by comprising the following steps:

[0011] (1) 7-month-old Japanese eel juveniles, 25-30 cm in length, are temporarily kept in sterile seawater containing three antibodies for 1-2 hours, and eugenol is dripped into the sterile seawater at the end of the time, preferably, the eugenol accounts for 0.005-0.015% of the volume of the sterile seawater; until the fish body has no stress behavior to the stimulation, the mucus on the fish body surface is removed; the fish body surface is wiped with gauze soaked in alcohol, and then the fish body is moved to a clean bench, and the testicular tissue is removed with a dissecting instrument, and rinsed multiple times in a PBS solution containing three antibodies;

[0012] (2) Chop the testicular tissue into pieces of 0.5-1.5 mm 3 For small tissue blocks of different sizes, rinse the cut small tissue blocks with PBS solution containing three antibodies for several times and transfer them to centrifuge tubes. Use red blood cell lysis solution to lyse the blood cells attached to the tissues, then wash them with PBS solution for 3 times, evenly stick the tissue blocks to the cell culture bottle, resuspend them with complete culture medium to wet the bottom of the culture bottle, and start primary culture at 27±3℃ constant temperature. Add an equal volume of complete culture medium on the second day, and add the same volume of complete culture medium as on the second day on the third day. Replace the complete culture medium once on the fourth day, and supplement the complete culture medium for primary culture;

[0013] (3) When the coverage rate of adherent cells in the primary culture of Japanese eel testis cell line reaches 80-90% or higher, the primary cells may show obvious contact inhibition. At this time, trypsin digestion method can be used to start subculture.

[0014] The present invention also provides a freezing method for the Japanese eel testis tissue cells AJTTC (Anguilla japonica), which is characterized by taking a bottle of Japanese eel testis cell line cells that are growing vigorously and covering the bottom of a culture bottle, using a trypsin digestion method, collecting cell precipitation after centrifugation, slowly adding serum-free cell freezing solution, and gently blowing the cells to make them evenly dispersed in the cell freezing solution, using a pipette to move the liquid into a cryopreservation tube; the cryopreservation tube is placed at 4°C for 1 hour, and then placed in a programmed gradient cooling cryopreservation box, the temperature drop rate of the programmed gradient cooling is 1°C / min, the cryopreservation box is placed at -80°C for 1 day, and finally the cryopreservation tube is taken out and immersed in liquid nitrogen for long-term freezing.

[0015] The present invention also provides a method for reviving the Japanese eel testicular tissue cells AJTTC (Anguilla japonica), which is characterized in that a cryopreservation tube is taken out from liquid nitrogen and quickly placed in a 40°C water bath. During the process of thawing the cells, the cryopreservation tube should be continuously shaken to thaw quickly and evenly until the cells are completely thawed. The thawed cell suspension is transferred to a culture bottle centrifuge tube, and complete culture medium is added to the culture bottle, and culture is carried out at 27°C and 5% CO2; after 24 hours, a new complete culture medium is replaced and culture is continued.

[0016] The present invention also provides the use of the Japanese eel testicular tissue cell AJTTC (Anguilla japonica) for analyzing the Japanese eel germ cell differentiation mechanism, sex control and genetic breeding.

[0017] The present invention will use the dry-stick method to isolate and culture the testis tissue of Japanese eel, and then perform passaging and cryopreservation, and finally establish a stable testis cell line of Japanese eel, providing a new strategy mode and research model for analyzing the mechanism of germ cell differentiation, sex control and genetic breeding of Japanese eel.

[0018] The method for constructing the Japanese eel testicular tissue cell line of the invention has strong repeatability and the cultured testicular tissue cell line has good stability.

[0019] The invention uses the electrotransfection method to carry out the transfection experiment of the Japanese eel testis tissue cell line, and the transfection efficiency is high.

[0020] The Japanese eel testis tissue of the invention has excellent cell properties and stable chromosome karyotype analysis.

[0021] The cells of the testis tissue of the Japanese eel of the present invention were subjected to overexpression and RNAi interference experimental analysis, and the functional verification analysis of the relevant genes was obtained, which laid the foundation for the functional research of the genes related to the gonad development of the Japanese eel, and provided a new strategy mode and research model for the research on the differentiation mechanism of Japanese eel germ cells, sex control and genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a picture of the primary culture of Japanese eel testis tissue for 3 days;

[0023] Figure 2 This is a picture of the primary culture of Japanese eel testis tissue for 5 days;

[0024] Figure 3 This is a picture of the first generation of subculture of Japanese eel testis tissue;

[0025] Figure 4 This is a picture of the second generation of subculture of Japanese eel testis tissue;

[0026] Figure 5This is a picture of the 5th generation of subculture of the testis tissue of Japanese eel;

[0027] Figure 6 This is a picture of the 10th generation of subculture of Japanese eel testis tissue;

[0028] Figure 7 This is a picture of the 15th generation of subculture of the testis tissue of the Japanese eel;

[0029] Figure 8 This is a picture of the 20th generation of subculture of the testis tissue of the Japanese eel;

[0030] Fig. 9 This is a picture of the 30th generation of subculture of the testis tissue of the Japanese eel;

[0031] Fig.10 This is a picture of the 50th generation of subculture of the testis tissue of the Japanese eel;

[0032] Fig.11 This is a picture of the 100th generation of subculture of the testis tissue of the Japanese eel;

[0033] Fig.12 This is a picture of the 120th generation of subculture of the testis tissue of the Japanese eel;

[0034] Fig.13 This is a picture of the Japanese eel testis tissue cell line 24 hours after cryopreservation and recovery;

[0035] Fig.14 This is a picture of the Japanese eel testis cell line 72 hours after cryopreservation and recovery;

[0036] Fig.15 This is a picture of the Japanese eel testis cell line after recovery and passage;

[0037] Fig.16 This is a diagram showing the cell proliferation at different passage ratios of the Japanese eel testis tissue cell line;

[0038] Fig.17 This is a diagram showing the species origin and type identification results of the Japanese eel testis cell line;

[0039] Fig.18 This is the result of chromosome karyotype analysis of the testis tissue cell line of Japanese eel;

[0040] Fig.19 This is the statistical result of chromosome number in the testis tissue cell line of Japanese eel;

[0041] Fig. 20 This is the result of transfection of Japanese eel testis tissue cell line with EGFP;

[0042] Fig.21 This is a diagram of the cell state of the Japanese eel testis cell line after 10 days of starvation treatment;

[0043] Fig. 22 This is a picture of the cell status of the Japanese eel testis cell line after starvation treatment and replacement of fresh culture medium;

[0044] Fig.23 This is a diagram of the cell state of Japanese eel testis cells after Nanog interference;

[0045] Fig.24 This is a graph showing the changes in gene expression in Japanese eel testis tissue cells after interfering with Nanog;

[0046] Fig.25 This is a diagram of the cell state after overexpression of Lin28a in the testis cells of Japanese eel;

[0047] Fig.26 This is a graph showing changes in gene expression after overexpression of Lin28a in testicular cells of Japanese eel;

[0048] Fig. 27 This is a diagram of the cell state after overexpression of Lin28b in the testis cells of Japanese eel;

[0049] Fig.28 Changes in gene expression levels after overexpression of Lin28b in testicular cells of Japanese eel. DETAILED DESCRIPTION

[0050] Embodiments of the present invention are described in detail below, and the examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals represent the same or similar elements or elements with the same or similar functions from beginning to end. The embodiments described below by reference to the accompanying drawings are exemplary, are intended to be used to explain the present invention, and are not to be construed as limitations of the present invention. Those who do not indicate specific techniques or conditions in the embodiments are carried out according to the techniques or conditions described in the documents in this area or according to the product specification. Those who do not indicate the manufacturer of reagents or instruments used are all conventional products that can be obtained commercially.

[0051] The complete culture medium used in the following examples is based on L-15 culture medium, containing fetal bovine serum, β-mercaptoethanol, N-acetylglucosamine, sodium carboxymethyl cellulose, human basic fibroblast growth factor (Human FGF-basic), human epithelial cell growth factor (Human EGF), human hepatocyte growth factor (Human HGF), human insulin-like growth factor (Human IGF), human leukemia inhibitory factor (Human LIF), penicillin, streptomycin, Japanese eel serum and Japanese eel embryo extract (AJ-EE). Using L-15 culture medium as the basic culture medium, the added amounts of fetal bovine serum, β-mercaptoethanol, N-acetylglucosamine, sodium carboxymethyl cellulose, human basic fibroblast growth factor (Human FGF-basic), human epithelial cell growth factor (Human EGF), human hepatocyte growth factor (Human HGF), human insulin-like growth factor (Human IGF), human leukemia inhibitory factor (Human LIF), penicillin, streptomycin, Japanese eel serum and Japanese eel embryo extract (TEE) are 15vol%~20vol%, 0.5vol‰, 50μg / L, 50μg / L, 10μg / L, 5μg / L, 1μg / L, 100IU / mL, 100μg / mL, 5μg / L, 5μg / L, 1vol% and 1vol%, respectively. Among them, L-15 culture medium and fetal bovine serum FBS provide sufficient nutrition for cell growth; the addition of β-mercaptoethanol, N-acetylglucosamine, sodium carboxymethyl cellulose, human FGF-basic, human EGF, human HGF and human IGF can stimulate cell activity, accelerate cell division and proliferation, and provide a good buffer environment for cell culture in vitro, enabling cells to maintain a stable pH during long-term culture; fish serum and fish embryo extract help to improve the mitotic activity of cells in fish cell culture and may be one of the key additives in the current culture medium; the addition of human LIF can effectively inhibit the differentiation of testicular tissue cells and promote cell proliferation.

[0052] Preparation of Japanese eel serum: soak a 10 mL syringe with 15% (w / v) EDTA, collect blood from the caudal vein of an adult Japanese eel into a 15 mL centrifuge tube on ice. Centrifuge at 3,500 g for 15 min, transfer the supernatant to a 50 mL centrifuge tube, incubate overnight at 4°C, centrifuge at 3,500 g for 30 min, filter the supernatant with a 0.2 μm filter to sterilize, and store in 15 mL centrifuge tubes per 10 mL tube at -20°C.

[0053] Preparation of Japanese eel embryo extract (AJ-EE): At least 2,000 healthy Japanese eel embryos at day 7 (30 hpf or before hatching after fertilization) were collected, washed three times with 1×PBS, and stored at -20°C for later use. 500 embryos were homogenized on ice in a glass homogenizer with cold 1×PBS, and the homogenate was transferred to a 15 mL centrifuge tube. After repeated freezing and thawing three times in a liquid nitrogen-37°C water bath, the homogenate was centrifuged at 4°C and 3,500 g for 30 min. The supernatant was transferred to a new 1.5 mL centrifuge tube and centrifuged at 18,000 g and 4°C for at least 30 min to ensure that the homogenate was divided into three layers: the top layer was the lipid layer, the bottom layer was the debris, and the middle layer was the Japanese eel embryo extract (AJ-EE), which was clear and green. TEE was collected in a 15 mL centrifuge tube to minimize lipid contamination. If the layers are not clear, repeat the centrifugation and layering steps to obtain the best layering effect and AJ-EE yield. AJ-EE is sterilized by filtration with a 0.2 μm filter and the volume is adjusted to 1 mL containing 400 embryos (i.e., 2.5 μL / embryo) with 1× PBS. Then each 1 mL is dispensed into a 1.5 mL centrifuge tube and stored at -20°C.

[0054] The formula of red blood cell lysis solution is taken as 1L as follows: NH4Cl: 8.26g; NaHCO3: 0.8g, and the rest is DEPC water.

[0055] PBS solution or sterile seawater containing tertiary antibodies: Taking 100mL PBS or 100mL sterile seawater as an example, add 1mL of 100X concentrated solution of tertiary antibodies to obtain PBS solution or sterile seawater containing tertiary antibodies with a concentration of 1X. The 100X concentrated solution of tertiary antibodies contains 10000U / mL penicillin, 10000μg / mL streptomycin and 25μg / mL amphotericin B.

[0056] Example 1 Establishment of Japanese eel testicular tissue cell line:

[0057] (1) Since Japanese eels are extremely sensitive to hypochlorite, sterile seawater containing three antibodies is used instead of hypochlorous acid disinfectant in the body surface disinfection step. Japanese eel fry, 7 months old and 25-30 cm long, are temporarily kept in sterile seawater containing three antibodies for 1-2 hours. At the end, 3-4 drops of eugenol (eugenol accounts for 0.005-0.015% of the volume of sterile seawater) are dripped until the fish body turns over, the abdomen faces up, and the fish body has no stress behavior to the stimulation. Wipe the mucus on the fish body surface with a piece of sterile gauze. Wipe the fish body surface twice with gauze soaked in 75% alcohol. Move the fish body to the clean bench, remove the testicular tissue with a dissecting instrument, and rinse it in a PBS solution containing three antibodies for 3-4 times.

[0058] (2) Use two No. 11 scalpels to cross-cut the testicular tissue into 1 mm pieces. 3Small tissue blocks of about 1.5-2.5 mm in size. Rinse the cut small tissue blocks with PBS solution containing three antibodies three times. After rinsing, transfer the above small tissue blocks to a 15 mL centrifuge tube, use red blood cell lysis solution to lyse the blood cells attached to the tissue, and then wash it with PBS solution for 3 times. Stick the tissue blocks evenly to the cell culture bottle, resuspend with 1 ml of complete culture solution to wet the bottom of the culture bottle, and start primary culture at 27 ° C. Add 1 mL of complete culture solution on the second day, add 1 mL of complete culture solution on the third day, replace the complete culture solution once on the fourth day, and add 5 mL of complete culture solution for primary culture.

[0059] like Figure 1 to Figure 2 As shown, adherent cells appeared on the third day after the primary culture of Japanese eel testis tissue was initiated ( Figure 1 ), and by the fifth day, the cells had expanded to 70-80% ( Figure 2 ).

[0060] (3) When the coverage rate of adherent cells in the primary culture of Japanese eel testis cell line reaches 80-90% or higher, the primary cells may show obvious contact inhibition, and then the trypsin digestion method is used to start the subculture.

[0061] Subculture of testicular tissue cells of Japanese eel:

[0062] The classic cell digestion procedure was used: when the primary culture cells proliferated to 80-90% coverage, the old culture medium in the original culture bottle was removed; 5 mL of 1X PBS solution was added, and the cells were washed once to remove the serum and divalent metal ions in the original culture medium (such substances would greatly affect the digestion of trypsin); the PBS solution was poured out, and 0.5 mL of 0.25% commercial pancreatic digestion solution containing EDTA, shake the bottle to make the pancreatic solution fully contact with the bottom cells, and pour out the pancreatic digestion solution (this step should be done quickly, otherwise it is easy to cause over-digestion; when removing the pancreatic digestion solution, there should be enough solution to keep the flat bottom moist, otherwise the bottom of the bottle will easily become partially dry and affect digestion); remove the culture bottle and observe under an inverted microscope. When most cells become round and loosen their adhesion to the wall, immediately move to the clean bench and add 5mL of complete culture solution containing serum to terminate digestion; blow and check the effect of blowing under a microscope. If there are too many residual cells, repeat the digestion once; inoculate the cell suspension into a new culture bottle at a volume ratio of 1:2-10, fill the complete culture solution to 5mL, and place the culture bottle at a constant temperature of 27℃ for culture. Subculture every 2-3 days thereafter. Until 355 days, 120 generations, if Figures 3 to 12 As shown, the Japanese eel testis cell line showed a relatively stable long fiber shape from the 1st to the 120th generation.

[0063] Example 2 Cryopreservation and revival of Japanese eel testis cell line

[0064] (1) Cryopreservation: Take a 75cm bottle 2 The Japanese eel testis cell line cells that are growing vigorously and covering the bottom of the culture bottle are digested by trypsin. After centrifugation, the cell pellet is collected, and 3mL of the prepared cell freezing solution is slowly added. The cells are gently blown to make them evenly dispersed in the cell freezing solution, and the liquid is transferred into the cryopreservation tube using a pipette. The cryopreservation tube is placed at 4℃ for 1h, and then placed in a programmed gradient cooling cryopreservation box (temperature drop rate is 1℃ / min), and the cryopreservation box is placed at -80℃ for 1 day. Finally, the cryopreservation tube is taken out and immersed in liquid nitrogen for long-term cryopreservation.

[0065] (2) Take the cryovial out of liquid nitrogen and quickly place it in a 40°C water bath. During the thawing process, the cryovial should be shaken continuously to allow it to thaw quickly and evenly until it is completely thawed. Transfer the thawed cell suspension to a 25 cm 2 Fill the culture flask with 5 mL of complete culture medium and culture at 27°C, 5% CO2. Replace with new complete culture medium after 24 hours and continue culturing.

[0066] like Fig.13 As shown in the figure, the adhesion rate of Japanese eel testis cell line after cryopreservation and recovery for 24 hours reached 60%-80%, and there was no significant difference in cell morphology before cryopreservation; Fig.14 As shown, the cells can fill the culture flask after 72 hours of thawing after freezing.

[0067] Bottle bottom; Fig.15 The thawed Japanese eel testicular cells can be passaged normally, and there is no difference in cell morphology between the cells before and after cryopreservation and thawed.

[0068] Example 3 Morphological analysis of Japanese eel testicular cell line after Giemsa staining

[0069] 1) Take the cell lines grown to 90% density for cell morphology study.

[0070] 2) Discard the original culture medium in the culture bottle, add 3 mL of 1×PBS for washing, and discard the waste liquid;

[0071] 3) Digest the cells using trypsin digestion, inoculate an appropriate amount of cells into a 6-well cell culture plate (with poly-lysine-treated cell slides placed in advance), and perform subsequent staining when the cell growth reaches 90% density;

[0072] 4) Carefully aspirate the original culture medium in the culture plate, add 1 mL of 1×PBS for washing, and discard the waste liquid (use a 1 mL pipette tip to aspirate);

[0073] 5) Then fix in 5 mL of cold methanol for 10 min and stain with undiluted Wright-Giemsa stain (2-5 min);

[0074] 6) Rinse the excess stain in the culture plate with distilled water and dry the stained cell slides;

[0075] Use a microscope to take pictures of the stained cell monolayer and analyze the morphology of the cell lines.

[0076] Example 4 Effect of different passage ratios on proliferation curve of Japanese eel testis cell line:

[0077] From the Japanese eel testis cell line established in Example 1, cells with good morphology and vigorous proliferation were selected, digested and passaged at a ratio of 1:2, 1:3, 1:5 and 1:10 to 25 cm 2 Cell culture flasks (i.e., add 2.5mL, 1.6mL, 1mL, and 0.5mL of cell suspension to 4 culture flasks, and then fill the total volume of each flask with culture medium to 5mL). Take pictures every 24 hours from 24 hours after passage, and use the classic five-point cross sampling method to take inverted microscopic pictures of the cultured cells to count the number of cells in the field of view. Take the sum of the number of cells observed at 5 points in each group for graphical analysis.

[0078] like Fig.16 As shown in the figure, for the Japanese eel testis cell line, different subculture ratios have a great impact on the cells. Except for the 1:2 and 1:3 subculture groups, the proliferation of the other groups is very slow. The total number of adherents at the end of the first day is proportional to the seeding density. After that, except for the 1:2 group, the other groups proliferate at a slower rate.

[0079] Example 5 Identification and verification of Japanese eel testis cell line

[0080] Using RT-PCR technology, the Japanese eel testis cell line was identified. Fig.17 ; T is the result of using primers to detect the testis tissue of Japanese eel, AJTTC is the result of using primers to detect the testis cell line of Japanese eel, and O is the result of using primers to detect the ovary tissue of Japanese eel.

[0081] The 16S rRNA gene (upstream primer sequence (5'-3') is: CCGGTCTGAACTCAGATCACGT, SEQ ID NO: 1, downstream primer sequence (5'-3') is: ATGTTTTGATAAACAGGCG, SEQ ID NO: 2) was amplified in all tissues. After rubber tapping and purification, the sequence alignment result with the Japanese eel 16S rRNA gene sequence was more than 99%;

[0082] Dmrt1 gene (upstream primer sequence (5'-3') is: CAACTTCTACCAGCCCTCCC, SEQ ID NO: 3, downstream primer sequence (5'-3') is: GAACTGGTCTCGCACTCCTG, SEQ ID NO: 4);

[0083] dnd gene (upstream primer sequence (5'-3') is: GGAGTCATGGGTGCAAAGGA, SEQ ID NO: 5, downstream primer sequence (5'-3') is: TGGCCGCTGAAGTTCATCAT, SEQ ID NO: 6);

[0084] Amh gene (upstream primer sequence (5'-3') is: CAGAGGAGAGAGCTGACCCT, SEQ ID NO: 7, downstream primer sequence (5'-3') is: GGAAGTGGAAAGTCCGGGAG, SEQ ID NO: 8);

[0085] from Fig.17 It can be seen that the Sox3 gene (upstream primer sequence (5'-3') is: TACCGACCACGCAGAAAGAC, SEQ ID NO: 9, downstream primer sequence (5'-3') is: TGTTCATGCTGGGATGCTGT, SEQ ID NO: 10). Dmrt1 and Amh are highly expressed in testicular tissue and testicular cells, while Sox3 is highly expressed in the ovary and not expressed in the testis, and dnd is highly expressed in the testicular tissue, but weakly expressed in AJTTC (Japanese eel testicular tissue cells). It is speculated that this cell is a Japanese eel testicular supporting cell, so it is named Japanese eel testicular tissue cell line. The deposit information is as follows:

[0086] ·Strain name: Japanese eel testicular tissue cell AJTTC Anguilla japonica;

[0087] Deposit date: January 22, 2024;

[0088] ·Depository: China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China;

[0089] ●Deposit number: CCTCC NO:C202430.

[0090] Example 6 Chromosome Analysis of Japanese Anguilla Testis Cell Line:

[0091] Take the vigorous Japanese eel testis cells (30 generations, the cells are in good condition after 48 hours of growth, and the cells have basically covered the bottom of the bottle) and inoculate them to 75cm2 In the cell culture flask, when the cells are in the logarithmic growth phase (according to the growth curve of the subculture ratio, it can be seen that the cells are in the exponential growth phase at 48 h), colchicine with a final concentration of 20 μg / mL is added, and the cells are collected to obtain a cell suspension after continuing to culture for 6-8 h. Transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1000 g for 10 min, gently aspirate the supernatant, add 4 mL 0.075 M KCl hypotonic for 30 min; add 0.5 mL freshly prepared pre-cooled Carnoy's fixative for pre-fixation for 10 min, centrifuge at 2000 g for 10 min; take the cell pellet and add 0.5 mL Carnoy's fixative, resuspend the pellet with a pipette; add 1 mL fixative; drop the slide onto a glass slide (pretreated at -20°C) at a height of 30 cm, place it horizontally to allow it to extend thoroughly, dry it at 65°C; then immerse it in a dye vat containing Giemsa dye working solution for staining for 10 min, rinse with double distilled water to remove the residue on the slide surface, dry it, seal it with neutral resin, and observe and count it with a 1000× oil immersion lens.

[0092] like Fig.18 and Fig.19 As shown, in chromosome analysis of the Japanese eel testis cell line, 79% of the observed mitotic cells had 38 chromosomes, which is consistent with the actual 38 chromosomes of the Japanese eel.

[0093] Example 7 Transfection of Japanese eel testicular cell line with pEGFP-N1 plasmid

[0094] Preparation of competent bacterial cells: Escherichia coli DH5α was used, and competent cells were prepared by the classic calcium chloride method and stored at -80°C for a long time.

[0095] Plasmid transformation: Take 1ng pEGFP-N1 plasmid DNA solution and place it in an EP tube and place it in an ice bath. Take out 100μL competent bacterial suspension from the -80℃ refrigerator, dissolve it quickly, add it to the DNA solution, and place it in an ice bath for 10min. Place it in a 42℃ water bath for 2min. Incubate the EP tube at 37℃ and 220rpm for 1h. Then spread the transformed bacterial solution on an LB solid culture plate containing antibiotics.

[0096] Plasmid preparation: pEGFP-N1 plasmid was extracted according to the instructions of HiPure Plasmid MaxiPrep Kit (TransGene) and stored at -20°C.

[0097] Transfected cells: Take cells of the Japanese eel testis cell line that are growing vigorously, and when the cell coverage rate reaches 70%-80%, change the medium the night before electroporation. This medium change does not contain double antibodies. Digest the cells with trypsin at 37°C and collect the suspended cells in a 15ml centrifuge tube. Collect the cells by centrifugation, and control the number of revolutions to about 800-1000. Centrifuge for 3-5 minutes and discard the supernatant. Pipette a certain amount of OPTI-MEM I to fully resuspend the cells (2ml is recommended), and centrifuge again to collect the cells. Discard the supernatant. (Wash away the serum to the greatest extent possible, as the serum will affect the transformation efficiency); add the same volume of OPTI-MEM I, suspend the cells, and centrifuge for a second time to collect the cells. After the end, discard the supernatant and suspend 1x 10 6 Cells were added to make the resistance reach 200 ohms. Suspend the cells fully, add plasmid, add 5ug of plasmid to each electrode cup with a gap of 2mm; mix the cells fully and dispense them into the electrode cups, 26ul per electrode cup. Set up the program and conduct the electroporation experiment. Culture the cells normally in a constant temperature incubator at 27℃ and 5% CO2 until observation and analysis, and take pictures after 48h. Fig. 20 As shown, the left figure A shows the cell state of Japanese eel testis cells transfected with eGFP under bright field, and the right figure B shows the cell state of Japanese eel testis cells transfected with eGFP under blue excitation light. As can be seen from the figure, 48 hours after transfection, green fluorescence can be detected under a fluorescence microscope, and the pEGFP-N1 plasmid is expressed in this cell line. This shows that the established Japanese eel testis cell line can adapt to the transfection experiment of exogenous genes.

[0098] Example 8 Starvation treatment of Japanese eel testis cell line

[0099] Take Japanese eel cells with a cell coverage rate of 80%-100%, replace the medium with complete culture medium, and culture at 27℃, 5% CO2. After 30 days, the color of the culture medium changes from orange to light yellow, indicating that the nutrients in the culture medium are consumed in large quantities. Fig.21 As shown in the figure, a large number of cells are released from the wall to form cavities; some cells shrink due to nutrient consumption, and the refractive index increases under the microscope; there are still many cells that survive and their morphology has not changed. Fig. 22 As shown, when fresh complete culture medium is replenished again, the surviving cells can proliferate again, divide vigorously, and have no change in morphology.

[0100] Example 9 Interference of Nanog gene in Japanese eel testis cell line

[0101] Nanog gene (experimental group) and pEGFP-N1 (control group) dsRNA of Japanese eel were electroporated into AJTTC. Four parallels were set up for each group. The culture medium was replaced after 24 hours, and the cell status was observed after 48 hours.

[0102] The transfection experiment was performed using the BEX TM CUY21 EDITⅡ electroporator. The operation steps are as follows:

[0103] 1) Replace the culture medium without double antibody 24 hours before electroporation;

[0104] 2) Digest the cells with trypsin, transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 800-1,000 rpm for 5 min, and discard the supernatant;

[0105] 3) Add 2 mL of Opt1 MEM I culture medium, resuspend the cells, centrifuge and discard the supernatant to collect the cells;

[0106] 4) Repeat the above steps (add 1 mL of OptI MEM I medium, resuspend the cells, aspirate 10 μL of the cell suspension and mix with an equal volume of 0.4% trypan blue solution, and count using a cell characteristic analyzer);

[0107] 5) According to the number of cells calculated previously, add an appropriate amount of OptI MEM I medium to the cell pellet to dilute the cells until the cell concentration reaches 1×10^6 cells per 20 μL. Gently blow or shake to ensure that the cells are fully resuspended in the culture medium. Then, add an appropriate amount of dsRNA to fully mix the cells and dsRNA and let it stand for 3 minutes. Finally, divide the mixture into the electroporation cups to ensure that the amount of liquid in each electroporation cup is 26 μL;

[0108] 6) Set the electroporation program and start electroporation. After the electroporation is completed, remove the cells from the electroporation cup and add preheated complete culture medium (containing 15% FBS, EGF, FGF and other growth factors);

[0109] 7) Carefully blow and mix the cells, place the electroporated cell culture flask in a 27°C constant temperature incubator for culture, and observe the cell status after 24 hours and 48 hours.

[0110] 72 hours after electrotransfection, the cell RNA of the experimental group and the control group was extracted and reverse transcribed into the first chain of cDNA, which was diluted 10 times and used as a template for qRT-PCR. qRT-PCR technology was used to analyze the expression of pluripotency genes in the Japanese eel testis tissue cell line after electrotransfection of Nanog and EGFP dsRNA. Fig.23 and Fig.24 As shown. Fig.23These are the cell status pictures of Japanese eel testis cells after Nanog interference. The left picture shows Japanese eel testis cells transfected with ds-eGFP (control group), and the right picture shows Japanese eel testis cells transfected with Nanog (interference group). It can be seen that the cells in the interference group are morphologically dying and floating. Fig.24 This is a graph showing the changes in gene expression after Nanog interference in Japanese eel testis tissue cells. It can be seen that after interference, the expression level of Nanog decreased, and the expression of pluripotency factors related to cell proliferation also decreased accordingly, indicating that the established Japanese eel testis cell line can adapt to RNAi interference experiments.

[0111] Example 10 Overexpression of Lin28a gene in Japanese eel testis cell line

[0112] The Lin28a gene (experimental group) and pEGFP-N1 (control group) overexpression plasmid vectors of Japanese eel were electroporated into AJTTC, respectively. Four parallels were set up for each group. The culture medium was replaced after 24 hours, and the cell status was observed after 48 hours. The transfection experiment was carried out using BEX TMCUY21EDITⅡ electroporator. The electroporation steps were the same as those in Implementation Case 8. 72 hours after electroporation, the cell RNA of the experimental group and the control group was extracted and reversely transcribed into the first chain of cDNA, which was diluted 10 times and used as a template for qRT-PCR. The qRT-PCR technology was used to analyze the expression of pluripotency genes in the testis tissue cell line of Japanese eel after electroporation of Lin28a and EGFP plasmids. Fig.25 and Fig.26 shown. Fig.25 These are cell status diagrams of Japanese eel testis cells after overexpression of Lin28a. The left picture shows Japanese eel testis cells transfected with eGFP (control group), and the right picture shows Japanese eel testis cells transfected with Lin28a (overexpression group). It can be seen that 48 hours after transfection, the cells in the overexpression group proliferated faster, the number of cells increased, and the cell density increased significantly. Fig.26 This is the change in gene expression after overexpression of Lin28a in Japanese eel testis cells. It can be seen that after overexpression, the expression level of Lin28a increased significantly, and the expression of the homologous gene Lin28b was also activated, and the expression of Oct4 was also significantly increased. In addition, the expression of pluripotency factors related to cell proliferation also increased accordingly. This provides a basis for the use of AJTTC cells for the study of exogenous gene transfection and gene interactions, indicating that the established Japanese eel testis cell line can adapt to overexpression experiments.

[0113] Example 11 Overexpression of Lin28b gene in Japanese eel testis cell line

[0114] The Lin28b gene (experimental group) and pEGFP-N1 (control group) overexpression plasmid vectors of Japanese eel were electroporated into AJTTC, respectively. Four parallels were set up for each group. The culture medium was replaced after 24 hours, and the cell status was observed after 48 hours. The transfection experiment was carried out using BEX TMCUY21EDITⅡ electroporator. The electroporation steps were the same as those in Implementation Case 8. 72 hours after electroporation, the cell RNA of the experimental group and the control group was extracted and reverse transcribed into the first chain of cDNA, which was diluted 10 times and used as a template for qRT-PCR. The qRT-PCR technology was used to analyze the expression of pluripotency genes in the testis tissue cell line of Japanese eel after electroporation of Lin28b and EGFP plasmids. Fig. 27 and Fig.28 As shown. Fig. 27 These are cell status diagrams of Japanese eel testis cells after overexpression of Lin28b, where the left picture shows Japanese eel testis cells transfected with eGFP (control group), and the right picture shows Japanese eel testis cells transfected with Lin28b (overexpression group). It can be seen that 48 hours after transfection, the cells in the overexpression group proliferated faster, the number of cells increased, and the cells were more compact. Fig.28 This is a graph showing the changes in gene expression after overexpression of Lin28b in Japanese eel testis cells. It can be seen that after overexpression, the expression level of Lin28b increased significantly, and at the same time activated the expression of the homologous gene Lin28a, and also caused a very significant increase in the expression of Sox2. In addition, the expression of pluripotency factors related to cell proliferation also increased accordingly, indicating that the established Japanese eel testis cell line can adapt to overexpression experiments and experiments such as interactions between gene families.

[0115] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. A Japanese eel testicular tissue cell AJTTC (Anguilla japonica), characterized in that: It was deposited in the China Center for Type Culture Collection on January 22, 2024, with the deposit number CCTCC NO:C202430.

2. The method for establishing the Japanese eel testicular tissue cell AJTTC (Anguilla japonica) according to claim 1, characterized in that: The steps include: (1) 7-month-old Japanese eel juveniles, 25-30 cm in length, are temporarily kept in sterile seawater containing three antibodies for 1-2 hours, and eugenol is dripped into the sterile seawater at the end of the time, preferably, the eugenol accounts for 0.005-0.015% of the volume of the sterile seawater; until the fish body has no stress behavior to the stimulation, the mucus on the fish body surface is removed; the fish body surface is wiped with gauze soaked in alcohol, and then the fish body is moved to a clean bench, and the testicular tissue is removed with a dissecting instrument, and rinsed multiple times in a PBS solution containing three antibodies; (2) Chop the testicular tissue into pieces of 0.5-1.5 mm 3 For small tissue blocks of different sizes, rinse the cut small tissue blocks with PBS solution containing three antibodies for several times and transfer them to centrifuge tubes. Use red blood cell lysis solution to lyse the blood cells attached to the tissues, then wash them with PBS solution for 3 times, evenly stick the tissue blocks to the cell culture bottle, resuspend them with complete culture medium to wet the bottom of the culture bottle, and start primary culture at 27±3℃ constant temperature. Add an equal volume of complete culture medium on the second day, and add the same volume of complete culture medium as on the second day on the third day. Replace the complete culture medium once on the fourth day, and supplement the complete culture medium for primary culture; (3) When the coverage rate of adherent cells in the primary culture of Japanese eel testis cell line reaches 80-90% or higher, the primary cells may show obvious contact inhibition. At this time, trypsin digestion method can be used to start subculture.

3. The cryopreservation method of Japanese eel testicular tissue cells AJTTC (Anguilla japonica) according to claim 1, characterized in that: Take a bottle of Japanese eel testis cell line cells that are growing vigorously and covering the bottom of the culture bottle, use trypsin digestion method, collect cell sediments after centrifugation, slowly add serum-free cell freezing solution, and gently blow the cells to make them evenly dispersed in the cell freezing solution, use a pipette to transfer the liquid into a cryopreservation tube; the cryopreservation tube is placed at 4°C for 1 hour, and then placed in a programmed gradient cooling cryopreservation box, the temperature drop rate of the programmed gradient cooling is 1°C / min, the cryopreservation box is placed at -80°C for 1 day, and finally the cryopreservation tube is taken out and immersed in liquid nitrogen for long-term freezing.

4. The method for resuscitating Japanese eel testicular tissue cells AJTTC (Anguilla japonica) according to claim 1, characterized in that: Take out the cryovial from liquid nitrogen and quickly place it in a 40°C water bath. During the thawing process, shake the cryovial constantly to thaw it quickly and evenly until it is completely thawed. Transfer the thawed cell suspension to a culture flask centrifuge tube, add complete culture medium to the culture flask, and culture at 27°C, 5% CO2; replace with new complete culture medium after 24 hours and continue culturing.

5. Use of the Japanese eel testicular tissue cells AJTTC (Anguilla japonica) according to claim 1 for analyzing the Japanese eel germ cell differentiation mechanism, sex control and genetic breeding.

Images