High-yield rAAV plasmid system and application

Abstract

The invention belongs to the technical field of biology, and discloses a plasmid system with high rAAV yield and application. The plasmid system of the high-yield rAAV comprises a transgenic plasmid containing two terminal inverted repetitive sequences, a packaging plasmid, an auxiliary plasmid and an shRNA (short hairpin Ribonucleic Acid) expression cassette, the shRNA expression cassette comprises a sequence capable of targeting a target gene in the transgenic plasmid. According to the plasmid system, in the rAAV production process, transcription expression of a target gene is inhibited by expressing a target gene coding region or a target sequence on shRNA targeted transgenic plasmids. The well-designed target sequence is different from human and mammal source gene coding region sequences, and can be applied to various transgenic plasmids in a broad spectrum manner, so that the yield of the rAAV is increased, the rAAV production efficiency of mammal cells can be remarkably improved, and the technical effects of improving the druggability of the rAAV and reducing the production cost are achieved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a plasmid system for high-yield rAAV and its application. Background Art

[0002] Recombinant adeno-associated virus (rAAV) vectors have many advantages, such as the ability to stably express exogenous genes for a long time, non-integration into the host genome, the ability to infect dividing / non-dividing cells, a wide range of host cells, strong specificity, and low immunogenicity, making them a safe and effective gene therapy tool. They are therefore considered to be one of the most promising gene therapy vectors currently.

[0003] The rAAV production system mainly includes the plasmid transfection production system based on HEK293 cells, the production system based on insect cells and baculovirus, and the packaging cell or induced packaging cell method. The plasmid transfection production system based on HEK293 cells is the mainstream technology for clinical / research-level rAAV production. The system mainly adopts the method of co-transfecting HEK293 cells with a transgenic plasmid containing two terminal inverted repeat sequences, a packaging plasmid encoding AAV replication protein (Rep) and capsid protein (Cap), and an auxiliary plasmid encoding auxiliary factors required for rAAV replication. The main process includes: preparation of plasmids, amplification of production cells, transfection of plasmids into production cells, cell lysis to harvest crude virus solution, virus purification and other steps.

[0004] However, during the rAAV production process, since the promoter on the transgenic plasmid can be active in HEK293 cells and drive the transcriptional expression of the target gene, these gene expression products, especially those that have a negative impact on cells, will lead to a reduction in the ability to package rAAV. Therefore, research and development of methods that can silence the target gene during the rAAV production process, thereby increasing rAAV production, is of great significance for promoting the large-scale production of rAAV and rAAV-mediated gene therapy. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a plasmid system and application of high-yield rAAV.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a plasmid system for high-yield rAAV, comprising a transgenic plasmid containing two terminal inverted repeat sequences, a packaging plasmid, a helper plasmid and a shRNA expression cassette;

[0008] The shRNA expression cassette includes a sequence capable of targeting the target gene in the transgenic plasmid.

[0009] During the rAAV production process, the plasmid system of the present invention silences the target gene on the transgenic plasmid by expressing shRNA, thereby increasing the yield of rAAV, which can significantly improve the rAAV production efficiency of mammalian cells, achieving the technical effects of improving the drugability of rAAV and reducing production costs.

[0010] As a preferred embodiment of the high-yield rAAV plasmid system of the present invention, a target sequence is inserted at the 5' end or 3' end outside the target gene coding region on the transgenic plasmid; the nucleotide of the target sequence is: 5'-GGCGAGAATGAGCCTGCCTGTAAA-3'.

[0011] As a preferred embodiment of the high-yield rAAV plasmid system of the present invention, the shRNA expression cassette includes a promoter driving the shRNA, a shRNA hairpin structure targeting the target gene coding region or the target sequence on the transgenic plasmid, and a terminator.

[0012] As a preferred embodiment of the high-yield rAAV plasmid system of the present invention, the shRNA expression cassette is located on any plasmid among the transgenic plasmid, packaging plasmid and auxiliary plasmid.

[0013] As a preferred embodiment of the high-yield rAAV plasmid system of the present invention, the transgenic plasmid is a pGOI plasmid; the packaging plasmid is pRep-Cap; and the auxiliary plasmid is pHelper.

[0014] The pGOI plasmid includes ITR sequences from different serotypes and optimized sequences thereof; the pRep-Cap includes nucleic acid sequences from different serotypes that express Rep protein and nucleic acid sequences that express Cap protein and optimized nucleic acid sequences thereof; the plasmid pHelper encodes auxiliary factors required for rAAV replication, including nucleic acid sequences from different helper virus plasmids that express adenovirus original protein and optimized sequences thereof.

[0015] In a second aspect, the present invention provides a cell with high rAAV production, comprising the above-mentioned plasmid system.

[0016] As a preferred embodiment of the high-rAAV-producing cells of the present invention, the cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, Hela cells, Vero cells, and SF-9 cells.

[0017] In a third aspect, the present invention applies the plasmid system and the cells in rAAV production.

[0018] In a fourth aspect, the present invention provides a method for improving the production of recombinant adeno-associated virus, using the plasmid system to transfect packaging cells; or culturing the cells.

[0019] As a preferred embodiment of the method described in the present invention, the packaging cell is at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, Hela cells, Vero cells, and SF-9 cells.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] During the rAAV production process, the plasmid system of the present invention silences the target gene on the transgenic plasmid by expressing shRNA, thereby increasing the yield of rAAV, which can significantly improve the rAAV production efficiency of mammalian cells, achieving the technical effects of improving the drugability of rAAV and reducing production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The rAAV packaging effect of inhibiting the expression of target gene by targeting the gene coding region on pGOI;

[0023] Figure 1 In the figure, Figure a: schematic diagram of pGOI, pHelper-shScram, and pHelper-shGFP constructed by the present invention; Figure b: fluorescence intensity of rAAV packaging by co-transfection of pGOI and pRep-Cap with pHelper, pHelper-shScram, and pHelper-shGFP, respectively; Figure c: relative genome titer of rAAV packaging by co-transfection of pGOI and pRep-Cap (AAV9) with pHelper, pHelper-shScram, and pHelper-shGFP, respectively; Figure d: relative genome titer of rAAV packaging by co-transfection of pGOI and pRep-Cap (AAV2) with pHelper, pHelper-shScram, and pHelper-shGFP, respectively.

[0024] Figure 2 The rAAV packaging effect of inhibiting the expression of the target gene by targeting the 5' end target sequence of the gene on pGOI;

[0025] Figure 2In the figure, Figure a: schematic diagram of pGOI-5'TS, pHelper-shScram, and pHelper-shTS constructed by the present invention; Figure b: fluorescence intensity of rAAV packaging using pGOI-5'TS, pRep-Cap, and pHelper, pHelper-shScram, and pHelper-shTS co-transfection, respectively; Figure c: relative genome titer of rAAV packaging using pGOI-5'TS, pRep-Cap (AAV9) and pHelper, pHelper-shScram, and pHelper-shTS co-transfection, respectively; Figure d: relative genome titer of rAAV packaging using pGOI-5'TS, pRep-Cap (AAV2) and pHelper, pHelper-shScram, and pHelper-shTS co-transfection, respectively.

[0026] Figure 3 The rAAV packaging effect of inhibiting the expression of the target gene by targeting the 3' end target sequence of the gene on pGOI;

[0027] Figure 3 In the figure, Figure a: schematic diagram of pGOI-3'TS, pHelper-shScram, and pHelper-shTS constructed by the present invention; Figure b: fluorescence intensity of rAAV packaging using pGOI-3'TS, pRep-Cap, and pHelper, pHelper-shScram, and pHelper-shTS co-transfection, respectively; Figure c: relative genome titer of rAAV packaging using pGOI-3'TS, pRep-Cap (AAV9) and pHelper, pHelper-shScram, and pHelper-shTS co-transfection, respectively; Figure d: relative genome titer of rAAV packaging using pGOI-3'TS, pRep-Cap (AAV2) and pHelper, pHelper-shScram, and pHelper-shTS co-transfection, respectively. DETAILED DESCRIPTION

[0028] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0029] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0030] Example 1: rAAV packaging effect of inhibiting target gene expression by targeting the gene coding region on pGOI

[0031] (1) Plasmid construction and preparation

[0032] Using molecular biological techniques such as gene synthesis, PCR, Gibson Assembly, and sequencing analysis, the self-cleavage polypeptide P2A (Kim JH et.al. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One. 2011, 6(4): e18556. doi: 10.1371 / journal.pone.0018556.) and CASP4 gene (GenBank accession: NM_001225) were inserted into the 3' end of the eGFP gene on the pAAV-GFP plasmid (Addgene: 32395) to obtain the following: Figure 1 a The pGOI plasmid shown in FIG.

[0033] The EF1a promoter (Qin JY et.al. Systematic comparison of constitutive promoters and the doxycycline-inducible promoter. PLoS One. 2010, 5(5): e10611. doi: 10.1371 / journal.pone.0010611.), shRNA control shScarm hairpin structure (5'-tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgGCCTA AGGTTAAGTCGCCCTCGtagtgaagccacagatgtaCGAGGGCGACTTAACCTTAGGTtgcctactgcctcggacttcaaggggctagaattcgagcaattatct tgtttaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaattaaatcacttt-3'), WPRE-SV40pA fragment (Choi JH et.al.Optimization of AAV expressioncassettes to improve packaging capacity and transgene expression inneurons.Mol Brain.2014,7:17.doi:10.1186 / 1756-6606-7-17.Carswell S,AlwineJC.Efficiency of utilization of the simian virus 40late polyadenylation site:effects of upstream sequences.Mol Cell Biol.1989,9(10):4248-58.doi:10.1128 / mcb.9.10.4248-4258.1989.) was inserted into the pHelper plasmid (GeneBank: AF369965) to obtain the following Figure 1 pHelper-shScram plasmid shown in a.

[0034] The EF1a promoter, the shGFP hairpin construct targeting the GFP coding region (5′-tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgTGCACAAGCTGGAGTACAACTAtagtgaagccacagatgtaTAGTTGTACTCCAGCTTGTGCCtgcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaa ttaaatcacttt-3′), and the WPRE-SV40pA fragment were inserted into the pHelper plasmid to obtain the result. Figure 1 pHelper-shGFP plasmid shown in a.

[0035] Extract high-concentration and high-purity pGOI, pRep-Cap (AAV9), pRep-Cap (AAV2), pHelper, pHelper-shSram, and pHelper-shGFP plasmids.

[0036] (2) rAAV packaging

[0037] One day before transfection, 293T cells were suspended in DMEM medium and counted at 6×10 6 Cells / dish were evenly spread on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.

[0038] Set the control group plasmid: pGOI, pRep-Cap (AAV9 or AAV2), pHelper; the shScram group plasmid: pGOI, pRep-Cap (AAV9 or AAV2), pHelper-shScram; the shGFP group plasmid: pGOI, pRep-Cap (AAV9 or AAV2), pHelper-shGFP.

[0039] On the day of transfection, replace with fresh DMEM medium. Mix pGOI, pRep-Cap, and pHelper at a ratio of 2.0μg:2.5μg:2.5μg:2.3μg, with 3 replicates per group. Mix 0.5mL DMEM with plasmid DNA, 0.5mL DMEM with 8.4μL PEIpro, then add the PEIpro mixture to the DNA mixture and mix well, let stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.

[0040] On the third day after transfection, eGFP fluorescence was observed under a fluorescence microscope. The fluorescence photography results showed that the fluorescence intensity of the shGFP group was significantly reduced compared with the Control and shScram groups ( Figure 1 b).

[0041] (3) Genomic titer determination

[0042] Add 100 μL of cell lysate to the transfected culture dish, let stand at room temperature for 30 minutes, and take 50 μL of supernatant to measure the genome titer. Use DNaseI to digest the harvested supernatant, use qRT-PCR to measure the genome titer, and use gradient dilution of plasmid standards to make a standard curve. Calculate the genome titer of the rAAV sample based on the standard curve.

[0043] The results of genome titer test showed that compared with the Control group, the genome titers of AAV9 and AAV2 shGFP groups increased by 5.91 times ( Figure 1 c) and 2.22 times ( Figure 1 d).

[0044] Example 2: rAAV packaging effect of inhibiting target gene expression by targeting the 5' end target sequence of the gene on pGOI

[0045] (1) Plasmid construction and preparation

[0046] Bioinformatics methods were used to generate all nucleotide sequences encoding the amino acid sequence of PACKGENE. After all sequences were aligned, potential shRNA target sequences were designed using the GPP Web Portal online program, and then the target sequence with the highest score (5'-GGCGAGAATGAGCCTGCCTGTAAA-3') was selected for testing. After comparison, the target sequence was different from the coding region sequence of genes from humans and mammals, so the designed shRNA would not target and affect human or animal genes.

[0047] Using molecular biological techniques such as gene synthesis, PCR, Gibson Assembly, and sequencing analysis, a 24 bp target sequence (TS, 5'-GGCGAGAATGAGCCTGCCTGTAAA-3') was inserted into the 5' end of the eGFP gene on the pGOI plasmid to obtain Figure 2 a The pGOI-5'TS plasmid shown in FIG.

[0048] The EF1a promoter, the shTS hairpin structure targeting the TS sequence (5′-tgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgTGAGAATGAGCCTGCCTGTAAAtagtgaagccacagatgtaTTTACAGGCAGGCTCATTCTCGtgcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaattaaatcacttt-3′), and the WPRE-SV40pA fragment were inserted into the pHelper plasmid to obtain the result. Figure 2 pHelper-shTS plasmid shown in a.

[0049] Extract high-concentration and high-purity pGOI-5'TS, pRep-Cap(AAV9), pRep-Cap(AAV2), pHelper, pHelper-shSram, and pHelper-shTS plasmids.

[0050] (2) rAAV packaging

[0051] One day before transfection, 293T cells were suspended in DMEM medium and counted at 6×10 6 Cells / dish were evenly spread on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.

[0052] The control group plasmids were set as follows: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper; the shScram group plasmids were set as follows: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper-shScram; the shTS group plasmids were set as follows: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper-shTS.

[0053] On the day of transfection, replace with fresh DMEM medium. Mix pGOI, pRep-Cap, and pHelper at a ratio of 2.0μg:2.5μg:2.5μg:2.3μg, with 3 replicates per group. Mix 0.5mL DMEM with plasmid DNA, 0.5mL DMEM with 8.4μL PEIpro, then add the PEIpro mixture to the DNA mixture and mix well, let stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.

[0054] On the third day after transfection, eGFP fluorescence was observed under a fluorescence microscope. The fluorescence imaging results showed that the fluorescence intensity of the shTS group was slightly reduced compared with the Control and shScram groups ( Figure 2 b).

[0055] (3) Genomic titer determination

[0056] Add 100 μL of cell lysate to the transfected culture dish, let stand at room temperature for 30 minutes, and take 50 μL of supernatant to measure the genome titer. Use DNaseI to digest the harvested supernatant, use qRT-PCR to measure the genome titer, and use gradient dilution of plasmid standards to make a standard curve. Calculate the genome titer of the rAAV sample based on the standard curve.

[0057] The genome titer test results showed that compared with the Control group, the genome titers of the AAV9 and AAV2 shTS groups increased by 5.29 times ( Figure 2 c) and 3.08 times ( Figure 2 d).

[0058] Example 3: rAAV packaging effect of inhibiting target gene expression by targeting the 3' end target sequence of the gene on pGOI

[0059] (1) Plasmid construction and preparation

[0060] Using molecular biological techniques such as gene synthesis, PCR, Gibson Assembly, and sequencing analysis, a 24 bp target sequence (TS) was inserted into the 3' end of the eGFP gene on the pGOI plasmid to obtain Figure 3 a The pGOI-3'TS plasmid shown in FIG.

[0061] Extract high-concentration and high-purity pGOI-3'TS, pRep-Cap(AAV9), pRep-Cap(AAV2), pHelper, pHelper-shSram, and pHelper-shTS plasmids.

[0062] (2) rAAV packaging

[0063] One day before transfection, 293T cells were suspended in DMEM medium and counted at 6×10 6 Cells / dish were evenly spread on a 10-cm cell culture dish and cultured at 37°C and 5% CO2 until the cell confluence was about 80%.

[0064] The control group plasmids were set as follows: pGOI-3'TS, pRep-Cap (AAV9 or AAV2), pHelper; the shScram group plasmids were set as follows: pGOI-5'TS, pRep-Cap (AAV9 or AAV2), pHelper-shScram; the shTS group plasmids were set as follows: pGOI-3'TS, pRep-Cap (AAV9 or AAV2), pHelper-shTS.

[0065] On the day of transfection, replace with fresh DMEM medium. Mix pGOI, pRep-Cap, and pHelper at a ratio of 2.0μg:2.5μg:2.5μg:2.3μg, with 3 replicates per group. Mix 0.5mL DMEM with plasmid DNA, 0.5mL DMEM with 8.4μL PEIpro, then add the PEIpro mixture to the DNA mixture and mix well, let stand at room temperature for 15 minutes. Add the DNA-PEIpro mixture to the grown cells, mix gently, and return to the incubator for culture.

[0066] On the third day after transfection, eGFP fluorescence was observed under a fluorescence microscope. The fluorescence photography results showed that the fluorescence intensity of the shTS group was significantly reduced compared with the Control and shScram groups ( Figure 3 b).

[0067] (3) Genomic titer determination

[0068] Add 100 μL of cell lysate to the transfected culture dish, let stand at room temperature for 30 minutes, and take 50 μL of supernatant to measure the genome titer. Use DNaseI to digest the harvested supernatant, use qRT-PCR to measure the genome titer, and use gradient dilution of plasmid standards to make a standard curve. Calculate the genome titer of the rAAV sample based on the standard curve.

[0069] The results of genome titer test showed that compared with the Control group, the genome titers of the shTS groups of AAV9 and AAV2 increased by 8.68 times ( Figure 3 c) and 6.23 times ( Figure 3 d).

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A plasmid system for high-yield rAAV, characterized in that: It includes a transgenic plasmid containing two terminal inverted repeat sequences, a packaging plasmid, a helper plasmid and a shRNA expression cassette; The shRNA expression cassette includes a sequence that targets the target gene in the transgenic plasmid.

2. The high-yield rAAV plasmid system according to claim 1, characterized in that: A target sequence is inserted into the 5' end or 3' end outside the coding region of the target gene in the transgenic plasmid; the nucleotide sequence of the target sequence is: 5'GGCGAGAATGAGCCTGCCTGTAAA-3'.

3. The high-yield rAAV plasmid system according to claim 1 or 2, characterized in that: The shRNA expression cassette comprises a promoter for driving the shRNA, a shRNA hairpin structure targeting the target gene coding region or the target sequence on the transgenic plasmid, and a terminator.

4. The high-yield rAAV plasmid system according to claim 1, characterized in that: The shRNA expression box is located on any plasmid among the transgenic plasmid, the packaging plasmid and the auxiliary plasmid.

5. The high-yield rAAV plasmid system according to claim 1, characterized in that: The transgenic plasmid is pGOI plasmid; the packaging plasmid is pRep-Cap; and the auxiliary plasmid is pHelper.

6. A cell that produces high levels of rAAV, characterized in that: A plasmid system comprising any one of claims 1 to 5.

7. The high-rAAV-producing cell according to claim 6, characterized in that The cell is at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, Hela cells, Vero cells, and SF-9 cells.

8. Use of the plasmid system described in any one of claims 1 to 5 and the cell described in claim 6 or 7 in rAAV production.

9. A method for improving the production of recombinant adeno-associated virus, characterized in that: The method comprises using the plasmid system of any one of claims 1 to 5 to transfect packaging cells; or culturing the cells of claim 6 or 7.

10. The method according to claim 9, characterized in that The packaging cell is at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, Hela cells, Vero cells, and SF-9 cells.

Images