Application of SSBP2-FLT3 fusion gene as detection target in preparation of products for detecting human leukemia

Abstract

The invention relates to the field of medical examination, in particular to application of a substance for detecting an SSBP2-FLT3 fusion gene in preparation of a product for detecting human leukemia. Aiming at the fusion gene SSBP2-FLT3, a specific PCR primer is designed, PCR amplification and sequencing are performed after nucleic acid is extracted from a patient sample, and the specific translocation site of the fusion gene is detected, so that the method is the most accurate, convenient and economical method. According to the application, DNA fusion gene detection and RNA fusion gene detection are combined, and meanwhile, as a molecular marker, an important basis can be provided for selecting a treatment scheme for a patient, predicting a recurrence risk and evaluating prognosis, and the molecular marker has an irreplaceable important effect in aspects of hematopoietic stem cell transplantation curative effect evaluation, pretreatment scheme optimization and post-transplantation molecular recurrence monitoring.

Description

Technical Field

[0001] This specification relates to the field of gene detection, and in particular to the use of a substance for detecting SSBP2-FLT3 fusion gene in the preparation of a product for detecting human leukemia. Background Art

[0002] Hematological tumors are a type of proliferative diseases with high heterogeneity, mainly including various types of leukemia, lymphoma, multiple myeloma, etc. At present, the MICM diagnostic model and the latest WHO diagnostic criteria are adopted internationally, that is, morphology and cytochemistry (Morphology, M), immunology (Iummunity, I), chromosome karyotype analysis (Cytogenetics, C), molecular biology (Molecular, M, including in situ hybridization technology of fluorescent labeled probes, fusion gene analysis, gene variation analysis, gene expression and its regulation, gene fragment analysis) and other technologies are used to diagnose, classify and clinically stage patients. Acute lymphoblastic leukemia (ALL) is one of the most common malignant tumors in children. ALL is a hematological malignancy driven by gene mutations originating from hematopoietic stem / progenitor cells. Most ALL patients show different cytological characteristics, and molecular genetic abnormalities have important clinical significance in guiding diagnosis, classification, treatment and prognosis.

[0003] SSBP2 (single-stranded DNA binding protein 2) is a protein-coding gene located at 5q14.1, which plays an important role in DNA damage response and maintaining genome stability. Currently reported SSBP2 partner genes include JAK2, CSF1R and PDGFRB, and fusion genes are seen in B-ALL. Fusion genes are important driving factors for tumor occurrence and development, usually acting as atypically activated transcriptional regulators, promoting the expression of proto-oncogenes, inactivation of tumor suppressor genes and the formation of new fusion proteins. This promotes the activation of downstream signaling pathways for cell proliferation or overactivates cell growth, inhibits cell differentiation, and ultimately leads to tumor occurrence.

[0004] The FMS-like tyrosine kinase 3 gene (FLT3) is a receptor tyrosine kinase expressed in early hematopoietic progenitor cells and plays an important role in hematopoietic development. The signaling pathways stimulated by the FLT3 protein are involved in several key cellular processes, including cell division and growth. FLT3 is a single transmembrane receptor that belongs to the type III receptor tyrosine kinase family. After binding to its ligand (FL), FLT3 can phosphorylate phosphatidylinositol-3-kinase (PI3K), growth factor receptor binding protein (Grb2), and Src family tyrosine kinases, inducing the proliferation of hematopoietic progenitor cells and promoting their survival. Abnormal activation of FLT3 caused by mutations or epigenetic dysregulation may have carcinogenic effects and promote the occurrence of ALL, AML, and chronic myeloid leukemia. FLT3 gene mutations in B-ALL patients are associated with relapse and poor prognosis.

[0005] Currently, high-throughput sequencing technology (NGS) is the only detection method that can clearly identify unknown translocation sites. However, high-throughput sequencing has high costs, long detection cycles, fewer detection platforms, and high requirements for sample quality, which is not conducive to popularization and promotion. For most patients, it is not the preferred detection method. Summary of the invention

[0006] In view of the above technical problems, the present application detects the SSBP2-FLT3 fusion gene through high-throughput sequencing technology in a case diagnosed with acute lymphoblastic leukemia characteristics based on the results of bone marrow cell morphology, flow cytometry and chromosome karyotype analysis. The purpose of the present application is to provide a SSBP2-FLT3 fusion gene and its detection primers and applications to solve the problems in the prior art.

[0007] The present application provides the use of SSBP2-FLT3 fusion gene as a detection target in the preparation of a product for detecting human leukemia.

[0008] The present application also provides the use of the substance for detecting the SSBP2-FLT3 fusion gene in the above-mentioned use in the preparation of a product for detecting human leukemia.

[0009] The present application also provides a diagnostic product for detecting human leukemia, wherein the diagnostic product comprises a substance for detecting the SSBP2-FLT3 fusion gene.

[0010] The present application also provides a method for detecting the SSBP2-FLT3 fusion gene for non-diagnostic purposes, wherein the method uses the diagnostic product of claim 7 or 8 to detect whether the SSBP2-FLT3 fusion gene exists in a sample from a subject.

[0011] The beneficial effects brought by this application include but are not limited to: (1) This application discloses for the first time a new fusion gene SSBP2-FLT3, and designs a specific detection primer pair that can be used to detect new types of leukemia, thereby increasing the detection rate of leukemia. (2) This application designs specific PCR primers for the fusion gene SSBP2-FLT3, extracts nucleic acid from patient samples, performs PCR amplification and sequencing, and detects the specific translocation site of the fusion gene, which is the most accurate, convenient and economical method. (3) Currently, fusion gene detection on the market is mainly based on RNA level detection, but RNA is more easily degraded and unstable than DNA. This application combines DNA fusion gene detection with RNA fusion gene detection. At the same time, as a molecular marker, it can provide an important basis for patients to choose treatment plans, predict recurrence risks, and evaluate prognosis. It plays an irreplaceable and important role in the evaluation of the efficacy of hematopoietic stem cell transplantation, the optimization of pretreatment regimens, and the monitoring of molecular recurrence after transplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The present application will be further described in the form of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not restrictive, and include:

[0013] Figure 1 They are respectively the bone marrow smear results, flow cytometry results, and chromosome karyotype analysis results of the leukemia case in Example 1 of the present application.

[0014] Figure 2 In order to verify the application of the primer combination of the present invention (DNA: SSBP2::FLT3-F1, DNA: SSBP2::FLT3-R1; RNA: SSBP2::FLT3-F2, RNA: SSBP2-FLT3::R2) in known SSBP2::FLT3 fusion tumors, the SSBP2::FLT3 fusion gene sequencing maps were successfully detected.

[0015] Figure 3 is the electrophoretogram of Example 2, wherein Figure 3 A Lanes 1 to 30 are 30 cases of control group with clear diagnosis (DNA), including lanes 1 to 10 for 10 cases of acute lymphoblastic leukemia with positive BCR::ABL1 fusion gene, lanes 11 to 20 for 10 cases of acute lymphoblastic leukemia with positive ETV6::RUNX1 fusion gene, and lanes 21 to 30 for 10 cases of acute lymphoblastic leukemia with positive TCF3::PBX1 fusion gene. The template of the negative control is ddH2O, and the positive control is the positive quality control. Figure 3B Lanes 1 to 30 are 30 cases (RNA) with a clear diagnosis in the control group, including lanes 1 to 10 for 10 cases of acute lymphoblastic leukemia with positive BCR::ABL1 fusion gene, lanes 11 to 20 for 10 cases of acute lymphoblastic leukemia with positive ETV6::RUNX1 fusion gene, and lanes 21 to 30 for 10 cases of acute lymphoblastic leukemia with positive TCF3::PBX1 fusion gene. The template of the negative control is ddH2O, and the positive control is the positive quality control.

[0016] Figure 4 The results of Example 3 are as follows. Figure 4 A is the fluorescence quantitative detection of TCF3::PBX1 fusion gene copy number at the early stage of treatment. Figure 4 B is the fluorescence quantitative detection of TCF3::PBX1 fusion gene copy number in the middle stage of treatment. Figure 4 C is the fluorescence quantitative detection of TCF3::PBX1 fusion gene copy number at the end of treatment.

[0017] Figure 5 They are respectively the bone marrow smear results, flow cytometry results, and chromosome karyotype analysis results of the leukemia case after treatment in Example 3 of the present application. DETAILED DESCRIPTION

[0018] In order to more clearly illustrate the technical solutions of the embodiments of this specification, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some examples or embodiments of this specification. For ordinary technicians in this field, this specification can also be applied to other similar scenarios based on these drawings without creative work. Unless it is obvious from the language environment or otherwise explained, the same reference numerals in the figures represent the same structure or operation.

[0019] As shown in this specification and claims, unless the context clearly indicates an exception, the words "a", "an", "an" and / or "the" do not refer to the singular and may also include the plural. Generally speaking, the terms "comprise" and "include" only indicate the inclusion of the steps and elements that have been clearly identified, and these steps and elements do not constitute an exclusive list. The method or device may also include other steps or elements.

[0020] Flowcharts are used in this specification to illustrate the operations performed by the system according to the embodiments of this specification. It should be understood that the preceding or following operations are not necessarily performed precisely in order. Instead, the steps may be processed in reverse order or simultaneously. At the same time, other operations may also be added to these processes, or one or more operations may be removed from these processes.

[0021] The present application provides the use of SSBP2-FLT3 fusion gene as a detection target in the preparation of a product for detecting human leukemia.

[0022] In some embodiments, the SSBP2-FLT3 fusion gene is formed by the fusion of exons 1 to 8 of the SSBP2 gene and exons 14 to 24 of the FLT3 gene.

[0023] In some embodiments, the SSBP2-FLT3 fusion gene is formed by breakage and recombination between intron 8 of the SSBP2 gene on chromosome 5 and intron 13 of the FLT3 gene on chromosome 13 of the hg19 reference genome.

[0024] In some embodiments, the starting sequence of intron 8 of the SSBP2 gene is located at genomic coordinates chr5:80,767,603.

[0025] In some embodiments, the starting sequence of intron 13 of the FLT3 gene is located at genomic coordinates chr13:28,608,375.

[0026] In some embodiments, the SSBP2-FLT3 fusion gene may comprise a DNA sequence or an RNA sequence as shown in SEQ ID NO: 5. In some embodiments, the cDNA sequence corresponding to the RNA sequence may be as shown in SEQ ID NO: 6.

[0027] In some embodiments, the leukemia can be acute lymphoblastic leukemia.

[0028] The present application also provides the use of the substance for detecting the SSBP2-FLT3 fusion gene in the above-mentioned use in the preparation of a product for detecting human leukemia.

[0029] In some embodiments, the leukemia can be acute lymphoblastic leukemia.

[0030] In some embodiments, the substance for detecting the SSBP2-FLT3 fusion gene may include at least one of a primer pair, a probe or an antibody. In some embodiments, preferably, the substance for detecting the SSBP2-FLT3 fusion gene may be a primer pair. In some embodiments, more preferably, the primer pair may be selected from any one of the following primer pairs: a first primer pair: an upstream primer including a nucleotide sequence such as that shown in SEQ ID NO.1 and a downstream primer including a nucleotide sequence such as that shown in SEQ ID NO.2; a second primer pair: an upstream primer including a nucleotide sequence such as that shown in SEQ ID NO.3 and a downstream primer including a nucleotide sequence such as that shown in SEQ ID NO.4; a third primer pair: an upstream primer including a nucleotide sequence such as that shown in SEQ ID NO.7 and a downstream primer including a nucleotide sequence such as that shown in SEQ ID NO.8.

[0031] In some embodiments, further preferably, the second primer pair can be used to detect the RNA sequence of the SSBP2-FLT3 fusion gene, and the first primer pair and the third primer pair can be used to detect the DNA sequence of the SSBP2-FLT3 fusion gene.

[0032] The present application also provides a diagnostic product for detecting human leukemia, wherein the diagnostic product comprises a substance for detecting the SSBP2-FLT3 fusion gene.

[0033] In some embodiments, the diagnostic product can be any one of a kit, a chip, a membrane strip, a protein array, a composition or a detection system.

[0034] The term "kit" refers to a packaged collection of related components, such as one or more polynucleotides or compositions, and one or more related materials, such as a delivery device (e.g., a syringe), solvents, solutions, buffers, instructions, or desiccant.

[0035] The term "membrane strip" refers to a diagnostic tool that utilizes the principle of specific biomolecule recognition, fixes biomolecules such as antigens or antibodies on the membrane, specifically binds to the substances to be tested in the sample, and qualitatively or quantitatively analyzes the target substances in the sample through visualization or other signal detection methods.

[0036] The term "chip" generally refers to a microdevice that integrates biosensors and microfluidic technologies, which can perform a variety of operations such as sample preparation, reaction, and detection in biological, chemical, and medical analysis processes at the microscopic level to achieve rapid and accurate detection of disease-related biomarkers.

[0037] Protein array, also known as protein microarray, is a high-throughput biotechnology tool that allows the analysis and study of a large number of proteins at the same time. This technology allows rapid protein expression analysis, protein-protein interaction, protein-small molecule binding studies, etc. by orderly arranging thousands of different protein or protein interaction probes on a solid surface.

[0038] In some embodiments, preferably, the diagnostic product can be a kit. In some embodiments, more preferably, the kit can also include any one or more of a DNA polymerase, a deoxynucleotide mixture, a buffer solution, a positive control or a negative control.

[0039] In some embodiments, the leukemia can be acute lymphoblastic leukemia.

[0040] In some embodiments, the substance for detecting SSBP2-FLT3 fusion gene may include at least one of a primer pair, a probe or an antibody.

[0041] The term "primer" as used herein refers to a naturally occurring oligonucleotide (e.g., a restriction fragment) or a synthetically produced oligonucleotide that is capable of serving as a starting point for the synthesis of a primer extension product that is complementary to a nucleic acid strand (a template or target sequence) when placed under appropriate conditions (e.g., buffer, salt, temperature, and pH) and in the presence of nucleotides and reagents for nucleic acid polymerization (e.g., a DNA-dependent or RNA-dependent polymerase). Typically, a set of primers will consist of at least two primers, an "upstream primer" and a "downstream primer" that together define an amplicon (a sequence to be amplified using the primers).

[0042] The detection primer pair of the present application follows the primer design principle, which is specifically embodied in that: the length of the upstream primer or the downstream primer is 15 to 25 bp; specifically, it can be 15 to 18 bp, 18 to 20 bp, or 20 to 25 bp, etc. The GC content of the upstream primer or the downstream primer is between 40 and 60%; specifically, it can be 40 to 50%, 50 to 55%, or 55 to 60%, etc. The annealing temperature of the upstream primer or the downstream primer is 70 to 75°C; specifically, it can be 70 to 72°C, 72 to 74°C, or 74 to 75°C, etc. In a preferred embodiment of the present application, the annealing temperature of the upstream primer or the downstream primer is close to 72°C. There should be no complementary sequences between the primers themselves and between the primers, and the amplified band is single and specific.

[0043] The term "probe" refers to any molecule capable of selectively binding to a target biomolecule (eg, a nucleic acid sequence to which the probe hybridizes).

[0044] In some embodiments, the probe can be labeled, for example, with a fluorescent group and a quencher group. In some embodiments, the probe can be a Taqman probe with a fluorescent reporter group added to the 5' end and a fluorescent quencher group added to the 3' end.

[0045] Antibodies are proteins with protective effects produced by the body due to antigen stimulation. In some embodiments, antibodies can be used as detection reagents to detect gene expression.

[0046] In some embodiments, preferably, the substance for detecting SSBP2-FLT3 fusion gene can be a primer pair. In some embodiments, more preferably, the primer pair is selected from any one of the following primer pairs: a first primer pair: comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2; a second primer pair: comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; a third primer pair: comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8.

[0047] The present application also provides a method for detecting the SSBP2-FLT3 fusion gene for non-diagnostic purposes, wherein the method uses the above-mentioned diagnostic product to detect whether the SSBP2-FLT3 fusion gene exists in a sample from a subject.

[0048] In some embodiments, the non-diagnostic purpose may be a statistical purpose.

[0049] The term "sample" refers to any composition containing nucleic acid isolated from a subject. In some embodiments, the sample can be selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, semen, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swab, oral swab, nasal swab or lavage. In some embodiments, preferably, the sample can be blood or bone marrow.

[0050] In some embodiments, the method may include the following steps: (1) extracting genomic DNA or RNA from the peripheral blood or bone marrow sample to be tested; (2) using the aforementioned detection primers to perform polymerase chain reaction to obtain an amplified product; (3) performing agarose gel electrophoresis on the amplified product, and judging the situation of the SSBP2-FLT3 fusion gene in the sample to be tested based on the electrophoresis band results. Specifically, when a band of 371bp or 400bp appears in the electrophoresis gel image, it indicates that the sample to be tested contains the SSBP2-FLT3 fusion gene; when there is no band of 371bp or 400bp in the electrophoresis gel image, it indicates that the sample to be tested does not contain the SSBP2-FLT3 fusion gene.

[0051] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0052] Example 1

[0053] The diagnosis of ALL should adopt the MICM (cytomorphology, immunology, cytogenetics and molecular genetics) diagnostic model. Basic examinations include cell morphology and immunophenotype to ensure differentiation from acute myeloid leukemia (AML). The ratio of primitive / immature lymphocytes in the bone marrow must be ≥20% to diagnose ALL. This application uses high-throughput sequencing technology to identify a case of bone marrow cell morphology, flow cytometry and genetics that meets the characteristics of acute lymphoblastic leukemia ( Figure 1 ) and detected the SSBP2::FLT3 fusion gene in the lesion cells. This fusion gene can be used as a new leukemia classification target.

[0054] 1. DNA Extraction

[0055] The extraction was performed strictly according to the instructions of TIANamp Blood DNA kit (cat: DP348-03).

[0056] 1. Take a 1.5ml centrifuge tube, add 200μl sample, 20μl proteinase K, and 200μl GB, and shake to mix;

[0057] 2. Pyrolysis in a metal bath at 56°C for 15 min, inverting and mixing every 5 min;

[0058] 3. Cool for 5 minutes after heating; 4. Add 350 μl BD and shake to mix;

[0059] 5. Transfer to the adsorption column twice, centrifuge at 12000rpm for 1min, and discard the waste liquid;

[0060] 6. Add 500 μl GDB, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;

[0061] 7. Add 500 μl PWB, centrifuge at 12000 rpm for 1 min, and discard the waste liquid; repeat the wash once and discard the waste liquid;

[0062] 8. Transfer the adsorption column to a new 2 ml collection tube and centrifuge at 12000 rpm for 2 min;

[0063] 9. Add 55 μl TB elution buffer, let stand for 5 min, centrifuge at 12000 rpm for 2 min, measure the concentration and purity of the collected nucleic acid extract, and store at -80°C for later use.

[0064] 2. RNA Extraction and Reverse Transcription

[0065] 1. Add about 750μl of 1× red blood cell lysis buffer H and 500μl of whole blood or bone marrow sample to a 1.5ml Eppendorf tube, mix thoroughly and incubate in a refrigerator at 2℃~8℃ for 5-10 minutes. Vortex once during the incubation process. Centrifuge at 2,100-3,500rpm for 2-3min and completely remove the supernatant.

[0066] 2. Add 1× red blood cell lysis buffer H to the white blood cell pellet (the volume of 1× red blood cell lysis buffer added is 750μl-1000μl), shake and mix, and resuspend the cells. Centrifuge at 2,100-3,500rpm for 2-3min and completely remove the supernatant.

[0067] 3. Add 350μl-500μl of RLH lysis buffer (adjust according to the number of white blood cells) to the leukocyte pellet and vortex or use a pipette to mix.

[0068] 4. Transfer the solution to the filter column CS (the filter column CS is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 2 min, discard the filter column CS, and collect the filtrate.

[0069] 5. Add 1 volume of 70% ethanol to the filtrate and mix well (precipitate may appear at this time). Transfer the obtained solution and precipitate into the adsorption column CR2 (the adsorption column CR2 is placed in the collection tube). Centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR2 back into the collection tube.

[0070] 6. Add 350 μl of deproteinization solution RW1H to the adsorption column CR2, centrifuge at 12,000 rpm (~13,400 × g) for 30-60 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR2 back into the collection tube. Add 80 μl of DNase I working solution to the center of the adsorption column CR2 and leave it at room temperature for 15 minutes.

[0071] 7. Add 350 μl of deproteinized solution RW1H to the adsorption column CR2, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, pour out the waste liquid in the collection tube, and put the adsorption column CR2 back into the collection tube.

[0072] 8. Add 500 μl of rinse solution RW to the adsorption column CR2 (make sure that RW has been added with anhydrous ethanol as indicated on the reagent bottle label), let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR2 back into the collection tube. Centrifuge at 12,000 rpm (~13,400×g) for 2 minutes and pour out the waste liquid. Leave the adsorption column CR2 at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.

[0073] 9. Transfer the adsorption column CR2 into a new RNase-Free centrifuge tube, add 30-50 μl RNase-Free ddH 2O and let stand at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to obtain RNA solution.

[0074] 10. Reverse transcription to obtain cDNA template.

[0075] TTGAGAACTCAGCACCCAGATAATATGACTTAGACCTACATACAATAATATATGTTGTATTGTATGTTTGTATTGTATATATGCATTGTTTCTAACCAACATATAACTATGTATATTGACTATATTGAAACAAGGGGTTCATTTAGCCAGACTTTTTGGAGATGCCATATTATAGGAAAAAAAAAACCCATATAAATACAGTTCCAAGGAAAGAGGAACAAATGGTGTCTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAG (DNA sequence of SSBP2::FLT3 fusion gene: SEQ ID NO: 5).

[0076] TCCTGTACCACCAGGGTTCTTTCAGCCTTTTATGTCACCTCGGTACCCTGGAGGTCCAAGGCCCCCATTGAGGATACCTAATCAGGCACTTGGAGGTGTCCCAGGAAGTCAGCCATTACTCCCCAGTGGAATGGATCCAACTCGACAACAAGGACATCCAAATATGGGTGGGCCAATGCAGAGAATGACTCCTCCAAGAGGAATGGTGCCCTTAGGACCACAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCA (cDNA sequence corresponding to the RNA sequence of SSBP2::FLT3 fusion gene: SEQ ID NO: 6).

[0077] III. PCR Amplification

[0078] The PCR amplification primers are shown in Table 1:

[0079] Table 1 Primer Sequences

[0080] Primer name sequence Sequence Listing Number DNA:SSBP2::FLT3-F1 TTGAGAACTCAGCACCCAGA SEQ ID NO: 1 DNA:SSBP2::FLT3-R1 CTCTTGGAAACTCCCATTTGA SEQ ID NO: 2 RNA:SSBP2::FLT3-F2 TCCTGTACCACCAGGGTTCT SEQ ID NO: 3 RNA:SSBP2::FLT3-R2 TGCGTTCATCACTTTTCCAA SEQ ID NO: 4

[0081] The DNA PCR reaction system includes: 10 μl GoTaq Colorless Master Mix, 1 μl DNA:SSBP2::FLT3-F1 primer (10 μM), 1 μl DNA:SSBP2::FLT3-R1 primer (10 μM), 100 ng DNA template, and sterile deionized water added to 20 μl.

[0082] The PCR reaction system for RNA includes: 10 μl GoTaq Colorless Master Mix, 1 μl RNA:SSBP2::FLT3-F2 primer (10 μM l), 1 μl cDNA:SSBP2::FLT3-R2 primer (10 μM), 100 ng cDNA template, and sterile deionized water added to 20 μl.

[0083] The PCR amplification conditions for DNA and cDNA were denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min, and finally extension at 72°C for 10 min. The PCR products were electrophoresed with 2% agarose at 100 V, and the results were observed and sequenced.

[0084] Results: After PCR with primers, a single specific electrophoresis band was observed. The amplified product was sequenced to obtain the SSBP2::FLT3 fusion gene sequence ( Figure 2 ), demonstrating that the designed primer combination was reliable and sensitive.

[0085] Example 2

[0086] Thirty cases of the control group with clear diagnosis were tested, including 10 cases of acute lymphoblastic leukemia with positive BCR::ABL1 fusion gene, 10 cases of acute lymphoblastic leukemia with positive ETV6::RUNX1 fusion gene, and 10 cases of acute lymphoblastic leukemia with positive TCF3::PBX1 fusion gene. Theoretically, there was no SSBP2::FLT3 gene fusion in any of them. The primer combination of the present application was used for detection, and the nucleic acid extraction and PCR amplification methods were the same as in Example 1.

[0087] Results: Figure 3 , the SSBP2::FLT3 fusion gene was not detected using the primer combination designed by the present invention, which proves that the DNA and RNA primers designed in this project have high specificity and can distinguish other leukemia types.

[0088] Example 3

[0089] MRD quantitative monitoring was performed on a patient with ALL carrying the SSBP2::FLT3 fusion gene. Specific primers and probes were designed: MRD-F: CAACTCGACAACAAGGACAT (SEQ ID NO: 7); MRD-R: TATGAAAGCCAG CTACAGATG (SEQ ID NO: 8); probe: ATGGGTGGGCCAATGCAGAGAATG (SEQ ID NO: 9). The reaction system was: 10μl Taqman Gene Master Mix, 1μl MRD-F (5μM), 1μl MRD-R (5μM), 1μl Probe (2.5μM), 5μl cDNA, 2μl ddH2O, and the total volume was 20μl. The amplification conditions were denaturation at 50℃ for 2min, followed by 95℃ for 10min, 95℃ for 15s, and 60℃ for 1min, for a total of 40 cycles. The results showed that the copy number of the fusion gene in the patient gradually decreased to negative in the early, middle, and late stages of treatment (see Figure 4 ), indicating that the primer-probe combination has high specificity and can monitor the SSBP2::FLT3 fusion gene in real time.

[0090] In summary, this application discloses a new fusion gene SSBP2::FLT3 for the first time, expanding the types of acute lymphoblastic leukemia fusion genes. The detection primer pair of this application is a supplement to the original acute lymphoblastic leukemia fusion gene primers, expanding the types of acute lymphoblastic leukemia fusion genes and increasing the detection rate of the PCR method for diagnosing the tumor.

[0091] The basic concepts have been described above. Obviously, for those skilled in the art, the above detailed disclosure is only for example and does not constitute a limitation of this specification. Although not explicitly stated here, those skilled in the art may make various modifications, improvements and corrections to this specification. Such modifications, improvements and corrections are suggested in this specification, so such modifications, improvements and corrections still belong to the spirit and scope of the exemplary embodiments of this specification.

[0092] At the same time, this specification uses specific words to describe the embodiments of this specification. For example, "one embodiment", "an embodiment", and / or "some embodiments" refer to a certain feature, structure or characteristic related to at least one embodiment of this specification. Therefore, it should be emphasized and noted that "one embodiment" or "an embodiment" or "an alternative embodiment" mentioned twice or more in different positions in this specification does not necessarily refer to the same embodiment. In addition, certain features, structures or characteristics in one or more embodiments of this specification can be appropriately combined.

[0093] In some embodiments, numbers describing the number of components and attributes are used. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise specified, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may change according to the required features of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining digits. Although the numerical domains and parameters used to confirm the breadth of their range in some embodiments of this specification are approximate values, in specific embodiments, the setting of such numerical values ​​is as accurate as possible within the feasible range.

[0094] Finally, it should be understood that the embodiments described in this specification are only used to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, as an example and not a limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly introduced and described in this specification.

Claims

1. Use of SSBP2-FLT3 fusion gene as a detection target in the preparation of products for detecting human leukemia.

2. The use according to claim 1, characterized in that The SSBP2-FLT3 fusion gene is formed by the fusion of exons 1 to 8 of the SSBP2 gene and exons 14 to 24 of the FLT3 gene.

3. The use according to claim 1, characterized in that The SSBP2-FLT3 fusion gene is formed by the breakage and recombination between intron 8 of the SSBP2 gene on chromosome 5 of the hg19 reference genome and intron 13 of the FLT3 gene on chromosome 13.

4. The use according to claim 1, characterized in that The starting sequence of intron 8 of the SSBP2 gene is located at genomic coordinates chr5:80,767,603; and / or, the starting sequence of intron 13 of the FLT3 gene is located at the genomic coordinate chr13:28,608,375; and / or, the SSBP2-FLT3 fusion gene comprises the DNA sequence or RNA sequence shown in SEQ ID NO:5, The cDNA sequence corresponding to the RNA sequence is shown in SEQ ID NO: 6; And / or, the leukemia is acute lymphoblastic leukemia.

5. Use of the substance for detecting the SSBP2-FLT3 fusion gene in any one of claims 1 to 4 in the preparation of a product for detecting human leukemia.

6. The use according to claim 5, characterized in that The leukemia is acute lymphoblastic leukemia; And / or, the substance for detecting SSBP2-FLT3 fusion gene includes at least one of a primer pair, a probe or an antibody. Preferably, the substance for detecting SSBP2-FLT3 fusion gene is a primer pair. More preferably, the primer pair is selected from any one of the following primer pairs: The first primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2; The second primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; The third primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8; Further preferably, the second primer pair is used to detect the RNA sequence of the SSBP2-FLT3 fusion gene, and the first primer pair and the third primer pair are used to detect the DNA sequence of the SSBP2-FLT3 fusion gene.

7. A diagnostic product for detecting human leukemia, characterized in that: The diagnostic product includes a substance for detecting the SSBP2-FLT3 fusion gene.

8. The diagnostic product according to claim 7, characterized in that The diagnostic product is any one of a kit, a chip, a membrane strip, a protein array, a composition or a detection system. Preferably, the diagnostic product is a kit. More preferably, the kit further comprises any one or more of a DNA polymerase, a deoxynucleotide mixture, a buffer solution, a positive control or a negative control. And / or, the leukemia is acute lymphoblastic leukemia; And / or, the substance for detecting SSBP2-FLT3 fusion gene includes at least one of a primer pair, a probe or an antibody. Preferably, the substance for detecting SSBP2-FLT3 fusion gene is a primer pair. More preferably, the primer pair is selected from any one of the following primer pairs: The first primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2; The second primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; The third primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.

8.

9. A method for detecting SSBP2-FLT3 fusion gene for non-diagnostic purposes, characterized in that: The method utilizes the diagnostic product of claim 7 or 8 to detect the presence of the SSBP2-FLT3 fusion gene in a sample from a subject.

10. The method according to claim 9, characterized in that The sample is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, semen, cerebrospinal fluid, peritoneal fluid, pleural fluid, stool, lymph, skin swab, oral swab, nasal swab or lavage; Preferably, the sample is blood or bone marrow.

Images