SSR (Simple Sequence Repeat) core primer combination and kit for identifying tea tree variety 'swan goose 12' and application of SSR core primer combination and kit

Abstract

The invention discloses an SSR (Simple Sequence Repeat) core primer combination and a kit for identifying a tea tree variety 'swan gooses 12' and application of the SSR core primer combination and the kit. According to the invention, three pairs of SSR core primers are screened by using an SSR fluorescence labeling detection technology, and the three pairs of SSR core primers can rapidly identify and detect the 'Yangou 12' from other tea tree varieties. The SSR core primer combination disclosed by the invention can be used for identifying the variety of the swan goose 12, the uncertainty of identification based on external morphological characteristics is overcome, the result is reliable and visual, the detection efficiency is high, the operation is simple and convenient, and meanwhile, the popularization, utilization and protection of the variety of the swan goose 12 are also facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of variety resource identification and germplasm innovation, and in particular to an SSR core primer combination, a kit and an application thereof for identifying the tea variety "Hongyan No. 12". Background Art

[0002] "Hongyan No. 12" was bred by the Tea Research Institute of Guangdong Academy of Agricultural Sciences from the natural hybrid offspring of Tieguanyin in 1990-2003 using the single plant breeding method. It was identified as a national variety by the National Tea Variety Identification Committee in 2010. "Hongyan No. 12" is an asexual shrub-type medium-leaf early-maturing black tea variety with tall plants, spreading trees and dense branches. The leaves are slightly oblique, oblong, dark green, slightly raised, flat, with wavy edges, gradually pointed tips, dense and shallow leaf teeth, and relatively hard and brittle leaves. The corolla diameter is 3.0-3.3cm, the petals are white with 6-8 petals, the ovary is medium, the style is 3-lobed, and the fruit is medium. This variety is suitable for making green tea and oolong tea, and has excellent quality. The processed oolong tea has a strong, long-lasting floral aroma, a rich, refreshing and smooth taste, a bright yellow-green soup color, and tender and even leaves; the processed green tea has a green appearance, a long-lasting floral aroma, a rich, mellow and refreshing taste, and a bright green soup color and leaves.

[0003] Currently, the identification of the tea variety "Hongyan No. 12" is based on the identifier's personal understanding of "Hongyan No. 12" and its external morphological characteristics. The identification result is easily affected by factors such as the developmental stage, cultivation measures, the identifier's personal ability, and the growth environment of "Hongyan No. 12", and there is great uncertainty.

[0004] Molecular marker technology has become the future development direction of variety identification and protection due to its high polymorphism, short testing cycle, and no environmental influence. Therefore, SSR molecular markers have good application prospects in variety-specific evaluation and protection. Summary of the invention

[0005] In order to overcome the above-mentioned defects and shortcomings in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea variety "Hongyan No. 12".

[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea variety "Hongyan No. 12".

[0007] The second object of the present invention is to provide the use of the above-mentioned SSR core primer combination in the preparation of an identification product of the tea variety "Hongyan No. 12".

[0008] The third object of the present invention is to provide a product comprising the above-mentioned SSR core primer combination for use in identifying the tea variety "Hongyan No. 12".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea variety "Hongyan No. 12".

[0010] A fifth object of the present invention is to provide a method for identifying the tea variety "Hongyan No. 12".

[0011] To achieve the above-mentioned purpose, the present invention provides an SSR core primer combination for identifying the tea variety "Hongyan No. 12", wherein the SSR core primer combination comprises SSR core primers represented by nucleotide sequences HY12.SSR-1-F, HY12.SSR-1-R, HY12.SSR-2-F, HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R; wherein: the primer sequence of HY12.SSR-1-F is: TCGCACTCAAGTCGTACTCG; the primer sequence of HY12.SSR-1- The primer sequence of R: ATGTCGGTCACAACCACTCG; the primer sequence of HY12.SSR-2-F: CTCCCTATCCATCCCCAGCT; the primer sequence of HY12.SSR-2-R: CAACTTGGGCGTTGGAATCC; the primer sequence of HY12.SSR-3-F: TGCCGTCGTTGAATGCAATT; the primer sequence of HY12.SSR-3-R: CGTTTAGCAGCACAAGGAAT.

[0012] The 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-3-F is labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0014] Use of any of the above-mentioned SSR core primer combinations in the preparation of an identification product for the tea variety "Hongyan No. 12".

[0015] Application of a product comprising any of the above-mentioned SSR core primer combinations in identifying the tea variety "Hongyan No. 12".

[0016] A kit for identifying the tea variety "Hongyan No. 12", comprising any of the above-mentioned SSR core primer combinations.

[0017] The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

[0018] A method for identifying the tea variety "Hongyan No. 12" is provided, using any of the above-mentioned SSR core primer combinations or kits for identification.

[0019] The method comprises the following steps: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using any of the above-mentioned SSR core primer combinations; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers shown by the nucleotide sequences HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195bp and 198bp, the SSR core primers shown by the nucleotide sequences HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171bp and 173bp, and the SSR core primers shown by the nucleotide sequences HY12.SSR-3-F and HY12.SSR-3-R amplified only one characteristic band of 184bp, indicating that the tea tree sample to be tested is "Hongyan No. 12"; the appearance of other bands indicates that the tea tree sample to be tested is not "Hongyan No. 12".

[0020] The typing method described in step S3 is to perform capillary electrophoresis on the PCR amplification product; wherein the PCR amplification, the total reaction system is 10μL, including: 10×Buffer I 1μL, 2.5 mMdNTPs 0.8μL, 2.5μM upstream primer 0.6μL, 2.5μM downstream primer 0.6μL, TAKARA HSTaq 0.1μL, DNA 1μL, ddH2O filler 10μL; PCR amplification reaction conditions are: 95℃ pre-denaturation for 5min; 94℃ denaturation for 30s; 60℃ annealing for 30s for 35 cycles; 72℃ extension for 30s; and finally 60℃ extension for 30min.

[0021] Advantages and effects of the present invention: The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea variety "Hongyan No. 12". The present invention utilizes SSR fluorescent marker detection technology to screen and obtain three pairs of SSR core primers, which can quickly identify and detect "Hongyan No. 12" from other tea varieties. The SSR core primer combination disclosed in the present invention can accurately identify the variety of "Hongyan No. 12", overcomes the uncertainty of identification based on external morphological characteristics, and the result is reliable and intuitive, with high detection efficiency and simple operation. It is also conducive to the promotion, utilization and protection of the variety "Hongyan No. 12". BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Capillary electrophoresis bands of 21 tea varieties / lines amplified by the specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R in Example 1.

[0023] Figure 2 Capillary electrophoresis bands of 21 tea varieties / lines amplified by the specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R in Example 1.

[0024] Figure 3 Capillary electrophoresis bands of 21 tea varieties / lines amplified by the specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R in Example 1.

[0025] Figure 4 Capillary electrophoresis bands of 32 tea varieties / lines amplified by the specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R in Example 2.

[0026] Figure 5 Capillary electrophoresis bands of 32 tea varieties / lines amplified by the specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R in Example 2.

[0027] Figure 6 Capillary electrophoresis bands of 32 tea varieties / lines amplified by the specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R in Example 2. DETAILED DESCRIPTION

[0028] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0029] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0030] Example 1 Screening and obtaining of specific primer sequences of "Hongyan 12" 1. Experimental Methods 1. SSR primer design The genome sequence of the tea plant genome database (http: / / tpia.teaplants.cn / ) was searched using MISA software to retrieve the SSR sites in the genome sequence. Primer 5.0 was used to batch design 200 pairs of SSR primers, which were synthesized by Beijing Reader Gene Technology Co., Ltd.

[0031] 2. Extraction of DNA from tea varieties A preliminary screening was conducted using 21 tea varieties / lines with similar genetic and phenotypical characteristics, including “Hongyan 12,” “Hongyan 8,” “Hongyan 10,” “Hongyan 14,” and “Meizhan.” The tea varieties / lines used in the preliminary screening are listed in Table 1 (taken from the Guangdong Tea Germplasm Resource Bank).

[0032] Table 1 21 tea varieties / lines used in the preliminary screening

[0033] DNA was extracted from the 21 tea varieties / lines (Table 1) used in the preliminary screening. The specific steps of DNA extraction were as follows: a) Take tea leaves and add liquid nitrogen to grind them thoroughly, and weigh about 100 mg of the ground powder.

[0034] b) Quickly add 400 μL of GPS buffer and 10 μL of RNase A to the ground powder, vortex quickly to mix, and place the centrifuge tube in a 65°C water bath for 15 min. Invert the centrifuge tube several times to mix the sample during the water bath.

[0035] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12,000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12,000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0036] d) Add an equal volume of anhydrous ethanol and mix thoroughly. Flocculent precipitation may appear at this time.

[0037] e) Transfer the solution and flocculent precipitate obtained in the previous step to RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0038] f) Add 550 μL of deproteinizing solution RD to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0039] g) Add 700 μL of rinse solution PW to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in a collection tube.

[0040] h) Repeat step g.

[0041] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, and then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and dry it at room temperature for 5-10 min.

[0042] j) Add 50-100 μL of elution buffer TB to the RNase-Free adsorption column CR2, place at room temperature for 3-5 minutes, centrifuge at 12000 rpm for 2 minutes, collect the solution into a centrifuge tube, and obtain the tea tree genomic DNA.

[0043] 3. PCR Amplification The tea tree genomic DNA extracted in step 2 is used as a template, and PCR amplification is performed using the SSR fluorescent marker detection technology, wherein the primers include an upstream primer with a fluorescent reporter group (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and the FAM fluorescent marker is used in the present invention) labeled at the 5' end, and a downstream primer. The PCR amplification guided by the upstream primer with a fluorescent reporter group labeled at the 5' end produces a PCR product with fluorescence.

[0044] For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O to make up 10 μL.

[0045] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0046] 4. Typing test Capillary electrophoresis detection: 9 μL of molecular weight internal standard and formamide mixture (volume ratio of 0.5:8.5) and 1.0 μL of PCR product were added to each well of a 96-well plate; denaturation was performed at 95°C for 3 min, and typing was performed using a 3730XL DNA analyzer.

[0047] 5. Data Analysis The raw data files obtained by 3730XL DNA analyzer were imported into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0048] 2. Experimental Results Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely HY12.SSR-1-F, HY12.SSR-1-R, HY12.SSR-2-F, HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R. The primer sequences are shown in Table 2.

[0049] Table 2 Specific SSR core primer sequences

[0050] The statistical results of capillary electrophoresis bands of 21 tea varieties / lines (Table 1) amplified by these three pairs of specific SSR core primers are shown in Tables 3 and Figures 1 to 3 As shown in the figure, the results show that "Hongyan 12" has characteristic stripes, specifically: (1) The specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195 bp and 198 bp respectively; (2) Specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171 bp and 173 bp; (3) The specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R only amplified a characteristic band of 184 bp.

[0051] The above results showed that the three pairs of specific SSR core primers could amplify characteristic bands for the tea variety "Hongyan 12", so "Hongyan 12" could be distinguished from the other 20 related and phenotypically similar tea varieties / lines.

[0052] Table 3 Statistics of capillary electrophoresis bands of 21 tea varieties / lines by three pairs of specific SSR core primers

[0053] Example 2 Further validation of 3 pairs of specific SSR core primers 1. Experimental Methods The three pairs of specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R, HY12.SSR-2-F and HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R for identifying "Hongyan 12" were further verified, and 31 tea varieties currently promoted and used in production were selected for amplification detection simultaneously with "Hongyan 12". The specific details of the 32 tea varieties are shown in Table 4.

[0054] Table 4 32 tea varieties currently being promoted and applied in production

[0055] The extraction method, PCR amplification, typing detection and data analysis method of tea variety DNA are carried out according to Example 1.

[0056] 2. Experimental Results The statistical results of capillary electrophoresis bands of 32 tea varieties (Table 4) amplified by three pairs of specific SSR core primers are shown in Tables 5 and Figures 4 to 6 As shown, the results show that only "Hongyan 12" has characteristic stripes, specifically: (1) The specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195 bp and 198 bp respectively; (2) Specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171 bp and 173 bp; (3) The specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R only amplified a characteristic band of 184 bp.

[0057] The above results indicate that the three pairs of specific SSR core primers can amplify specific alleles for the tea variety "Hongyan No. 12", and therefore can distinguish "Hongyan No. 12" from the other 31 tea varieties currently promoted and applied in production.

[0058] Table 5 Statistics of capillary electrophoresis bands of 32 tea varieties promoted and applied

[0059] Example 3 A method for identifying "Hongyan 12" using specific SSR core primer combination 1. Extract DNA from the tea variety "Hongyan No. 12" according to the method of Example 1; 2. Using the DNA extracted in step 1 as a template, PCR amplification was performed using three pairs of specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R, HY12.SSR-2-F and HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R. The sequences of the three pairs of specific SSR core primers are as follows, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention): HY12.SSR-1-F: TCGCACTCAAGTCGTACTCG; HY12.SSR-1-R:ATGTCGGTCACAACCACTCG; HY12.SSR-2-F: CTCCCTATCCATCCCCAGCT; HY12.SSR-2-R:CAACTTGGGCGTTGGAATCC; HY12.SSR-3-F: TGCCGTCGTTGAATGCAATT; HY12.SSR-3-R:CGTTTAGCAGCACAAGGAAT; 3. PCR amplification method was carried out according to Example 1: The PCR product obtained in step 2 is subjected to typing detection and data analysis, and the typing detection and data analysis methods are both performed in accordance with Example 1.

[0060] 4. Interpretation of results: If the amplification products of the three pairs of specific SSR core primers show the following characteristic bands, it indicates that the tea variety to be tested is "Hongyan No. 12"; if the following characteristic bands do not appear, it indicates that the tea variety to be tested is not "Hongyan No. 12": (1) The specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195 bp and 198 bp respectively; (2) Specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171 bp and 173 bp; (3) The specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R only amplified a characteristic band of 184 bp.

[0061] Example 4

[0062] A kit for identifying the tea variety "Hongyan No. 12" 1. Composition (1) Three pairs of specific SSR core primers, wherein the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and the HEX fluorescent label is used in the present invention): HY12.SSR-1-F: TCGCACTCAAGTCGTACTCG; HY12.SSR-1-R:ATGTCGGTCACAACCACTCG; HY12.SSR-2-F: CTCCCTATCCATCCCCAGCT; HY12.SSR-2-R:CAACTTGGGCGTTGGAATCC; HY12.SSR-3-F: TGCCGTCGTTGAATGCAATT; HY12.SSR-3-R:CGTTTAGCAGCACAAGGAAT; (2) HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.

[0063] 2. Usage The detection and result interpretation were performed according to the method of Example 3.

[0064] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An SSR core primer combination for identifying the tea variety "Hongyan No. 12", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences HY12.SSR-1-F, HY12.SSR-1-R, HY12.SSR-2-F, HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R; wherein: the primer sequence of HY12.SSR-1-F is TCGCACTCAAGTCGTACTCG; the primer sequence of HY12.SSR-1-R is ATGTCGGTCACAACCACTCG; the primer sequence of HY12.SSR-2-F is CTCCCTATCCATCCCCAGCT; the primer sequence of HY12.SSR-2-R is CAACTTGGGCGTTGGAATCC; the primer sequence of HY12.SSR-3-F is TGCCGTCGTTGAATGCAATT; the primer sequence of HY12.SSR-3-R is CGTTTAGCAGCACAAGGAAT.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-3-F is labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety "Hongyan No. 12".

5. Use of a product comprising the SSR core primer combination described in any one of claims 1 to 3 in identifying the tea variety "Hongyan No. 12".

6. A kit for identifying the tea variety "Hongyan No. 12", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

8. A method for identifying the tea variety "Hongyan No. 12", characterized in that: The identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7.

9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, using the SSR core primer set described in any one of claims 1 to 3 Combined with PCR amplification; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers represented by the nucleotide sequences HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195bp and 198bp, the SSR core primers represented by the nucleotide sequences HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171bp and 173bp, and the SSR core primers represented by the nucleotide sequences HY12.SSR-3-F and HY12.SSR-3-R amplified only one characteristic band of 184bp, indicating that the tea tree sample to be tested is "Hongyan No. 12"; the appearance of other bands indicates that the tea tree sample to be tested is not "Hongyan No. 12".

10. The method according to claim 9, characterized in that The typing method in step S3 is to perform capillary electrophoresis on the PCR amplification product; For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O 10 μL; the PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

Images