Method for preparing recombinant human copper-zinc superoxide dismutase

Abstract

The invention discloses a method for preparing recombinant human copper-zinc superoxide dismutase. The method comprises the following steps: (a) designing and synthesizing a gene sequence for coding the recombinant human copper-zinc superoxide dismutase; (b) cloning the gene sequence into an expression vector to construct a recombinant expression vector; (c) transforming the recombinant expression vector into an expression host cell to obtain a recombinant strain; (d) inducing the expression host cell to express the recombinant human copper-zinc superoxide dismutase under proper conditions; and (e) collecting an expression product, and carrying out multi-step purification to obtain the high-purity recombinant human copper-zinc superoxide dismutase. According to the superoxide dismutase provided by the invention, the expression quantity and activity of recombinant protein are remarkably improved, the purification process is simplified, the production cost is reduced, and meanwhile, the high-quality standard of a product is ensured.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method for preparing recombinant human copper-zinc superoxide dismutase. Background Art

[0002] Superoxide dismutase (SOD) is an important antioxidant enzyme that is widely present in animals, plants and microorganisms. The main function of SOD is to catalyze the dismutation of superoxide anion radicals into hydrogen peroxide and water, thereby effectively removing superoxide anion radicals in the body, preventing them from damaging cell membranes and other biological molecules, and protecting cells from oxidative stress. Depending on the central metal ion, SOD can be divided into copper-zinc superoxide dismutase, iron superoxide dismutase and manganese superoxide dismutase. Among them, copper-zinc superoxide dismutase is mainly present in the cytoplasm of eukaryotic organisms and has important physiological functions.

[0003] With the development of genetic engineering technology, the production of humanized Cu / Zn SOD using recombinant technology has become a research hotspot. However, the existing recombinant Cu / Zn SOD production methods still have some problems, mainly including: the activity of the target protein is not high, the activity of the recombinant Cu / Zn SOD produced by the existing method is low, and it is difficult to meet the needs of practical applications; the expression level of the target protein is not high, and the expression level of Cu / Zn SOD in many recombinant expression systems is low, which increases the production cost; the existing purification process is cumbersome and difficult to achieve large-scale industrial production; the recombinant protein is easily contaminated by endotoxins during the purification process, affecting the quality and safety of the product.

[0004] In view of the wide application prospects of SOD in biomedicine and industry, it is urgent to develop a method that can efficiently, economically and simply prepare highly active and high-purity recombinant human Cu / Zn SOD to overcome the defects of existing technologies. Summary of the invention

[0005] 1. Technical Problems Solved

[0006] The technical problem to be solved by the present invention is the various problems mentioned in the above background technology, and a method for preparing recombinant human copper-zinc superoxide dismutase is provided.

[0007] 2. Technical Solution

[0008] In order to solve the above technical problems, the technical solution provided by the present invention is: a method for preparing recombinant human copper-zinc superoxide dismutase, comprising the following steps:

[0009] (a) designing and synthesizing a gene sequence encoding a recombinant human copper-zinc superoxide dismutase;

[0010] (b) cloning the gene sequence into an expression vector to construct a recombinant expression vector;

[0011] (c) transforming the recombinant expression vector into an expression host cell to obtain a recombinant strain;

[0012] (d) inducing the expression host cell to express the recombinant human copper-zinc superoxide dismutase under appropriate conditions;

[0013] (e) Collecting the expression products and obtaining high-purity recombinant human copper-zinc superoxide dismutase through multiple purification steps.

[0014] As an improvement, the gene sequence includes a nucleotide sequence encoding a recombinant human copper-zinc superoxide dismutase SOD-01 and a nucleotide sequence encoding a recombinant human copper-zinc superoxide dismutase SOD-02, wherein SOD-02 is based on SOD-01 with Cys7 mutated to Ala and Cys112 mutated to Ser.

[0015] As an improvement, the expression vector is pET30a.

[0016] As an improvement, the expression host cell is Escherichia coli BL21DE3.

[0017] As an improvement, the conditions for inducing expression in step (d) include using 0.5 mmol / L to 1 mmol / L IPTG and inducing at 30° C. to 37° C. for 3 to 5 hours.

[0018] As an improvement, in step (e), the multiple purification steps include cell disruption, ion exchange chromatography and renaturation treatment.

[0019] As an improvement, an appropriate amount of Cu2+ and Zn2+ ions are added during the renaturation treatment to restore the activity of the recombinant human copper-zinc superoxide dismutase.

[0020] As an improvement, the purity of the recombinant human copper-zinc superoxide dismutase is greater than or equal to 95%, and the endotoxin level should be less than or equal to 10EU / mg.

[0021] As an improvement, the enzyme activity of the recombinant human copper-zinc superoxide dismutase is greater than or equal to 6000 U / mg.

[0022] 3. Beneficial Effects

[0023] The advantages of the present invention compared with the prior art are:

[0024] The present invention provides a method for efficiently preparing recombinant human copper-zinc superoxide dismutase, which significantly improves the expression amount and activity of the recombinant protein by optimizing the gene sequence design, selecting suitable expression vectors and host cells, optimizing the induction expression conditions and the multi-step purification process, simplifies the purification process, reduces the production cost, and ensures the high quality standard of the product. Specifically, the present invention obtains a SOD-02 variant with a higher expression amount by mutating Cys7 in SOD-01 to Ala and Cys112 to Ser. Using pET30a expression vector and Escherichia coli BL21 (DE3) as host cells, under the induction of 0.5mmol / L to 1mmol / L IPTG, the expression is carried out at 30°C to 37°C for 3 to 5 hours, and a high expression amount of recombinant protein can be obtained. During the purification process, cell fragmentation, ion exchange chromatography and renaturation treatment are performed, and appropriate amounts of Cu2+ and Zn2+ ions are added to ensure the high activity of the recombinant protein. The purity of the recombinant human Cu / Zn SOD finally obtained is greater than or equal to 95%, the endotoxin level is less than or equal to 10EU / mg, and the enzyme activity is greater than or equal to 6000U / mg. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The present invention is a flow chart of the steps of a method for preparing recombinant human copper-zinc superoxide dismutase.

[0026] Figure 2 This is a SOD activity test chart of a method for preparing recombinant human copper-zinc superoxide dismutase according to the present invention.

[0027] Figure 3 This is a method for preparing recombinant human copper-zinc superoxide dismutase SOD antioxidant test data diagram of the present invention.

[0028] Figure 4 This is a method for preparing recombinant human copper-zinc superoxide dismutase SOD anti-inflammatory test data diagram of the present invention. DETAILED DESCRIPTION

[0029] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0030] Embodiment 1

[0031] like Figure 1 As shown, a method for preparing recombinant human copper-zinc superoxide dismutase comprises the following steps:

[0032] (a) designing and synthesizing a gene sequence encoding a recombinant human copper-zinc superoxide dismutase, wherein the gene sequence includes a nucleotide sequence encoding a recombinant human copper-zinc superoxide dismutase SOD-01 and a nucleotide sequence encoding a recombinant human copper-zinc superoxide dismutase SOD-02, wherein SOD-02 is based on SOD-01 with Cys7 mutated to Ala and Cys112 mutated to Ser;

[0033] (b) cloning the gene sequence into an expression vector to construct a recombinant expression vector, wherein the expression vector is pET30a;

[0034] (c) transforming the recombinant expression vector into an expression host cell to obtain a recombinant strain, wherein the expression host cell is Escherichia coli BL21DE3;

[0035] (d) inducing the expression host cell to express recombinant human copper zinc superoxide dismutase under appropriate conditions, wherein the induction conditions include using 0.5 mmol / L to 1 mmol / L IPTG and inducing at 30° C. to 37° C. for 3 to 5 hours;

[0036] (e) collecting the expression product and obtaining high-purity recombinant human copper-zinc superoxide dismutase through a multi-step purification process, wherein the multi-step purification process includes cell disruption, ion exchange chromatography and renaturation treatment, and during the renaturation treatment, an appropriate amount of Cu2+ and Zn2+ ions are added to restore the activity of the recombinant human copper-zinc superoxide dismutase.

[0037] In the specific implementation process, the steps are as follows:

[0038] Gene sequence design and synthesis:

[0039] The gene sequences encoding recombinant human copper-zinc superoxide dismutase SOD-01 and SOD-02 were designed and synthesized. SOD-02 is based on SOD-01, with the cysteine ​​at position 7 (Cys7) mutated to alanine (Ala), and the cysteine ​​at position 112 (Cys112) mutated to serine (Ser). The nucleotide sequences of SOD-01 and SOD-02 are:

[0040] Nucleotide sequence of SOD-01: ATGGCCACCAAAGCAGTTTGTGTGCTGAAAGGTGACGGTCCGGTGCAGGGCATTATTAATTTTGAACAGAAAGAAAGCAACGGCCCGGTTAAAGTGTGGGGTAGCATTAAGGGTCTGACCGAAGGTCTGCATGGTTTTCATGTGCATGAATTTGGTGACAATACCGCAGGCTGCACCAGCGCCGGTCCGCATTTTAATCCGCTGAGCCGCAAACATGGTGGCCCGAAAGATGAAGAACGCCATGTGGGTGACCTGGGCAATGTTACCGCAGATAAAGATGGTGTTGCAGATGTTAGCATTGAAGATAGCGTGATTAGTCTGAGTGGTGACCATTGTATTATTGGTCGCACCCTGGTTGTGCATGAAAAAGCCGATGATCTGGGCAAAGGCGGTAATGAAGAAAGCACCAAAACCGGCAATGCAGGTAGCCGCCTGGCATGTGGCGTTATTGGTATTGCACAGTAA。

[0041] Nucleotide sequence of SOD-02: ATGGCAACAAAAGCGGTTGCTGTACTAAAGGGCGATGGCCCAGTGCAAGGTATTATTAACTTTGAGCAGAAAGAATCTAATGGTCCGGTTAAAGTTTGGGGTAGCATTAAAGGCTTAACGGAAGGTCTGCATGGTTTCCACGTGCACGAGTTCGGCGACAACACTGCGGGTTGTACCAGCGCAGGTCCGCACTTTAACCCGCTGAGTCGCAAGCACGGCGGTCCGAAAGATGAAGAACGTCATGTGGGTGACTTGGGCAACGTGACCGCGGACAAGGACGGCGTGGCTGATGTCAGCATCGAGGACAGCGTTATTAGCCTGTCCGGCGACCACTCCATCATCGGCCGTACCTTGGTTGTTCATGAGAAGGCGGATGATCTGGGTAAGGGTGGCAATGAAGAGTCGACCAAAACCGGTAATGCAGGCTCTCGTCTGGCCTGCGGTGTCATCGGGATCGCGCAGTAA。

[0042] Expression vector construction:

[0043] The above synthesized gene sequences were cloned into the expression vector pET30a to construct recombinant expression vectors pET30a-SOD-01 and pET30a-SOD-02.

[0044] Transformation of expression host cells:

[0045] The recombinant expression vectors pET30a-SOD-01 and pET30a-SOD-02 were transformed into competent E. coli BL21 (DE3) cells, respectively, spread on plates containing kanamycin resistance, invertedly cultured at 37° C. for 12-16 hours, and positive clones were screened.

[0046] Inducible expression:

[0047] Pick a single positive clone, inoculate it in LB medium containing kanamycin, and culture it overnight at 30℃ for 14-15 hours. The next day, take 10μL of overnight cultured bacteria and add it to 1mL LB medium. After culturing at 37℃ for 3 hours, add IPTG with a final concentration of 0.5mmol / L or 1mmol / L, and induce it at 30℃ or 37℃ for 3-5 hours.

[0048] Protein expression verification:

[0049] After the induction expression was completed, a small amount of bacterial solution was taken for SDS-PAGE electrophoresis analysis to verify the expression of the recombinant protein. The results showed that SOD-02 had a good expression level under the induction conditions of 30°C and 0.5mmol / L IPTG or 1mmol / L IPTG, which was significantly higher than SOD-01.

[0050] Protein purification:

[0051] Collect the expression product and purify it by the following steps:

[0052] Cell disruption: suspend the bacteria in 20 mM Tris buffer at a resuspension ratio of 1:10, use a high-pressure homogenizer to disrupt the bacteria at a pressure of 600-800 bar, add urea solid to the disrupted suspension to 8 M, adjust the pH to 4.5, and centrifuge to obtain the supernatant.

[0053] Affinity chromatography: The supernatant was passed through an SP chromatography column and eluted with a pH gradient using 20 mM Tris + 8 M urea + 200 mM NaCl as the eluent.

[0054] Ion exchange chromatography: adjust the pH of the eluate after SP chromatography to 8.0, add 10mM DTT for 10-20 minutes, then add to the renaturation solution (20mM Tris+5% sucrose+0.2M urea+0.2mM GSSG+0.46mM GSH), adjust the pH to 7.4, let stand at 2-8°C for 18-30 hours, add copper sulfate and zinc sulfate, and continue to stand at 2-8°C for 48-72 hours.

[0055] Further purification: The pH of the renatured protein solution was adjusted to 8.5, and further purified by Q chromatography column, with gradient elution using 20mM Tris pH 8.5 and 20mM Tris+50mM NaCl pH 7.4, to collect the target protein peak, the purity of which could reach more than 95%.

[0056] Endotoxin removal: To further control the endotoxin in the protein solution, the purified protein solution was passed through the Q chromatography column again, and the endotoxin level could be controlled within 10EU / mg.

[0057] Quality Control:

[0058] The final recombinant human Cu / Zn SOD was subjected to multiple quality control tests, including purity testing, endotoxin level determination, and enzyme activity determination. The results showed that the purity of the recombinant protein was greater than or equal to 95%, the endotoxin level was less than or equal to 10EU / mg, and the enzyme activity was greater than or equal to 6000U / mg.

[0059] Functional verification of the recombinant human Cu / Zn SOD obtained:

[0060] 1. Recombinant superoxide dismutase activity assay

[0061] Combined with Figure 2 According to GB / T 5009.171-2003, the activity of superoxide dismutase (SOD) in health foods is determined. Pyrogallol can be rapidly self-oxidized under alkaline conditions to generate colored intermediates. In the initial stage of the self-oxidation process, the accumulation of yellow intermediates is linearly related to time. The intermediate has strong light absorption at 325nm. In the presence of SOD, it can catalyze the generation of oxygen and water, thereby preventing the accumulation of intermediates. The activity of SOD can be calculated by taking 50% of the inhibition of the self-oxidation rate as one enzyme activity unit. The inhibition of oxidation rate is controlled between 30% and 70% of the self-oxidation rate. The linear regression curve drawn with time as the horizontal axis and the OD value at 325nm as the vertical axis requires R ≥ 0.99. The protein activity is controlled above 6000U / mg.

[0062] 2. Antioxidant Experiment of Recombinant Superoxide Dismutase

[0063] Combined with Figure 3 Principle of the antioxidant experiment: The fluorescent probe 2',7'-dichlorofluorescein diacetate (DCFH-DA) can pass through the cell membrane and enter the cell. It is decomposed by esterase in the cell to form dichlorofluorescein. Dichlorofluorescein can be oxidized by free radicals induced by 2,2'-azobisisobutylamidine dihydrochloride (AAPH) to generate fluorescent substances, and its fluorescence intensity is correlated with the level of intracellular reactive oxygen. Antioxidants can bind oxygen free radicals outside the cell membrane to prevent them from entering the cell, or remove oxygen free radicals inside the cell membrane to block the generation of fluorescent substances. The corresponding degree of fluorescence intensity reduction can reflect the degree of anti-cell oxidation of the test substance. Results: In the in vitro oxidative stress injury model of HaCaT cells induced by H2O2, the sample group had an antioxidant effect, and the antioxidant effect of 0.05 mg / ml was equivalent to that of the positive control group (vitamin C 0.1 mg / ml).

[0064] 3. Anti-inflammatory Experiment of Recombinant Superoxide Dismutase

[0065] Combined with Figure 4 , Principle of anti-inflammatory experiment: RAW264.7 macrophages are a classic cell model for studying inflammatory factors. By comparing the difference in the content of inflammatory mediator NO released by RAW264.7 after administration of the negative control and the test substance, the effect of the test substance on inhibiting NO release was evaluated. The blank control group was background DMEM + 10% FBS culture medium, the model control group was 1μg / ml LPS, the positive control group was 0.1mg / ml dexamethasone + 1μg / ml LPS, and the sample group was recombinant protein + 1μg / ml LPS. Results: Different concentrations of the sample group had different degrees of anti-inflammatory effects, among which 0.1mg / ml had an anti-inflammatory effect equivalent to the positive control group (dexamethasone).

[0066] In summary, the experimental results show that the recombinant superoxide dismutase of the present invention inhibits the oxidative effect of free radicals, thereby effectively preventing the toxic effect of superoxide radical anions on cells.

[0067] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0068] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

[0069] The present invention and its embodiments are described above, and such description is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. In short, if ordinary technicians in the field are inspired by it, without departing from the purpose of the invention, they can design a structure and embodiment similar to the technical solution without creativity, which should belong to the protection scope of the present invention.

Claims

1. A method for preparing recombinant human copper-zinc superoxide dismutase, characterized in that: The following steps are involved: (a) designing and synthesizing a gene sequence encoding a recombinant human copper-zinc superoxide dismutase; (b) cloning the gene sequence into an expression vector to construct a recombinant expression vector; (c) transforming the recombinant expression vector into an expression host cell to obtain a recombinant strain; (d) inducing the expression host cell to express the recombinant human copper-zinc superoxide dismutase under appropriate conditions; (e) Collecting the expression products and obtaining high-purity recombinant human copper-zinc superoxide dismutase through multiple purification steps.

2. The method according to claim 1, characterized in that The gene sequence includes a nucleotide sequence encoding a recombinant human copper-zinc superoxide dismutase SOD-01 and a nucleotide sequence encoding a recombinant human copper-zinc superoxide dismutase SOD-02, wherein SOD-02 is based on SOD-01 with Cys7 mutated to Ala and Cys112 mutated to Ser.

3. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 1, characterized in that: The expression vector is pET30a.

4. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 1, characterized in that: The expression host cell is Escherichia coli BL21DE3.

5. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 1, characterized in that: The conditions for inducing expression in step (d) include using 0.5 mmol / L to 1 mmol / L IPTG and inducing at 30° C. to 37° C. for 3 to 5 hours.

6. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 1, characterized in that: In step (e), the multiple purification steps include cell disruption, ion exchange chromatography and renaturation treatment.

7. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 6, characterized in that: During the renaturation process, appropriate amounts of Cu2+ and Zn2+ ions are added to restore the activity of the recombinant human copper-zinc superoxide dismutase.

8. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 1, characterized in that: The purity of the recombinant human copper-zinc superoxide dismutase is greater than or equal to 95%, and the endotoxin level should be less than or equal to 10EU / mg.

9. A method for preparing recombinant human copper-zinc superoxide dismutase according to claim 1, characterized in that: The enzyme activity of the recombinant human copper-zinc superoxide dismutase is greater than or equal to 6000 U / mg.

Images