Genetically modifying animal fibers of animal origin

Abstract

Non-human animals having novel fibers and methods of making the same are provided. Specifically, the present invention provides: a non-human animal in which the expression or function of one or more genes constituting the Krt or KAP family is reduced; and a method for producing the non-human animal.

Description

Technical Field

[0001] The present invention relates to a method for preparing an animal, the animal and animal fiber obtained by the method, and a fiber product containing the animal fiber. Background Art

[0002] The quality of animal fibers such as wool and cashmere is determined by factors such as fiber diameter, fiber length, and color. Among them, the fineness of the fiber diameter is directly related to the feel, wearing feel, gloss, warmth retention, and elasticity of woven fabrics, knitted fabrics, and other products, and is therefore an extremely important factor affecting the quality of the final product. Until now, fine animal fibers have been produced by using specific high-quality varieties, but even with high-quality varieties, fine animal fibers are only a very small part of the entire body hair, and the scarcity increases with fineness. Therefore, the price is easily fluctuated due to a slight increase or decrease in the amount of hair produced, resulting in unstable supply.

[0003] In addition, animal fibers have a scale structure with uneven surfaces on the fiber surface. The friction between the scales causes the fibers to entangle with each other, which causes the formation of pilling and the deterioration of gloss, softness, smoothness, etc. In order to avoid such deterioration, a treatment has been developed in the past to remove the scales by chemical methods or to cover the unevenness of the scales with a coating resin to make the fiber surface smooth. However, although this method can prevent the fibers from entangled with each other, it tends to avoid being applied to animal fibers, especially to rare animal fibers with thin fiber diameters, because it damages the original quality of the animal fibers.

[0004] In view of the above circumstances, a technology capable of stably supplying animal fibers having a fine fiber diameter and / or maintaining the quality thereof has been desired.

[0005] Prior art literature

[0006] Patent Literature

[0007] Patent Document 1: Japanese Patent Application Laid-Open No. 2006-283254

[0008] Patent Document 2: Japanese Patent Application Laid-Open No. 2006-132059 Summary of the invention

[0009] The present invention relates to a method for producing a non-human animal, the animal and animal fiber obtained by the method, and a fiber product containing the animal fiber.

[0010] The present inventors have conducted intensive research to solve the above problems and have found that the diameter of animal fibers becomes thinner by reducing the expression or function of genes constituting the Krt or Kap family, and that animal fibers with thin fiber diameters can be obtained from non-human animals having such reduced expression or function. In addition, the present inventors have found that animal fibers with smooth fiber surfaces can be obtained from the animals and have completed the invention.

[0011] That is, the present invention relates to the following aspects.

[0012] [1] A genetically modified animal or animal fiber thereof, which is an animal (preferably a mammal, more preferably an even-toed ungulate) or an animal fiber thereof having undergone genetic modification, wherein the animal has animal fiber, and the genetic modification is a reduction or deletion of the expression or function of one or more genes constituting the Krt or KAP family, or a destruction of the one or more genes.

[0013] [2] A genetically modified animal or animal fiber thereof, which is the genetically modified animal or animal fiber described in [1] above, wherein:

[0014] (i) animal fibers from animals having the genetic modification described above have a smaller major diameter (e.g., 5-50% or 5-25% smaller major diameter) compared to animal fibers from an isogenic or allogenic control animal not having the genetic modification described above, and / or

[0015] (ii-1) the content of the protein encoded by the one or more genes in the animal fiber of the animal with the above-mentioned genetic modification is lower than that of the animal fiber of the same species or allogeneic control animal without the above-mentioned genetic modification, or (ii-2) the animal fiber of the animal with the above-mentioned genetic modification does not contain the protein encoded by the one or more genes.

[0016] [3] A genetically modified animal or animal fiber thereof, which is a genetically modified animal or animal fiber thereof as described in [1] or [2] above, wherein the animal fiber of the genetically modified animal has a major diameter that is smaller by 5% or more, 10% or more, or 15% or more than that of the animal fiber of the animal not having the genetic modification.

[0017] [4] A genetically modified animal or animal fiber thereof, which is a genetically modified animal or animal fiber thereof as described in any one of [1] to [3] above, wherein one or more genes constituting the Krt or KAP family include any one or both of Kap8-1 and Kap8-2.

[0018] [5] A genetically modified animal or animal fiber according to any one of [1] to [3] above, wherein the one or more genes constituting the Krt or KAP family include at least one gene selected from Krt71, Krt72, Krt73 and Krt74.

[0019] [6] A genetically modified animal or animal fiber thereof according to any one of [1] to [5] above, wherein the genetic modification further comprises a reduction or deletion of the expression or function of one or both of the FGF-5 gene and the Tyr gene, or the destruction of the gene.

[0020] [7] An animal fiber, which is the animal fiber according to any one of [1] to [6] above.

[0021] [8] A cloth, woven fabric or fiber product comprising the animal fiber described in [7] above.

[0022] [9] The genetically modified animal or animal fiber according to any of the above items, wherein the non-human animal is a mammal or a bird.

[0023]

[10] The genetically modified animal or animal fiber according to the above [9], wherein the mammal is a mouse, rat, rabbit, goat, sheep, alpaca, llama, camel, yak, ibex, guanaco, musk ox, Tibetan antelope, raccoon dog, raccoon, mink, sable, fox, possum, opossum, beaver, seal, nutria, ferret or llama, or a mammal obtained by hybridization of any of these mammals, and the bird is a wild duck, goose, domestic duck or ostrich, or a bird obtained by hybridization of any of these birds.

[0024]

[11] The genetically modified animal or animal fiber thereof (preferably the animal fiber is underfur or undercoat) according to the above

[10] , wherein the goat is a goat selected from the group consisting of cashmere goats, mohair goats, angora goats and cashmere goats (preferably cashmere goats).

[0025]

[12] A genetically modified animal or animal fiber according to any of the above items, wherein the animal fiber has scales with larger spacing (e.g., 5% to 10% larger) compared to animal fibers of the same species or different species of control animals that do not have the above genetic modification.

[0026]

[13] A genetically modified animal or animal fiber according to any of the above items, wherein the animal fiber has thinner scales (e.g., 5 to 20% thinner) than animal fibers of a control animal of the same species or different species that do not have the above genetic modification.

[0027]

[14] The genetically modified animal or animal fiber according to the above

[12] , wherein the animal fiber has thinner scales (for example, 5 to 20% thinner) than animal fibers of the same species or different species control animals that do not have the above genetic modification.

[0028]

[15] The genetically modified animal or animal fiber according to any of the above items, which is more lustrous than animal fibers from a control animal of the same species or allogeneic species that does not have the above genetic modification.

[0029]

[16] The genetically modified animal or animal fiber according to the above [2], wherein the animal fiber has larger spacing between scales (for example, 5% to 10% larger) compared to animal fibers of the same species or different species control animals that do not have the above genetic modification.

[0030]

[17] The genetically modified animal or animal fiber according to the above [2], wherein the animal fiber has thinner scales (for example, 5 to 20% thinner) than the animal fiber of a control animal of the same species or different species that does not have the above genetic modification.

[0031]

[18] The genetically modified animal or animal fiber according to the above

[16] , wherein the animal fiber has thinner scales (for example, 5 to 20% thinner) than the animal fiber of a control animal of the same species or different species that does not have the above genetic modification.

[0032]

[19] A material for obtaining any of the genetically modified animals described above, comprising a genetically modified animal or its reproductive cells (e.g., sperm or egg) having been genetically modified, wherein the genetic modification is a reduction or deletion of the expression or function of one or more genes constituting the Krt or KAP family, or the destruction of one or more of the genes.

[0033]

[20] The material according to

[19] above, wherein the one or more genes constituting the Krt or KAP family include any one or both of Kap8-1 and Kap8-2.

[0034]

[21] The material according to the above

[19] , wherein the one or more genes constituting the Krt or KAP family include at least one or more genes selected from Krt71, Krt72, Krt73 and Krt74.

[0035]

[22] The material according to

[20] above, wherein the one or more genes constituting the Krt or KAP family include at least one or more genes selected from Krt71, Krt72, Krt73 and Krt74.

[0036]

[23] The material according to

[19] above, wherein the genetic modification further includes the reduction or deletion of the expression or function of any one or both of the FGF-5 gene and the Tyr gene, or the destruction of the gene.

[0037]

[24] The material according to

[20] above, further comprising a reduction or deletion of the expression or function of one or both of the FGF-5 gene and the Tyr gene, or gene disruption.

[0038]

[25] The material according to

[21] above, further comprising a reduction or deletion of the expression or function of one or both of the FGF-5 gene and the Tyr gene, or gene disruption.

[0039]

[26] The material according to

[22] above, further comprising a reduction or deletion of the expression or function of one or both of the FGF-5 gene and the Tyr gene, or gene disruption.

[0040]

[27] The genetically modified animal or animal fiber according to any of the above items, wherein the genetically modified animal is male.

[0041]

[28] The genetically modified animal or animal fiber according to any of the above items, wherein the genetically modified animal is female.

[0042]

[29] The material according to any of the above items, wherein the genetically modified animal is male.

[0043]

[30] The material according to any of the above items, wherein the genetically modified animal is female.

[0044]

[31] Raw wool, which is the raw wool of the animal fiber described in any one of the above items, including guard hair and down hair.

[0045]

[32] Manufactured wool obtained from the raw wool described in

[31] above.

[0046]

[33] A spun yarn or a plied yarn comprising the manufactured wool described in

[32] above.

[0047]

[34] A woven fabric comprising the spun yarn or plied yarn described in

[33] above.

[0048]

[35] A garment comprising the woven fabric described in

[34] above.

[0049]

[36] An animal fiber product comprising the woven fabric described in

[34] above.

[0050] (1) A method for producing a non-human animal, comprising reducing the expression or function of one or more genes constituting the Krt or KAP family in the non-human animal.

[0051] (2) The method according to (1), wherein the one or more genes constituting the Krt family of the non-human animal are genes encoding Krt proteins expressed in the inner root sheath, hair cuticle, hair cortex or hair medulla of the non-human animal.

[0052] (3) The method according to (2), wherein the gene encoding the Krt protein expressed in the inner root sheath is one or more genes selected from the group consisting of Krt71, Krt72, Krt73 and Krt74.

[0053] (4) The method according to (3), wherein the gene is one or more genes selected from Krt71, Krt72, Krt73 and Krt74.

[0054] (5) The method according to any one of (1) to (4), wherein the one or more genes constituting the KAP family of the non-human animal include KAP8-1.

[0055] (6) The method according to any one of (1) to (5), further comprising reducing gene expression or function of Fgf5 and / or Tyr gene in a non-human animal.

[0056] (7) The method according to any one of (1) to (6), wherein the reduction of gene expression or function is gene knockout in a non-human animal.

[0057] (8) The method according to (7), wherein the non-human animal belongs to the order Rodentia or the order Artiodactyla.

[0058] (9) A non-human animal or its offspring produced by the method according to any one of (1) to (8).

[0059] (10) Animal fiber obtained from the non-human animal described in (9) or its offspring.

[0060] (11) An animal fiber product comprising the animal fiber described in (10).

[0061] <1> A non-human animal or its offspring, comprising a modification resulting in a reduction in the expression or function of one or more genes constituting the Krt family or the KAP family.

[0062] <2> according to <1> The non-human animal or its offspring, wherein the genes constituting the Krt family are selected from the group consisting of Krt71, Krt72, Krt73 and Krt74, and the genes constituting the KAP family are selected from the group consisting of the KAP8 subfamily.

[0063] <3> according to <1> or <2> The non-human animal or its offspring further comprises a modification that reduces the expression or function of the Fgf5 and / or Tyr genes.

[0064] <4> according to <1> ~ <3> The non-human animal or its offspring described in any one of the preceding claims, wherein the modification resulting in a reduction in the expression or function of a gene is a knockout.

[0065] <5> A method for producing a non-human animal whose average fiber diameter is significantly thinner than that of a wild type, comprising reducing the expression or function of one or more genes selected from genes constituting the Krt family of the non-human animal, genes constituting the KAP family, genes constituting the Krt family of the non-human animal, and genes constituting the KAP family.

[0066] <6> A method for producing a non-human animal whose average scale thickness of animal fibers is significantly smaller than that of wild type animals, comprising reducing the expression or function of one or more genes constituting the Krt family or the KAP family of the non-human animal.

[0067] <7> A method for producing a non-human animal whose scale intervals of animal fibers are significantly longer than those of wild-type animals, comprising reducing the expression or function of one or more genes selected from genes constituting the Krt family and genes constituting the KAP family of the non-human animal.

[0068] <8> according to <5> ~ <7> The method according to any one of the preceding claims, wherein the genes constituting the Krt family are selected from the group consisting of Krt71, Krt72, Krt73 and Krt74, and the genes constituting the KAP family are selected from the group consisting of the KAP8-1 subfamily.

[0069] <9> according to <5> ~ <8> The method described in any one of the preceding claims, further comprising reducing the expression or function of the Fgf5 and / or Tyr gene in a non-human animal.

[0070] <10> according to <5> ~ <9> The method described in any one of the preceding claims, wherein reducing or losing the expression or function of a gene is referred to as knocking out the gene.

[0071] <11> A non-human animal or its descendants, who <5> ~ <10> Prepared by any of the methods described above.

[0072] <12> according to <5> ~ <11> The method according to any one of the preceding claims, wherein the non-human animal or its offspring is a mammal or a bird.

[0073] <13> according to <12> The method described herein, wherein the mammal is a mouse, rat, rabbit, goat, sheep, alpaca, llama, camel, yak, ibex, guanaco, musk ox, Tibetan antelope, raccoon dog, raccoon, mink, sable, fox, cuscus, opossum, beaver, seal, nutria, ferret or alpaca, or a mammal obtained by hybridization of any of these mammals, and the bird is a wild duck, goose, domestic duck or ostrich, or a bird obtained by hybridization of any of these birds.

[0074] <14> according to <13> The method, wherein the goat is selected from the group consisting of Kashmir goat, Angora goat, Angora goat and Cashmere goat.

[0075] <15> A non-human animal or its descendants, who <5> ~ <14> The method described is used for production.

[0076] <16> An animal fiber consisting of <1> ~ <4> or <15> The non-human animal or its offspring is obtained.

[0077] <17> An animal fiber product comprising <16> The animal fiber.

[0078] (P1) An animal fiber, which is an animal fiber of a genetically modified non-human animal {wherein the non-human animal may be neither a dog nor a cow}, wherein the non-human animal has animal fiber, and the genetic modification is a reduction or deletion of the expression or function of one or more genes selected from the group consisting of Krt71, Krt72, Krt74 and KAP8-1, or the destruction of the one or more genes.

[0079] (P2) The animal fiber according to (P1) above, wherein (1) the content of the protein encoded by the one or more genes in the animal fiber of the animal with the above genetic modification is lower than that in the animal fiber of the animal without the above genetic modification, or (2) the animal fiber of the animal with the above genetic modification does not contain the protein encoded by the one or more genes.

[0080] (P3) The animal fiber according to (P1) or (P2) above, wherein the animal fiber from the genetically modified animal has a major diameter that is 5% or more, 10% or more, or 15% or more smaller than the animal fiber from the genetically modified animal.

[0081] (P4) The animal fiber according to (P1) or (P2) above, wherein the one or more genes include at least Kap8-1.

[0082] (P5) The animal fiber according to (P3) above, wherein the one or more genes include at least Kap8-1.

[0083] (P6) The animal fiber according to (P1) or (P2) above, wherein the one or more genes include at least one or more genes selected from Krt71, Krt72 and Krt74.

[0084] (P7) The animal fiber according to (P3) above, wherein the one or more genes include at least one or more genes selected from Krt71, Krt72 and Krt74.

[0085] (P8) The animal fiber according to (P1) or (P2) above, wherein the genetic modification further includes the reduction or deletion of the expression or function of any one or both of the FGF-5 gene and the Tyr gene, or the destruction of the gene.

[0086] (P9) The animal fiber according to (P4) above, wherein the genetic modification further comprises a reduction or deletion of the expression or function of any one or both of the FGF-5 gene and the Tyr gene, or the destruction of the gene.

[0087] (P10) The animal fiber according to (P6) above, wherein the genetic modification further includes the reduction or deletion of the expression or function of any one or both of the FGF-5 gene and the Tyr gene, or the destruction of the gene.

[0088] (P11) A cloth, woven fabric or fiber product comprising the animal fiber described in (P8) above.

[0089] (P12) A cloth, woven fabric or fiber product comprising the animal fiber described in (P9) above.

[0090] (P13) A cloth, woven fabric or fiber product comprising the animal fiber described in (P10) above.

[0091] (P14) A cloth, woven fabric or fiber product comprising the animal fiber described in (P1) or (P2) above.

[0092] By the method of the present invention, it is possible to produce animal species with animal fibers having fine fiber diameters. In addition, the animal fibers having fine fiber diameters obtained from such animals have less individual variability, and the hair is thin overall. Therefore, it is believed that the supply of high-quality animal fibers having excellent hand feel, softness, elasticity, warmth retention, quick-drying properties, etc. can be achieved. Moreover, in addition to having a fine fiber diameter, the animal fiber also has a smooth fiber surface. Therefore, the animal fiber has better qualities such as hand feel, wearing feel, and gloss than existing animal fibers having the same fiber diameter. In addition, the animal fiber is also not prone to the formation of hair balls and felts, so the quality can be maintained for a long time. In addition, there is no need to use various chemical methods that have been used in the process of producing animal fibers having fine fiber diameters and smooth surfaces, so it is possible to produce unprecedented natural fibers with high safety. In this way, the inventors have confirmed that natural fibers having preferred characteristics as animal fibers can be produced by genetically modifying animals that produce animal fiber hair, and have discovered a new fiber production method that has low environmental burden and excellent safety, which is different from fiber production based on existing chemical methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1-1 The sequences of wild-type (WT) Krt71 and Krt71 in each modified individual are shown.

[0094] Figure 1-2 The sequence of Krt71 in each modified individual is shown.

[0095] Figure 1-3 The sequence of Krt71 in each modified individual is shown.

[0096] Figure 1-4 The sequence of Krt71 in each modified individual is shown.

[0097] Figure 2-1 The sequences of wild-type (WT) Krt72 and Krt72 in each modified individual are shown.

[0098] Figure 2-2 The sequence of Krt72 in each modified individual is shown.

[0099] Figure 2-3 The sequence of Krt72 in each modified individual is shown.

[0100] Figure 3-1 The sequences of wild-type (WT) Krt73 and Krt73 in each modified individual are shown.

[0101] Figure 3-2 The sequence of Krt73 in each modified individual is shown.

[0102] Figure 4-1 The sequences of wild-type (WT) Krt74 and Krt74 in each modified individual are shown.

[0103] Figure 4-2 The sequence of Krt74 in each modified individual is shown.

[0104] Figure 5 The sequences of wild-type (WT) KAP8-1 and KAP8-1 in each modified individual are shown.

[0105] Figure 6 The sequences of wild-type (WT) KAP8-2 and KAP8-2 in each modified individual are shown.

[0106] Figure 7 The sequences of wild-type (WT) Tyr and Tyr in modified individuals are shown.

[0107] Figure 8 The sequences of wild-type (WT) Fgf5 and Fgf5 in modified individuals are shown.

[0108] Fig. 9 The sequences of wild-type (WT) KAP8-1 of goats and KAP8-1 in transformed individuals are shown.

[0109] Fig.10 The long diameters of animal fibers obtained from wild-type individuals and genetically modified individuals are shown.

[0110] Fig.11 Electron micrographs of wild-type hair, Krt72 mutant hair, and KAP8-1 mutant hair are shown.

[0111] Fig.12 The appearance of a wild-type mouse with black fur and its Tyr mutant are shown.

[0112] Fig.13 The diagram shows the major diameters of cross sections of hair from wild-type goats and KAP8-1-disrupted goats.

[0113] Fig.14 The results of immunoblotting show the presence of Krt72 and KAP8-1 proteins contained in the hair of various wild-type animals.

[0114] Fig.15 The sequences of KAP8-1 of various species are shown to be identical to KAP8-1. Amino acid alignment was performed based on the domains in the KAP8-1 proteins of goats and mice (NCBI-CDDID: 239162; 23 amino acids).

[0115] Fig.16 The sequence identity of Krt71 in various species is shown. Amino acid comparison was performed based on the domains in the KRT71 proteins of goat and house mouse (NCBI-CDDID: 365827; 314 amino acids). The KRT71 of Artiodactyla and Carnivora was compared with that of goat, and that of Rodentia and Lagomorpha was compared with that of house mouse.

[0116] Fig.17 The sequence identity of Krt72 from various species is shown. Amino acid comparison was performed based on the domains in the KRT72 proteins of goat and house mouse (NCBI-CDDID: 365827; 314 amino acids). Artiodactyls, Carnivora, and Diprotodontia were compared with goat KRT72, and Rodentia and Lagomorpha were compared with house mouse KRT72.

[0117] Fig.18 The sequence identity of Krt74 in various species is shown. Amino acid alignment was performed based on the domain in the goat KRT72 protein (NCBI-CDDID: 365827; 314 amino acids). DETAILED DESCRIPTION

[0118] Unless otherwise defined in this specification, all technical terms and scientific terms used in this specification have the same meaning as those commonly understood by those skilled in the art. All patents, applications and other publications (including online information) referenced in this specification are incorporated herein by reference in their entirety.

[0119] In this specification, words in the singular form do not exclude plural forms. In this specification, "comprising" means that unrecorded structures may be included, including "consisting of". "Consisting of" does not substantially include unrecorded structures.

[0120] One embodiment of the present invention includes a method for producing a non-human animal, comprising reducing the expression or function of one or more genes constituting the Krt or Kap family.

[0121] The "animal" in this specification refers to an animal that produces animal fiber hair, which may be a human or a non-human animal, and the non-human animal may be, for example, a non-human mammal or a bird, etc. Mammals are not limited, and include rodents such as Muridae, Chinchillae, Nutria, and Beaver, Lagomorpha such as Leporidae, Artiodactyls (also called even-toed ungulates) such as Caprinae, Camelidae, and Bovidae, Carnivora such as Canidae, Procyonidae, and Mustelidae, Cuscus such as Cuscus, and Opossums such as Opossum. In one embodiment of the present invention, Muridae includes mice (house mice, etc.), rats (bear mice, etc.), etc., Chinchilla family includes chinchillas, etc., Coypus family includes nutria, etc., Beaver family includes beaver, etc., Leporidae includes rabbits, hares, Angora rabbits, etc., Caprinae includes goats or sheep, etc., Camelidae includes camels (dromedary camels, Bactrian camels, etc.), llamas, alpacas, alpacas, guanacos, etc., Bovidae includes yaks, musk oxen (musk oxen), Tibetan antelopes, etc., Canidae includes wolves, raccoon dogs, foxes, etc., raccoons include raccoons (Procyon lotor), etc., Mustelidae includes ferrets, minks, sables, etc., Phocidae includes spotted seals, ringed seals, harbor seals, ringed seals, bearded seals, etc. There is no particular limitation on goats, and they include Cashmere goats, ibex, Nezu goats, Angora goats, Shiba goats, Japanese bovine goats, Alpine goats, Tokara goats, etc. There is no particular limitation on sheep, and they include Merino sheep, Borovas sheep, Corriedale sheep, Cheviot sheep, Perrendale sheep, Romney sheep, Suffolk sheep, Loftan sheep, Jacob sheep, Friesian sheep, etc.

[0122] Birds are not limited, including ducks such as Anatidae, ostriches such as Struthionidae, etc. Anatidae is not limited, including mallards, ducks, domestic ducks, swans, geese, geese, lesser white-fronted geese, bean geese, etc., and Struthionidae includes ostriches, etc.

[0123] The non-human animal may be a non-human animal obtained by hybridization of any of the non-human animals listed above. In addition, the non-human animal may be a non-human animal in which other genes other than the target gene of the present invention have been modified, in addition to the wild type mentioned above. From the perspective of the usefulness of the reduction in average fiber diameter brought about by the genetic modification of the present invention, mice, rabbits, camels, goats or sheep are preferred, and as goats, Cashmere goats are particularly preferred.

[0124] Animal fibers can also be human hair.

[0125] The form of non-human animals can be the form of embryos or the form of individuals. Embryos refer to any cells or cell groups with individual development ability. As embryos, for example, fertilized eggs, early embryos, morulae, blastocysts or internal cell masses contained therein, as well as induced pluripotent stem (iPS) cells, embryonic stem (ES) cells, etc. Individuals develop animal fibers (hair growth) from the body surface by feeding. Embryos can grow into individuals by being transplanted into the uterus of non-human animals. Embryos or individuals can be mosaics or chimeras. In the case where the expression or function reduction of genes is brought about by genetic modification of the target gene, embryos or individuals of mosaics or chimeras can be included, at least in the cells constituting the hair follicles or the cells of the germ cell line, the modification can be included. When the cells constituting the hair follicles have the modification, the development of animal fibers with thin fiber diameters can be achieved, and when the cells of the germ cell line have the above-mentioned modification, the offspring of animal fibers with thin fiber diameters can be obtained. In mating between homozygous genetically modified animals, a homozygous genetically modified animal can be obtained with a theoretical probability of 100%, in mating between heterozygous genetically modified animals and homozygous genetically modified animals, a homozygous genetically modified animal can be obtained with a theoretical probability of 50%, and in mating between heterozygous genetically modified animals, a homozygous genetically modified animal can be obtained with a theoretical probability of 25%. The genetic modification is preferably a homozygous genetic modification, that is, the genetic modification is performed in both the paternal and maternal chromosomes.

[0126] The cells constituting the hair follicle are not limited, and examples thereof include hair matrix cells (epithelial cells) contained in the hair matrix, pigment-producing cells (melanocytes), cuboidal epithelial cells contained in the hair root sheath, hair follicle stem cells or pigment stem cells contained in the hair follicle bulge, hair papilla cells, and hair root sheath cells of the hair bulb. The hair follicle may be a single hair follicle or a composite hair follicle. In the case of a single hair follicle, it may be a primary hair follicle or a secondary hair follicle. The germ cell line is not limited, and refers to gametes such as eggs and sperms, or primordial germ cells, oocytes, oogonia, spermatogonia, spermatocytes, etc. that serve as their basis.

[0127] The "animal fiber" in this specification refers to the animal fiber of the above-mentioned human or non-human animal, for example, when the non-human animal is a mammal, it refers to animal hair fiber, and when the non-human animal is a bird, it refers to feather fiber. In this specification, "animal fiber" is sometimes referred to as "hair" or "body hair". Animal hair fiber is typically the animal fiber derived from mammals as described in detail above. Specifically, for example, there can be listed "chinchilla hair" such as mouse hair, rat hair, and chinchilla hair, "rabbit hair" such as rabbit or hare hair, "angora rabbit hair" such as angora rabbit hair, "cashmere" such as cashmere goat hair, "angora wool" such as angora goat hair, "wool" or "wool" such as sheep hair, "alpaca wool" such as alpaca hair, "llama wool" such as llama hair, "camel wool" such as Bactrian camel hair, "yak wool" such as yak hair, "northern mountain wool" such as northern goat hair. ", "guanaco hair" as the hair of guanaco, "musk ox hair" as the hair of musk ox, "Tibetan antelope hair" as the hair of Tibetan antelope, "raccoon hair" as the hair of raccoon dog, "mink hair" as the hair of raccoon, "mink hair" as the hair of mink, "sable hair" as the hair of sable, "possum hair" as the hair of possum, "beaver hair" as the hair of beaver, "seal hair" as the hair of seal, "nutria hair" as the hair of nutria, "ferret hair" as the hair of ferret, or "llama hair" as the hair of alpaca. As can be seen from these examples, in the present invention, the same name is sometimes used for the name of the animal and the name of the animal hair. In the present invention, the animal hair fiber can be guard hair (protective hair) or soft hair (also called underhair, lower fluff, inner fluff or fluff). Cashmere is hair obtained from Cashmere goats by removing guard hair, and mainly contains or consists of soft hair.

[0128] Feather fibers are not limited as long as they are fibers of bird origin. Typically, they are animal fibers derived from birds as described in detail above. Specifically, for example, feathers of wild ducks, geese, domestic ducks, quails, chickens, turkeys, long-tailed chickens, Japanese bantams, pigeons, ostriches, green pheasants, guinea fowls, or ostriches. Feather fibers are not limited and include down feathers, semi-down feathers, and the like. The animal fibers of the present invention include raw wool collected from non-human animals, animal fibers obtained by screening, washing, or cutting raw wool, and / or animal fibers obtained by subjecting them to optional processing treatments such as scale stripping treatment, enzyme treatment, or pulse treatment.

[0129] The "Krt family" in this specification refers to a gene family encoding keratin. In this specification, "one or more genes constituting the Krt family" are also referred to as Krt genes. In addition, the protein encoded by the Krt gene is also referred to as Krt protein. Usually, the Krt gene or Krt protein is not limited to Krt, for example, it is sometimes represented by symbols such as Ck, CK, KRT, K, etc., and the symbols of the genes or proteins represented by these symbols are represented by "Krt" in this specification.

[0130] The Krt gene in the present invention may be a member of the Krt gene maintained in the genome of a non-human animal, and may preferably be a gene encoding type II (neutral to alkaline) keratin. The Krt gene in the present invention is preferably one or more genes selected from the group consisting of Krt71, Krt72, Krt73 and Krt74, more preferably one or more genes selected from the group consisting of Krt71, Krt72 and Krt74, and further preferably Krt72.

[0131] In one embodiment of the present invention, the Krt gene may be a Krt gene expressed in cells constituting hair follicles during the individual growth period of a non-human animal. The individual growth period refers in particular to the period during which animal fibers (hair growth) develop from a non-human animal, and may also be a period during which the gene is expressed only during a specific period such as a specific time or season. A Krt gene expressed during a period when the amount of hair growth is high is particularly preferred. The hair follicle is not particularly limited as long as it is a hair follicle constituting a non-human animal.

[0132] Such expression can be measured by methods such as RT-PCR, qRT-PCR, Northern blot, expression array, RNA sequencing, etc., which are commonly used in transcriptome analysis of hair follicles. In addition, those skilled in the art can refer to the methods used in Qiao et al., Genet Mol Res. 2016 Sep 2; 15(3), Din et al., BMC Genomics. 2019 Feb 15; 20(1): 140, Fan et al., Genet Mol Res. 2015 Dec 22; 14(4): 17904-15, Zhu PLoS One. 2013 Sep 19; 8(9): e76282, etc. for measurement, and can also refer to the genes described in these documents.

[0133] Such expression in hair follicles is reflected as a constituent protein in animal fibers. Therefore, instead of direct transcriptome analysis of hair follicles, the protein expressed in hair follicles can be inferred by performing proteome analysis of animal fibers. For proteome analysis of animal fibers, commonly used methods can be used, such as dissolving the protein in the animal fibers and then analyzing it by electrophoresis, mass spectrometry, or immunoassay. Those skilled in the art can refer to Plowman et al., Electrophoresis. 2000 May;21(9):1899-906, Plowman et al., J Proteomics. 2012 Jul 19;75(14):4315-24, Li et al., PLoS One. 2016 Jan 20;11(1):e0147044, etc.

[0134] Animal fibers are composed of a hair shaft that is exposed from the epidermis to the outside and a hair root that exists in the hair follicle. Regarding the structure of animal fibers in the hair follicle, the hair shaft composed of the cuticle, cortex, and medulla is located in the center of the hair follicle, surrounded by the inner root sheath on the outside, and the outermost part is surrounded by the outer root sheath with the companion layer sandwiched between them. In the growth of animal fibers, the proliferation, differentiation, and keratinization of hair matrix cells present in the hair bulb (hair matrix) located below the hair root account for part of the core process.

[0135] Specifically, the hair mother cells that proliferate at the hair root differentiate into cells that constitute the inner root sheath and three types of hair stem cells that constitute the hair cuticle, hair cortex, and hair medulla, and proliferate and keratinize while expressing specificity in each site.

[0136] In the growth process of such animal fibers, Krt71, Krt72, Krt73 and Krt74 proteins are known as Krt proteins expressed in the inner root sheath (see Jeffrey E Plowman; Duane P Harland, Singapore Springer Singapore 2018, Hair Fibre: Proteins, Structure and Development). One or more genes selected from the group consisting of Krt71, Krt72, Krt73 and Krt74 are modified in tissues containing at least the inner root sheath. In this case, the modification may be specific to the tissue containing the inner root sheath.

[0137] The present inventors have found that by reducing the expression or function of one or more genes constituting the Krt family of non-human animals, particularly genes encoding Krt proteins expressed in the inner root sheath, hair cuticle, hair cortex or hair medulla of non-human animals, it is possible to impart a reduction in fiber diameter or a smooth fiber surface to animal fibers. The obtained animal fibers maintain a sound layer structure and toughness, etc.

[0138] Therefore, in one embodiment, the present invention includes a method for producing a non-human animal, the method comprising reducing the expression or function of one or more genes encoding Krt proteins expressed in tissues including inner root sheath, hair cuticle, hair cortex or hair medulla of the non-human animal.

[0139] In another embodiment of the present invention, the one or more genes constituting the Krt family may be genes expressed in the inner root sheath, that is, genes encoding one or more genes selected from the group consisting of Krt71, Krt72, Krt73 and Krt74.

[0140] Systematic analysis of keratins including subfamily classification is well known in the art and is described in Eckhart and Ehrlich, Adv Exp Med Biol. 2018;1054:33-45.

[0141] The genes encoding proteins constituting these subfamilies have been confirmed to have common expression periods and expression sites, as well as sequence homology, and are therefore believed to have the same function. Therefore, by reducing the expression or function of the genes encoding proteins in each subfamily, the same traits can be obtained in the subfamily unit.

[0142] In one embodiment, the Krt gene whose expression or function is reduced in the present invention is preferably one or more genes selected from the group consisting of Krt71, Krt72, Krt73 and Krt74, preferably Krt71, Krt72 or Krt74, and particularly preferably Krt72. When one or more genes (especially Krt71) selected from the group consisting of Krt71, Krt72, Krt73 and Krt74 are modified, the modified animal can be: rodents such as Muridae (excluding mice), Chinchilla, Beaver, and Castoridae, Lagomorpha such as Leporidae; Artiodactyls such as Caprinae, Camelidae, and Bovidae (also called even-toed ungulates; excluding cattle); Carnivora such as Canidae, Procyonidae, and Mustelidae; Possums such as Possums; and Opossums such as Opossums. It can be Lagomorpha such as Chinchilla, Beaver, Castoridae, and Leporidae; Caprinae, Camelidae; Carnivora such as Canidae, Procyonidae, and Mustelidae; Possums such as Possums; and Opossums such as Possums. Therefore, animal fiber can also be animal fiber of the above-mentioned modified animals. In one embodiment, the modified gene does not include Krt71.

[0143] In one embodiment of the present invention, the Krt gene may be a gene encoding a non-main component of the protein component constituting the animal fiber of a human or non-human animal. Of the animal fibers, about 50 to 60% are keratin, and about 20 to 30% are composed of matrix proteins containing keratin associated protein (KAP). The gene encoding the non-main component refers to a gene encoding a Krt protein that is, for example, below the top 10, below the 20, and below the 30 when the animal fiber is subjected to mass spectrometry analysis among these Krt and KAP proteins. Typically, for example, Krt86, Krt87, Krt83, Krt85, Krt84, Krt33a, Krt31, Krt34, Krt33b, Krt35, and Krt32 are genes encoding the main components, and genes encoding components other than these main components are genes encoding non-main components, such as genes encoding Krt71, Krt72, or Krt74.

[0144] In this specification, "KAP family" refers to a gene family encoding keratin associated protein, and in this specification, "one or more genes constituting the KAP family" are referred to as KAP genes. In addition, the protein encoded by the KAP gene is also referred to as KAP protein. Generally, KAP genes or KAP proteins are sometimes represented by symbols other than KAP, such as Kap, Krtap, KrtAP, etc., and in this specification, the symbols of genes or proteins represented by these symbols are represented by "KAP".

[0145] When the KAP gene is a member of the KAP family maintained in the genome of the non-human animal of the present invention, for example, it may be a gene encoding a high glycine / tyrosine KAP protein.

[0146] In one embodiment of the present invention, examples of genes encoding high glycine / tyrosine KAP proteins include genes of the KAP8 subfamily, and examples of the KAP8 subfamily include KAP8-1 and KAP8-2.

[0147] The KAP gene in one embodiment of the present invention is preferably a KAP gene encoding a high glycine / tyrosine KAP protein. As a KAP encoding a high glycine / tyrosine KAP protein, the KAP8 subfamily is preferred. As KAP8, KAP8-1 is particularly preferred. As the modification of KAP8-1, there is no particular limitation, and frameshift mutations, nonsense mutations, missense mutations, deletions, insertions, etc. can be listed. In a preferred embodiment, frameshift mutations and nonsense mutations can be generated on the 5' end side of the destroyed gene, for example, in the first exon or the second exon (preferably the first exon). The deletion can be, for example, more than 1 amino acid in length, more than 2 amino acids in length, preferably more than 3 amino acids in length, more preferably more than 4 amino acids in length, more than 5 amino acids in length, more than 6 amino acids in length, more than 7 amino acids in length, more than 8 amino acids in length, more than 9 amino acids in length, more than 10 amino acids in length, more than 20 amino acids in length, more than 30 amino acids in length, more than 40 amino acids in length, more than 50 amino acids in length, or more than 60 amino acids in length. In addition, for example, a deletion may be generated in an amino acid of KAP8-1 corresponding to one or more of the amino acids at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, or 62 of the amino acid sequence registered as GenBank: AAS00529.1. The deletion may be a deletion that induces a reduction or loss of the function of the KAP8-1 protein. Frameshift mutations include insertions or deletions of n bases in the exon region of the nucleic acid encoding KAP8-1 {wherein n is a natural number that is not a multiple of 3}. For example, n can be a natural number of 1 or more, 2 or more, 4 or more, 5 or more, 7 or more, 8 or more, 10 or more, 11 or more, 13 or more, 14 or more, 16 or more, 17 or more, 19 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, or 150 or more. Frameshifts can be frameshifts that induce a decrease in or loss of the function of the KAP8-1 protein.A nonsense mutation can be generated, for example, in a region of KAP8-1 corresponding to one or more of the amino acids at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, or 62 of the amino acid sequence registered as GenBank: AAS00529.1. In addition, missense mutations may occur, for example, in a region of KAP8-1 corresponding to one or more amino acids at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, or 62 of the amino acid sequence registered as GenBank: AAS00529.1. Among them, nonsense mutations and missense mutations may be mutations that induce reduction or loss of the function of KAP8-1. As a deletion mutation of KAP8-1, for example, it can be a deletion of the amino acids of KAP8-1 corresponding to positions 30 and 31 of the amino acid sequence registered as GenBank: AAS00529.1. The amino acids corresponding to specific positions of an amino acid sequence refer to amino acids arranged at the same position when two or more amino acid sequences are aligned. For example, the amino acids of KAP8-1 corresponding to positions 30 and 31 of the amino acid sequence registered as GenBank: AAS00529.1 refer to the amino acids of KAP8-1 arranged at the same positions as the amino acids at positions 30 and 31 when the amino acid sequence registered as GenBank: AAS00529.1 and the amino acid sequence of KAP8-1 are aligned.

[0148] In one embodiment of the present invention, the genetically modified animal has a reduction in expression or function of one or more genes selected from the group consisting of Krt71, Krt72 and Krt74 and the KAP8-1 gene, or a disruption of the above genes. In one embodiment of the present invention, the genetically modified animal has a reduction in expression or function of Krt71 and KAP8-1, or a disruption of the above genes. The genetically modified animal has a reduction in expression or function of Krt74 and KAP8-1, or a disruption of the above genes.

[0149] In a preferred embodiment of the present invention, the genetically modified animal has reduced expression or function of Krt72 and KAP8-1, or disruption of the above genes.

[0150] In a further preferred embodiment of the present invention, the genetically modified animal has: reduced expression or function of Krt71, Krt72 and KAP8-1, or disruption of the above genes; reduced expression or function of Krt72, Krt74 and KAP8-1, or disruption of the above genes; or reduced expression or function of Krt72, Krt74 and KAP8-1, or disruption of the above genes.

[0151] In a further preferred embodiment of the present invention, the genetically modified animal has reduced expression or function of Krt71, Krt72, Krt74 and KAP8-1, or disruption of the above genes.

[0152] In one embodiment of the present invention, the genetically modified animal is male or female. When determining whether male animal fiber or female animal fiber is better for each animal fiber based on the desired characteristics of the animal fiber, male or female can be selected according to the desired characteristics of the animal fiber to obtain the animal fiber. In one embodiment of the present invention, the genetically modified animal can have a certain age.

[0153] In one embodiment of the present invention, a genetically modified animal having an average fiber diameter (long diameter) of animal fibers (especially hair) of 95% or less, 90% or less, 85% or less, or 80% or less of the average fiber diameter (long diameter) of animal fibers (especially hair) of the same animal without the above-mentioned genetic modification can be selected from the above-mentioned genetically modified animals. By doing so, a genetically modified animal can be provided, which has a genetic modification, and the average fiber diameter (long diameter) of its animal fibers (especially hair) is 95% or less, 90% or less, 85% or less, or 80% or less of the average fiber diameter (long diameter) of animal fibers (especially hair) of the same species, the same line, or the same line without the above-mentioned genetic modification, and the above-mentioned genetic modification has a reduction in the expression or function of one or more genes selected from the group consisting of Krt71, Krt72, Krt74, and KAP8-1, or the destruction of the above-mentioned genes. The control animal is preferably of the same species and lineage, but when a control animal of the same species and lineage is not available, it can also be an animal of the same species and lineage. The allogeneic animal is preferably an allogeneic wild-type animal, and more preferably an animal before transformation. The effect of genetic modification can be most appropriately evaluated by comparing the animals before and after transformation.

[0154] In one embodiment, the present invention includes the above method, which comprises reducing the expression or function of one or more genes selected from one or more genes constituting the Krt or KAP family.

[0155] In one embodiment, the present invention includes reducing the expression or function of one or more genes selected from the group consisting of Krt71, Krt72, and Krt74 and the KAP8-1 gene, or disrupting (knocking out) the genes.

[0156] The Fgf5 gene in this specification refers to a gene encoding FGF5 (Fibroblast growth factor 5). Generally, there is no limitation other than Fgf5, and sometimes it is represented by symbols such as FGF-5, HBGF-5, etc. In this specification, the genes represented by these symbols are represented by "Fgf5".

[0157] The Tyr gene in this specification refers to a gene encoding tyrosinase. Generally, there is no limitation other than Tyr, and sometimes it is represented by symbols such as TYR, LB24-AB, SK29-AB, etc. In this specification, genes represented by these symbols are represented by "Tyr".

[0158] In this specification, Krt gene, Kap gene, Fgf5 gene, and Tyr gene may be collectively referred to as “target gene.” In addition, a protein encoded by a target gene may be referred to as “target protein.”

[0159] In this specification, "homolog" refers to a group of genes with high similarity that have the same evolutionary origin. Homologs are classified into two categories: "orthologs" and "paralogs". Orthologs refer to homologs that present the same gene when the species branches. Paralogs refer to homologs that are produced by gene duplication within the same species.

[0160] Regarding Krt71, its nucleic acid sequence and amino acid sequence are known in various biological species. Mouse Krt71, for example, has an amino acid sequence registered as GenBank: AAI25349.1 or an amino acid sequence of Krt71 corresponding to the amino acid sequence. Goat Krt71, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_017903206.1 or an amino acid sequence of Krt71 corresponding to the amino acid sequence. Sheep Krt71, for example, has an amino acid sequence registered as GenBank: AFV46425.1 or an amino acid sequence of Krt71 corresponding to the amino acid sequence. Rabbit Krt71, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_002711049.1 or an amino acid sequence of Krt71 corresponding to the amino acid sequence. Mink Krt71, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_044084420.1 or an amino acid sequence of Krt71 corresponding to the amino acid sequence. Human Krt71 has, for example, an amino acid sequence registered as GenBank: AAI03919.1 or an amino acid sequence of Krt71 corresponding to the amino acid sequence. A person skilled in the art can determine the amino acid sequence of the Krt71 gene and protein for each species.

[0161] Regarding Krt72, its nucleic acid sequence and amino acid sequence are known in various biological species. Mouse Krt72, for example, has an amino acid sequence registered as GenBank: EDL04025.1 or an amino acid sequence of Krt72 corresponding to the amino acid sequence. Goat Krt72, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_013832621.2 or an amino acid sequence of Krt72 corresponding to the amino acid sequence. Sheep Krt72, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_004006372.2 or NCBI Reference Sequence: XP_042102628.1 or an amino acid sequence of Krt72 corresponding to the amino acid sequence. Rabbit Krt72, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_008254713.1 or an amino acid sequence of Krt72 corresponding to the amino acid sequence. Mink Krt72 has, for example, an amino acid sequence registered as NCBI Reference Sequence: XP_044085134.1 or NCBI Reference Sequence: XP_044085135.1 or an amino acid sequence of Krt72 corresponding to the amino acid sequence. Human Krt72 has, for example, an amino acid sequence registered as GenBank: AAI13687.1 or an amino acid sequence of Krt72 corresponding to the amino acid sequence. A person skilled in the art can determine the amino acid sequence of the gene and protein of Krt72 for each species.

[0162] Regarding Krt74, its nucleic acid sequence and amino acid sequence are known in various biological species. Mouse Krt74, for example, has an amino acid sequence registered as GenBank: EDL04026.1 or an amino acid sequence of Krt74 corresponding to the amino acid sequence. Goat Krt74, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_005701908.2 or an amino acid sequence of Krt74 corresponding to the amino acid sequence. Sheep Krt74, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_004006373.1 or an amino acid sequence of Krt74 corresponding to the amino acid sequence. Mink Krt74, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_044085217.1 or an amino acid sequence of Krt74 corresponding to the amino acid sequence. Human Krt74 has, for example, an amino acid sequence registered as GenBank: KAI2565848.1 or an amino acid sequence of Krt74 corresponding to the amino acid sequence. A person skilled in the art can determine the amino acid sequence of the gene and protein of Krt74 for each species.

[0163] Regarding keratin associated protein 8-1 (KAP8-1), its nucleic acid sequence and amino acid sequence are known in various biological species. Mouse KAP8-1 has, for example, an amino acid sequence registered as NCBI Reference Sequence: NP_034805.1 or an amino acid sequence of KAP8-1 corresponding to the amino acid sequence. Goat KAP8-1 has, for example, an amino acid sequence registered as GenBank: AAS00529.1 or an amino acid sequence of KAP8-1 corresponding to the amino acid sequence. Sheep KAP8-1 has, for example, an amino acid sequence registered as NCBI Reference Sequence: XP_027834241.1 or an amino acid sequence of KAP8-1 corresponding to the amino acid sequence. Rabbit KAP8-1 has, for example, an amino acid sequence registered as NCBI Reference Sequence: XP_017202204.1 or an amino acid sequence of KAP8-1 corresponding to the amino acid sequence. Mink KAP8-1 has, for example, an amino acid sequence registered as NCBI Reference Sequence: XP_044110896.1 or an amino acid sequence of KAP8-1 corresponding to the amino acid sequence. Human KAP8-1 has, for example, an amino acid sequence registered as NCBI Reference Sequence: NP_787053.1 or an amino acid sequence of KAP8-1 corresponding to the amino acid sequence. Those skilled in the art can determine the amino acid sequence of the gene and protein of KAP8-1 for each species.

[0164] Regarding fibroblast growth factor 5 (Fgf5), its nucleic acid sequence and amino acid sequence are known in various biological species. Mouse Fgf5, for example, has an amino acid sequence registered as GenBank: AAH71227.1 or an amino acid sequence of Fgf5 corresponding to the amino acid sequence. Goat Fgf5, for example, has an amino acid sequence registered as GenBank: AIZ78004.1 or an amino acid sequence of Fgf5 corresponding to the amino acid sequence. Sheep Fgf5, for example, has an amino acid sequence registered as GenBank: AID52934.1 or an amino acid sequence of Fgf5 corresponding to the amino acid sequence. Rabbit Fgf5, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_008265908.1 or an amino acid sequence of Fgf5 corresponding to the amino acid sequence. Mink Fgf5, for example, has an amino acid sequence registered as NCBI Reference Sequence: XP_044080065.1 or an amino acid sequence of Fgf5 corresponding to the amino acid sequence. Human Fgf5, for example, has an amino acid sequence registered as GenBank: AAB06463.1 or an amino acid sequence of Fgf5 corresponding to the amino acid sequence. Those skilled in the art can determine the amino acid sequence of the gene and protein of Fgf5 for each biological species. Fgf5 is expressed in the outer root sheath and therefore can be modified in tissues containing the outer root sheath. The modification can be tissue-specific.

[0165] Regarding tyrosinase (tyr), its nucleic acid sequence and amino acid sequence are known in various biological species. Mouse Tyr, for example, has an amino acid sequence registered as GenBank: BAA00341.1 or an amino acid sequence of tyr corresponding to the amino acid sequence. Goat Tyr, for example, has an amino acid sequence registered as GenBank: AEV91332.1 or an amino acid sequence of tyr corresponding to the amino acid sequence. Sheep Tyr, for example, has an amino acid sequence registered as GenBank: ACF21682.1 or an amino acid sequence of tyr corresponding to the amino acid sequence. Rabbit Tyr, for example, has an amino acid sequence registered as NCBI Reference Sequence: NP_001075546.1 or an amino acid sequence of tyr corresponding to the amino acid sequence. Mink Tyr, for example, has an amino acid sequence registered as GenBank: AJO15925.1 or an amino acid sequence of tyr corresponding to the amino acid sequence. Human Tyr has, for example, the amino acid sequence registered as GenBank: AAB60319.1 or an amino acid sequence of tyr corresponding to the amino acid sequence.

[0166] The orthologs or homologs of the proteins having the above amino acid sequences have high homology with any of these amino acid sequences. High homology refers to a homology of 50% or more, 60% or more, preferably 70% or more, further preferably 80% or more, more preferably 90% or more (e.g., 95% or more, further 96%, 97%, 98% or 99% or more). The homology can be determined using the default parameters of the protein BLAST algorithm provided by the National Center for Biotechnology Information (NCBI) of the United States.

[0167] The nucleic acid sequence encoding any one of the above amino acid sequences can be determined by the nucleic acid sequence search of the U.S. National Library of Medicine of NCBI. In addition, the nucleic acid sequence can also be determined by the codon correspondence table based on the amino acid sequence. About the nucleic acid sequence, codon optimization can be performed for the cells expressing the nucleic acid sequence. In addition, the DNA with the base sequence encoding any one of the above proteins can be separated by hybridization with the DNA with natural nucleic acid sequence under strict conditions. Here, as "strict conditions", for example, "2 × SSC, 0.1% SDS, 50 ° C", "2 × SSC, 0.1% SDS, 42 ° C", "1 × SSC, 0.1% SDS, 37 ° C", as more stringent conditions, "2 × SSC, 0.1% SDS, 65 ° C", "0.5 × SSC, 0.1% SDS, 42 ° C" and "0.2 × SSC, 0.1% SDS, 65 ° C" and other conditions can be listed. A person skilled in the art can appropriately obtain the base sequences of homologs based on the base sequences or symbols described in the above-mentioned SEQ ID NOs: 1 to 26 in other organisms.

[0168] Even if it is a target protein other than the protein having the above-mentioned specific amino acid sequence, proteins having high homology (usually 65% ​​or more, 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more) and having the function possessed by the target protein are also included in the target protein of the present invention.

[0169] In this specification, "reducing the expression or function of a gene" means reducing or eliminating the expression of a target gene or target protein, or reducing or eliminating the function of a target protein. Examples of methods for reducing the expression or function of a target gene include destroying the target gene, inhibiting the transcription of the target gene, decomposing the transcript of the target gene, inhibiting the translation of the target gene, inhibiting the interaction of the target protein with other molecules, and inhibiting the normal folding of the target protein.

[0170] As specific means for realizing these methods, means of genome modification in humans or non-human animals and means of genome modification in humans or non-human animals can be listed. As means of genome modification without genome modification, epigenetic control factors, inhibitory nucleic acid factors (miRNA, etc.), RNA editing factors and other expression constructs that reduce the expression or function of the target gene can be listed, or arbitrary low molecules bound to the target protein can be used. Regarding the preferred embodiment of the present invention, from the viewpoint that animal fibers with desired properties can also be obtained from the offspring of humans or non-human animals, it is preferred to be accompanied by means of modification of the target gene.

[0171] "Transformation" in this specification refers to artificially deleting, replacing and / or inserting nucleotides to change the specified base sequence to another base sequence. Nucleotides can be nucleotides of one base, oligonucleotides, long-chain nucleotides, etc. As transformations, for example, missense mutations, frameshift mutations, nonsense mutations and deletions of one or more amino acids can be listed. In genetically modified animals, the expression or function of the modified gene or protein is reduced, or the modified gene or protein is destroyed by the transformation.

[0172] "Knockout" in this specification refers to the transformation that brings about the reduction of expression or function of the target gene, preferably refers to the destruction of the target gene. Knockout is not limited to such transformation, and can be the transformation of the target region, or the transformation of any region on the genome outside the target region. "Target region" in this specification refers to the coding region of the target gene, and the region of any cis or trans acting factors encoded outside the coding region that control the expression of the target gene. The transformation of any region on the genome also includes the insertion of external genes that bring about the reduction or destruction of the expression or function of the target gene, for example, also includes the transformation of expression cassettes such as insertion expression genome editing factors, hindering nucleic acid factors, RNA editing factors, epigenetic control factors, etc. Even if such an expression cassette does not cause the reduction or destruction of the expression or function of the target gene immediately after insertion, as long as it brings about reduction or destruction after a specified period of time.

[0173] In the present invention, knockout can be a modification of part or all of the target region. "Part" refers to a part of the target region, which is a region of the length required to reduce or destroy the expression or function of the gene. In the case of deletion or insertion of nucleotides in the target region, the expression or function of the gene can be reduced or destroyed, especially eliminated by frameshifting. Even if frameshifting does not occur, nonsense mutations that produce stop codons by deletion, substitution, and insertion can be used to reduce or destroy the expression or function of the target protein, especially eliminate it. For genes with more than two exons, the modification can be any exon such as the 1st, 2nd, 3rd, 4th, 5th, 6th, etc. without limitation, but it can be preferably the modification of the 1st exon or the 2nd exon (frameshift mutation or nonsense mutation).

[0174] In the present invention, knockout can be either homozygous or heterozygous as long as it can bring about the reduction or destruction of the expression or function of a gene. "homozygous" in this specification refers to having transformation in both (two alleles) of the chromosomes of the paternal and maternal lines, and is sometimes expressed as [- / -] in this specification. "Heterozygous" in this specification refers to having transformation only in any one (single allele) of the paternal or maternal lines when genetic modification is used, and is sometimes expressed as [- / +] or [+ / -] in this specification. It is understood that even if it is a heterozygous knockout, if it is a dominant negative mutation, the function of the gene disappears, even if it is other mutations, if expression or function is reduced in a single allele, then it is also possible to bring about the reduction of expression or function as a whole. No matter it is any one of homozygous and heterozygous, the transformation is inherited to a part or all of the descendants, and therefore, its descendants also have the transformation that brings about the expression or reduction of the function of a gene, which is useful. In the present invention, the knockout is preferably a homozygous knockout from the viewpoint of bringing about a phenotype and from the viewpoint of efficiently obtaining a homozygous knockout animal.

[0175] The method of transformation is not limited and can be carried out by any method such as genome editing and homologous recombination. From the viewpoint of simplicity and high transformation efficiency, genome editing is preferred. Regarding genome editing, for example, a method of genome editing factors comprising a nuclease for cutting target double-stranded DNA and a DNA recognition component bound to the nuclease can be cited. As genome editing, ZFN, TALEN, and CRISPR / Cas can be cited. For example, FokI (nuclease) and zinc finger motifs (DNA recognition components) are used in ZFN, FokI (nuclease) and TAL effectors (DNA recognition components) are used in TALEN, and Cas (nuclease) and guide RNA (gRNA) (DNA recognition components) are used in CRISPR. The nuclease used in genome editing can be used as long as it has nuclease activity, and DNA polymerase, recombinase, etc. can also be used in addition to nuclease.

[0176] As nuclease, there is no limitation, and CRISPR type I (TypeIA~C, TypeI-D (Cas3', Cas5d, Cas6d, Cas7d and Cas10d), TypeI-E (Cas3, Cse1, Cse2, Cas7, Cas5, Cas6)), type II (Cas9, etc.), type III and type V (Cas12a (Cpf1, MAD2, MAD7, etc.) can be used. In one embodiment, gRNA is used as a DNA recognition component in CRISPR / Cas, but gRNA can be a single gRNA or a dual gRNA based on crRNA and tracrRNA. In addition, genome editing does not need to be accompanied by nuclease activity, and any editing method such as Prime editing and Target-AID can be used. (Anzalone et al., 2019 Nature vol 576, pages 149-157, Nishimasu et al., Science 21 Sep2018: Vol. 361, Issue 6408, pp. 1259-1262).

[0177] The design method of the target sequence of the gRNA that targets the target gene can be designed using a common method. For example, it is described in Naito et al., Bioinformatics. 2015 Apr 1; ​​31(7): 1120-1123, Park et al., Bioinformatics. 2016 Jul 1; 32(13): 2017-2023. Based on these documents and sequence information of the target gene, gRNA can be prepared.

[0178] The target sequence of the gRNA targeting mouse Krt71 is not limited, and the sequences of SEQ ID NOs: 1 to 3 can be used. In other animal species, the Krt71 gene can be disrupted using a gRNA having a base sequence corresponding to the target sequence of the gRNA described above.

[0179] The target sequence of the gRNA targeting mouse Krt72 is not limited, and the sequences of SEQ ID NOs: 4 to 6 can be used. In other animal species, the Krt72 gene can be disrupted using a gRNA having a base sequence corresponding to the target sequence of the gRNA described above.

[0180] The target sequence of the gRNA targeting mouse Krt74 is not limited, and the sequences of SEQ ID NOs: 10 to 12 can be used. In other animal species, the Krt74 gene can be disrupted using a gRNA having a base sequence corresponding to the target sequence of the gRNA.

[0181] The target sequence of the gRNA targeting mouse KAP8-1 is not limited, and the sequences of SEQ ID NOs: 13 to 15 can be used. In other animal species, the KAP8-1 gene can be disrupted using a gRNA having a base sequence corresponding to the target sequence of the gRNA described above.

[0182] The target sequence of the gRNA targeting the mouse Tyr sequence is not limited, and the sequences of SEQ ID NOs: 19 to 21 can be used. In other animal species, the KAP8-1 gene can be disrupted using a gRNA having a base sequence corresponding to the target sequence of the gRNA described above.

[0183] The target sequence of the gRNA targeting the mouse Fgf5 sequence is not limited, and the sequences of SEQ ID NOs: 22 to 24 can be used. In other animal species, the KAP8-1 gene can be disrupted using a gRNA having a base sequence corresponding to the target sequence of the gRNA described above.

[0184] As the object of transformation, for example, embryos, somatic cells, germ cells, individuals, etc. can be listed. In the case of introducing the genome editing factor into the embryo, the embryo transformed by the introduction can be transplanted into the uterus of the individual to obtain a non-human animal individual. In the case of introducing into somatic cells, the embryo obtained by nuclear transplantation can be transplanted into the uterus of the individual, in which the nucleus of the somatic cell transformed by the introduction is introduced into the enucleated egg cell. In addition, cells derived from the transformed embryo can also be mixed with other embryos to make chimera embryos, and the chimera embryos produced can be transplanted into the uterus of the individual. In the case of introducing into germ cells, the germ cells transformed by the introduction can be directly used, or transplanted into the individual and fertilized (natural mating, artificial insemination or in vitro fertilization, etc.) to obtain a non-human animal individual.

[0185] In the case of introduction into an individual, a composition containing a genome editing factor can also be directly administered to an individual in the form of a viral vector or the like to obtain a non-human animal having modified cells. In this case, as long as the modification occurs at least in the cells constituting the hair follicles, the animal fibers will exhibit properties such as a thinning of the fiber diameter. If the modification occurs in the reproductive system, the expression or function of the target gene can be reduced in its offspring. Whether the modified object has been modified can be determined by using common methods such as PCR, Southern blotting, and genome sequencing.

[0186] There is no limitation on the method of introduction. Electroporation, lipofection, calcium phosphate method, dextran method, microinjection, iTOP (D'Astolfo et al., Cell. 2015; 161(3):674-690), cell membrane permeable peptide (CPP), viral vector or non-viral vector can be used. For introduction into embryos, electroporation is preferred from the perspective of high introduction efficiency. For introduction into individuals, a delivery method using viral vector or non-viral vector is preferred. There is no limitation on viral vectors, and vectors based on adenovirus, adeno-associated virus (AAV), retrovirus, vaccinia virus, poxvirus, lentivirus, herpes virus, etc. can be listed.

[0187] In one embodiment of the present invention, in addition to modifying the genes of non-human animals, an obstructive nucleic acid may also be administered to non-human animals. An obstructive nucleic acid refers to a nucleic acid that obstructs the expression of a target molecule, including RNAi molecules, microRNAs, microRNA mimics, piRNAs (Piwi-interacting RNAs), ribozymes, antisense nucleic acids, Bonac nucleic acids (WO 2012 / 005368), etc. The nucleic acid may contain a modified nucleic acid, or may be a hybrid molecule of DNA and RNA (Gapmer, Mixmer, etc.).

[0188] RNAi (RNA interference) molecules refer to any molecule with RNAi activity, without limitation, including, for example, siRNA (small interfering RNA), shRNA (short hairpin RNA), etc. RNAi interference typically refers to the phenomenon of induced by double-stranded nucleic acid molecules to specifically decompose the target RNA sequence. If the double-stranded nucleic acid molecule enters the cell, it is cut by Dicer according to its length and then incorporated into the RNA-induced gene silencing complex (RISC) containing the Argonaute (AGO) protein. RISC uses the antisense strand (guide strand) with a sequence complementary to the target RNA as a guide to recognize the target RNA and cut it. siRNA is typically a double-stranded RNA with a length of about 20 to 25mer. shRNA is typically an RNA obtained by connecting the double strands of siRNA via a hairpin composed of RNA.

[0189] Gene expression control mechanisms based on miRNAs typically refer to the degradation or translation inhibition of sequence-specific RNA induced by miRNAs. Mature miRNAs are incorporated into the miRNA-induced gene silencing complex (miRISC) containing Argonaute (AGO) proteins, which induce miRISC to mRNAs that are mainly complementary to the seed sequence (sequences at positions 2 to 8 from the 5' end), inhibit the translation of the mRNA, and degrade the polyA tail present at the 3' end of the mRNA to shorten it, thereby promoting the degradation of the mRNA. Gene expression control mechanisms based on piRNAs typically refer to the degradation of sequence-specific RNA induced by piRNAs. If piRNAs are incorporated into the piRNA-induced gene silencing complex (piRISC) containing Piwi proteins, a protein of the PIWI subfamily, they are transferred to the nucleus and sequence-specifically inhibit the transcription of target genes. RasiRNAs (repeat associated siRNAs) also produce gene silencing via Piwi proteins.

[0190] MicroRNA mimics are nucleic acid molecules that mimic the functions of endogenous microRNAs and are well known in the art (e.g., van Rooij and Kauppinen, EMBO Mol Med. 2014; 6(7):851-64, Chorn et al., RNA. 2012; 18(10):1796-804). MicroRNA mimics may include chemical modifications or alter the nucleotide sequence of endogenous microRNAs.

[0191] shRNA is a single-stranded RNA molecule containing an antisense region and a sense region with mutual complementarity, as well as a loop region between them. The pairing of the antisense region and the sense region forms a double-stranded region, presenting a hairpin-shaped three-dimensional structure. shRNA is cleaved by dicer in cells to generate double-stranded siRNA molecules, which are incorporated into RISC and cause RNA interference.

[0192] shRNA is typically expressed in cells by encoding its nucleic acid structure, a plasmid containing it, etc. and exerts its effect, but shRNA molecules can also be delivered directly to cells. These hindering nucleic acids can be suitably prepared using known methods based on the information of the target gene contained in this specification (Disney et al., Cold Spring Harb Perspect Biol. 2018 Nov 1; 10 (11), Naito and Ui-Tei, Front Genet. 2012; 3: 102, Mickiewicz et al., Acta Biochim Pol. 2016; 63 (1): 71-77, etc.). CRISPR / Cas13 can edit RNA, so the genome editing factor can be used for gene silencing in the same way as hindering nucleic acids.

[0193] In the method of the present invention, when various compositions that bring about the reduction of gene expression or function are administered to non-human animals, they can be administered without limitation through various routes including oral and non-oral routes, such as oral, transdermal, subcutaneous, intradermal, transmucosal, intravenous, intramuscular, local, rectal, intraarterial, intraportal, intraventricular, intramyocardial, intraarticular, intranasal, intraperitoneal, intratracheal, intrabronchial, intraalveolar, intrapulmonary and intrauterine routes, and can be prepared into dosage forms suitable for each administration route. The dosage form and preparation method can be suitably any known dosage form and preparation method.

[0194] In the present invention, if the expression or function of one or more genes (target genes) selected from one or more genes constituting the Krt or KAP family is reduced or destroyed, the expression or function of any other gene can also be reduced or improved. As other genes, it can be a gene that gives or improves the properties related to animal fiber or any other properties to non-human animals. As a preferred gene that reduces the expression or function of a gene, or reduces or destroys the function, it is not limited, and it can be Fgf-5, Tyr, MSTN, ASIP, BCO2, CFTR, etc., and it can be their knockout. As a preferred gene that improves the expression or function of a gene, it is not limited, and it can be Tβ4, VEGF (VEGF-A), AANAT, ASMT, etc., for example, it can be a knock-in of an expression cassette containing these genes. As long as the desired properties of the non-human animal of the present invention are not hindered, the expression or function of two or more genes can be increased or reduced at the same time.

[0195] In an exemplary embodiment, the non-human animal of the present invention reduces or destroys the expression or function of one or both of the Fgf5 gene and the Tyr gene in addition to reducing the expression or function of the target gene.

[0196] By reducing or destroying the expression or function of the Fgf5 gene, the length of the animal fiber of the non-human animal becomes longer. In addition, by reducing the expression or function of the Tyr gene, the color of the animal fiber of the non-human animal becomes white. Therefore, in one embodiment, by combining the reduction of the expression or function of one or more genes selected from Krt or KAP of the present invention, and the reduction of the expression or function of any one or two of Fgf5 and Tyr, a non-human animal having an animal fiber with a thinner fiber diameter and a longer fiber length (one or more genes selected from Krt or KAP, and the expression or function of the Fgf5 gene is reduced), a non-human animal having an animal fiber with a thinner fiber diameter and white (one or more genes selected from Krt or KAP, and the expression or function of the Tyr gene is reduced), a non-human animal having an animal fiber with a thinner fiber diameter and a longer fiber length and white (one or more genes selected from Krt or KAP, and the expression or function of the Fgf5 and Tyr genes is reduced) or a non-human animal having an animal fiber with a longer fiber length and white (Tyr, and the expression or function of the Fgf5 gene is reduced). As a method for reducing or disrupting the expression or function of Fgf5 and Tyr genes, the methods for reducing or disrupting the expression or function of target genes described in detail above may be used.

[0197] It is previously known that the fiber length is elongated in animals such as mice, dogs, cats and goats with knockout of the Fgf5 gene (Cell. 1994 Sep 23; 78(6):1017-25, Anim Genet. 2006 Aug; 37(4):309-15, Anim Genet. 2007 Jun; 38(3):218-21, PLoS One. 2016 Oct 18;11(10):e0164640). It is also known that animal fibers turn white in animals such as mice, rabbits, cattle, and minks that have a knockout of the Tyr gene (Mamm Genome. 2004 Oct; 15(10): 749-58, Mamm Genome. 2000 Aug; 11(8): 700-2, Mamm Genome. 2004 Jan; 15(1): 62-7, Anim Genet. 2008 Dec; 39(6): 645-8). From these, it is known that a trait based on the modification of a specific gene in a specific non-human animal species, as long as the trait is related to animal fibers, will also appear as the same trait in the modification of homologs in other animal species. This is believed to be the case for genes such as Krt and KAP.

[0198] The non-human animal produced by the method of the present invention has a genetic modification such as reduction or destruction of the expression or function of one or more genes selected from one or more genes constituting the Krt or KAP family. The diameter (fiber diameter) of the animal fiber of the non-human animal is thinner than the animal fiber of the same species or allogeneic control non-human animal that does not have the above-mentioned genetic modification (e.g., before genetic modification). The sequence before genetic modification can be a sequence exemplified by the registration number in this specification. The fiber diameter typically refers to the average fiber diameter (especially the average of the long diameter of the fiber), and the control non-human animal typically refers to the wild type. In one embodiment of the present invention, the average fiber diameter of the modified non-human animal having one or more genes selected from one or more genes constituting the Krt or KAP family is 5% or more, 6% or more, 7% or more, 8% or more, 9% or more, 10% or more, 11% or more, 12% or more, 13% or more, 14% or more, 15% or more, 16% or more, 17% or more, 18% or more, 19% or more, or 20% or more smaller than the average fiber diameter of a control non-human animal of the same species, syngeneic or heterogeneous lineage. The average fiber diameter of the non-human animal having the above modification is, for example, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less smaller than the average fiber diameter of a control non-human animal of the same species, syngeneic or heterogeneous lineage. The average fiber diameter of the non-human animal having the above modification is 5-40%, 5-30%, 5-20%, 10-20%, 15-20%, 5-15%, 10-15% or 5-10% thinner than the average fiber diameter of the control non-human animal of the same species or allotype. The genetically modified animal having an average fiber diameter that is 5-20%, 10-20%, 15-20%, 5-15%, 10-15% or 5-10% thinner than the average fiber diameter of the control non-human animal of the same species or allotype can be selected from the animals having the above modification.

[0199] A reduction in fiber diameter can generate commercial value. For example, cashmere is graded based on the characteristics of animal fibers, including the average fiber diameter (see Table 1). Based on this, a 5% reduction in fiber diameter can be expected to be a reduction in the average diameter fiber diameter of 0.75μm to 0.95μm, indicating an increase in grade from 1 to 2 levels. In addition, a 20% reduction in fiber diameter means a reduction from the maximum diameter of 19μm in level 3 to 15.2μm, meaning an increase in grade from level 3 to the highest level. The value of the transformation technology that brings about this increase in grade is considered to be destructive.

[0200] [Table 1]

[0201]

[0202] The average fiber diameter can be measured, for example, by observing the diameter of the same part of two or more animal fibers collected from the same body surface part of non-human animals of the same age using an optical or electron microscope (for example, animal fibers are collected from the same part of non-human animals, and the animal fibers are cut from the hair root part of the animal fibers to a predetermined length or in the same way, and the diameter of the animal fibers is a predetermined length from the root of the cut animal fibers). As another measurement method, the average fiber diameter of the animal fibers can be measured by any method such as a method used in wool fiber testing methods, for example, a projection microscope (IWTO1-8, referring to the standard of JIS L 1081 A) using two or more animal fibers obtained from non-human animals of the same age, air flow (IWTO-28, referring to the standard of JIS L 1081 B), laser scanning (referring to the standard of JIS L 1081 C), and an optical analyzer (IWTO-47, referring to the standard of JIS L 1081 D). The diameter of the animal fiber is preferably the major diameter.

[0203] Therefore, in one embodiment, the present invention can be a method for producing animal fibers having a finer average fiber diameter. In this embodiment, in addition to reducing the expression or function of one or more genes selected from one or more genes in the Krt or KAP family constituting the non-human animal, any one or more steps such as raising the non-human animal and harvesting the animal fibers of the non-human animal can be included.

[0204] It is known that the average fiber diameter contributes to the improvement of the properties of fiber products such as hand feel, skin feel, wearing feel, gloss, elasticity, warmth retention, quick drying, etc. Therefore, the fiber products produced by the present invention can obtain fiber products with improved properties selected from the group consisting of hand feel, skin feel, wearing feel, softness, elasticity, warmth retention, quick drying, and gloss.

[0205] In one embodiment, a non-human animal produced by the method of the present invention has a smoother fiber surface than a control non-human animal of the same species or a different species. "Smooth fiber surface" specifically means, for example, that the scales present on the surface of the animal fiber have a small scale thickness and / or a long scale interval. "Scale" refers to a scaly structure arranged in a pine cone shape on the surface of the animal fiber, which overlaps with other scales on the hair root side of the animal fiber, and the unevenness of the surface of the animal fiber is generated by the overlap. In feather fibers, there is a structure called "knot" or "node" similar to the scale, and the "scale" of the present invention also includes the knot or node in the feather fiber.

[0206] In this specification, the scale thickness refers to the thickness of the convex part where a certain scale overlaps with other scales. If the scale thickness decreases, the convex thickness decreases, so if, for example, the average scale thickness decreases, it can be understood that an animal fiber "with a smooth surface" is obtained. In one embodiment of the present invention, the scale thickness of an animal fiber selected from a non-human animal in which one or more genes constituting one or more genes of the Krt or KAP family are knocked out is significantly smaller than the average scale thickness of a control non-human animal of the same species or a different species, especially a wild type.

[0207] The average scale thickness can be measured by observing the scale thickness of scales existing in the same position on two or more animal fibers collected from the same body surface part of non-human animals of the same age using an optical or electron microscope (for example, animal fibers are collected from the same body surface part of non-human animals, and animal fibers are cut from the hair root part of the animal fibers at a prescribed length or in the same way, and the scale thickness of scales existing at a prescribed length from the root of the cut animal fibers). The difference in average scale thickness can be evaluated visually, so the measurement does not need to be expressed in numerical form. For example, electron microscope images of animal fibers of non-human animals produced by the method of the present invention and animal fibers of control non-human animals of the same species, the same strain, or the same species can be compared, and the shadows shown by the scales, the outlines of the scales, etc. can be used as indicators to evaluate the reduction in average scale thickness. "Small scale thickness" means that the shadows shown by the scales are thin and the outlines of the scales are not clear, compared with, for example, animal fibers of control non-human animals of the same species, the same strain, or the same species. When the average scale thickness can be measured numerically, it means that the scale thickness is, for example, 98% or less, 96% or less, 95% or less, 93% or less, 90% or less, 85% or less, 80% or less, 75% or less, preferably 70% or less, more preferably 65% ​​or less, further preferably 30% or less, and more preferably 20% or less, compared to animal fibers of a control non-human animal of the same species or a different species.

[0208] The gloss can be evaluated by visually observing the parts existing in the same position on two or more animal fibers collected from the same body surface part of non-human animals of the same age and controls (for example, animal fibers are collected from the same body surface part of non-human animals, and animal fibers are cut from the hair root part of the animal fibers at a prescribed length or in the same way, and the distance from the root of the cut animal fibers is a prescribed length). The evaluation can be performed by an evaluation team composed of multiple people. The evaluation team can evaluate the gloss of the animal fibers based on a prescribed score related to the quality of the gloss. In the scoring, for example, 5 points can be set for excellent gloss, 3 points for average or equal to the control, 1 point for poor gloss, 4 points for the highest point and the average, and 2 points for the average and the lowest point.

[0209] In one embodiment of the present invention, the scale intervals of fibers of non-human animals in which one or more genes selected from one or more genes constituting the Krt or KAP family are knocked out are significantly longer than the scale intervals of control non-human animals, particularly wild-type animals.

[0210] The scale spacing refers to the long diameter of each scale. If the long diameter of each scale existing on the surface of the animal fiber becomes longer, the number of scales existing in a specified fiber length will decrease. For example, in an animal fiber with scales having a scale spacing of 25 μm, there are 4 scales per 100 μm, while in contrast, in scales having an average scale spacing of 50 μm, there are only 2 scales per 100 μm, so the frequency of unevenness caused by the scales is reduced. Therefore, if the scale spacing, especially the average scale spacing, becomes longer, it can be understood that it brings a "smooth fiber surface".

[0211] The average scale spacing can be measured by observing the scale spacing of the same portion of two or more animal fibers collected from the same body surface portion of non-human animals of the same age using an optical or electron microscope (for example, the scale spacing of scales in a portion of a specified length from the hair root portion of the animal fiber collected from the same body surface portion of the non-human animal, or the scale spacing of scales in a portion of a specified length from the root portion of the animal fiber cut from the hair root portion of the animal fiber using the same method).

[0212] “Long scale interval” means, for example, that the average scale interval measured as described above is 102% or more, 105% or more, 110% or more, 120% or more, 130% or more, 140% or more, 150% or more, 160% or more, preferably 170% or more, and more preferably 180% or more longer than that of a control non-human animal, for example, 105% to 180% longer.

[0213] It has long been known that scales on animal fibers are the cause of the entanglement and curling of pilling and felt formed in woven and knitted fiber products. In addition, scales are not only the cause of irritation when wearing fiber products, but also the cause of damage to the gloss, softness, smoothness, etc. of the products themselves. In order to deal with such problems, the following methods are adopted: chemical and physical methods such as acidifiers, enzymes, plasma discharge, etc. are used to remove scales, or the unevenness of scales is covered by coating resin.

[0214] Therefore, in one embodiment, the present invention is also a method for producing a fiber product, wherein the fiber product comprises an animal fiber having one or more properties selected from the group consisting of being less likely to form pills and / or felt, having high softness, having a strong smooth feeling, having little irritation, having a strong glossiness, and having no curling. This method may include: reducing the expression or function of one or more genes selected from one or more genes constituting the Krt or KAP family of a non-human animal, harvesting animal fibers of a non-human animal, manufacturing a fiber product using the harvested animal fibers, and any one or more steps.

[0215] This method preferably does not include peeling or covering the scales. In one embodiment, the animal fiber products obtained by the non-human animal prepared by the method of the present invention are known to be less prone to hairball and / or felt formation, and are helpful for improving the properties of softness, non-irritation (hand feel, skin touch, wearing feeling), shrinkage resistance, etc. Therefore, it can be preferably used for the manufacturing purposes of fiber products with improved properties. In particular, as the average fiber diameter decreases, hairball and / or felt formation becomes easy to occur, so it is preferably used in the production of animal fibers such as cashmere, angora wool, angora goat wool, cashgrass goat wool, yak wool, northern goat wool, guanaco wool, musk ox wool, Tibetan antelope wool, raccoon wool, raccoon wool, mink wool, sable wool, fox wool, cuscus wool, opossum wool, beaver wool, seal wool, nutria wool, ferret wool, alpaca wool, wild duck wool, goose wool, domestic duck wool, ostrich wool, etc., which have finer average fiber diameters.

[0216] In one embodiment of the present invention, the animal fiber may be raw hair of an animal. Raw hair (especially animal hair) may generally include guard hair and down hair.

[0217] In one embodiment of the present invention, the animal fiber contains unwanted hair only in a proportion preferably less than 60% by weight, less than 50% by weight, less than 40% by weight, less than 30% by weight, less than 25% by weight, less than 20% by weight or less than 15% by weight. Regarding the unwanted hair, for example, in the case of animal hair (for example, goat hair (for example, cashmere, angora wool, angora goat hair and cashmere goat hair), it is pointer hair, etc. The animal fiber preferably contains more than 40% by weight, more than 50% by weight, more than 60% by weight, more than 70% by weight, more than 80% by weight or more than 85% by weight of undercoat. The unwanted hair is needle hair in goats (for example, cashmere goats, angora goats, angora goats and cashmere goats). Goats (for example, cashmere goats, angora goats, angora goats and cashmere goats) have down (also called undercoat or inner coat) in addition to needle hair.

[0218] The animal fibers are 5% or more, 6% or more, 7% or more, 8% or more, 9% or more, 10% or more, 11% or more, 12% or more, 13% or more, 14% or more, 15% or more, 16% or more, 17% or more, 18% or more, 19% or more, or 20% or more thinner in average fiber diameter than animal fibers from a control non-human animal of the same species, syngeneic or allogeneic lineage. The animal fibers are 50% or less, 40% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less thinner in average fiber diameter than animal fibers from a control non-human animal of the same species, syngeneic or allogeneic lineage. The animal fibers are 5-40%, 5-30%, 5-20%, 10-20%, 15-20%, 5-15%, 10-15%, or 5-10% thinner in average fiber diameter than animal fibers from a control non-human animal of the same species, syngeneic or allogeneic lineage. Such fibers can be obtained by screening the above-mentioned animal fibers using animal fibers harvested from the genetically modified animals of the present invention, or by harvesting (without or after screening) from genetically modified animals of the present invention having the above-mentioned fiber system.

[0219] The animal fiber obtained from the genetically modified animal contains less products of proteins encoded by the modified Krt gene and KAP gene in the genetically modified animal than a control non-human animal of the same species or different species. In a preferred embodiment, the animal fiber obtained from the genetically modified animal does not substantially contain proteins encoded by the modified Krt gene and KAP gene in the genetically modified animal.

[0220] In one embodiment, the non-human animal produced by the method of the present invention has a smaller average fiber diameter and a smoother fiber surface than the control non-human animal. Therefore, despite the smaller average fiber diameter, it is less likely to produce pilling and / or felt formation, and the quality can be maintained for a long time, and a wearable fiber product can be provided.

[0221] The average fiber diameter of the entire body hair of the animal produced by the method of the present invention is finer, and therefore, the animal fiber obtained from the animal can be produced by omitting the screening step of screening only the fine hair. Therefore, it is economically reasonable.

[0222] When there are individual differences in the average fiber diameter of the animal fibers of the non-human animals produced, the animal fibers can be recovered from the selected individuals after screening out the individuals with small average fiber diameters. Thus, the animal fibers with small average fiber diameters can be mainly recovered.

[0223] In one embodiment, raw wool of animal fiber can be obtained from non-human animals produced by the method of the present invention. According to the present invention, a method for obtaining manufactured wool from raw wool of animal fiber can be provided. The method for obtaining manufactured wool from raw wool of animal fiber can include: unhairing the raw wool, removing sand and dirt, washing the obtained raw wool (for example, including washing with a neutral detergent, hot water washing and water washing), and separating the down and needle hair mixed in the raw wool to take out the down (wool processing). It is generally believed that it is important to reduce the needle hair content as much as possible in the wool processing process while improving the yield. Wool processing is an important step in cashmere processing. Manufactured wool can be provided for dyeing as needed (for example, using a low-temperature dyeing method). Undyed manufactured wool or raw wool or dyed manufactured wool or raw wool is woven and processed into a coarse yarn, and the coarse yarn can be combined and processed into a plied yarn or a worsted yarn. Typically, the coarse yarn, plied yarn or worsted yarn is shipped after being bundled. The coarse yarn, plied yarn or worsted yarn is processed into different woven fabrics according to the purpose. In addition, the present invention can also provide manufactured wool, spun yarn, plied yarn, worsted yarn and woven fabric obtained from animal fibers. The manufactured wool, spun yarn, plied yarn, worsted yarn and woven fabric obtained in the present invention are derived from the animal fibers described above, and therefore have the average fiber diameter and / or scale spacing or scale thickness of the animal fibers described above. In addition, the wool-making process is often not carried out in the production of general fur (such as mink and sable fur), but can be carried out in the production of high-quality products (especially high-end products) such as cashmere.

[0224] In one embodiment, the animal fiber after the wool processing (such as "high quality" or "tops") has a lower content of unwanted hair (such as guard hair) than the original wool. The animal fiber after the wool processing contains only 60% by weight or less, 50% by weight or less, 40% by weight or less, 30% by weight or less, 20% by weight or less, 15% by weight or less, 10% by weight or less, or 5% by weight or less of unwanted hair. If the content of unwanted hair in the original wool is set to A, the content of unwanted hair in the animal fiber after the wool processing (B) can be 95% by weight or less of A, 90% by weight or less, 80% by weight or less, 70% by weight or less, 60% by weight or less, 50% by weight or less, 40% by weight or less, 30% by weight or less, 20% by weight or less, 15% by weight or less, 10% by weight or less, or 5% by weight or less. If the content of unwanted hair in raw wool is A, the content of unwanted hair in manufactured wool (B) may be, for example, 5 to 90% by weight, 5 to 60% by weight, 5 to 30% by weight, or 5 to 20% by weight. Therefore, the content of unwanted hair (e.g., needle hair) in woolen yarn, plied yarn, and worsted yarn is only 60% by weight or less, 50% by weight or less, 40% by weight or less, 30% by weight or less, 20% by weight or less, 15% by weight or less, 10% by weight or less, or 5% by weight or less. In addition, if the content of unwanted hair in raw wool is defined as A, the content of unwanted hair in the woolen yarn, plied yarn, and worsted yarn (C) may be 95% by weight or less, 90% by weight or less, 80% by weight or less, 70% by weight or less, 60% by weight or less, 50% by weight or less, 40% by weight or less, 30% by weight or less, 20% by weight or less, 15% by weight or less, 10% by weight or less, or 5% by weight or less of A. Of course, the animal fiber, woolen yarn, plied yarn, and worsted yarn thus obtained contain components based on the above-mentioned gene mutation. That is, the animal fiber, slub yarn, plied yarn and worsted yarn thus obtained contain only less modified gene products than the wild type (for example, only contain 50% by weight or less, 40% by weight or less, 30% by weight or less, 25% by weight or less, 20% by weight or less, 15% by weight or less, 10% by weight or less, 5% by weight or less, 3% by weight or less, 2% by weight or less, or 1% by weight or less), or do not contain the product of the disrupted gene (for example, protein) as described above, or contain peptide molecules encoded by the disrupted gene (peptide molecules whose function is reduced or lost). Therefore, the obtained animal fiber, slub yarn, plied yarn and worsted yarn have different component contents (especially the ratio of protein contained) from the animal fiber, slub yarn, plied yarn and worsted yarn of the same species, homology or heterology non-human control animal. In addition, the animal fibers, spun yarns, plied yarns and worsted yarns thus obtained may have a thinner diameter (major diameter) as specified above compared to the same species, isogenic or heterogenic non-human control animals not having the above gene disruption.These characteristics may be at least characteristics common to the animal hair and the above-mentioned thread derived from the animal hair.

[0225] The "fiber products" in this specification are not limited as long as they include animal fibers obtained from animals produced by the method of the present invention, and include various forms of materials such as silk, thread (including woolen and fine yarn), fiber sheets, woven fabrics, knitted fabrics, cloth, clothing, non-woven fabrics, multiaxial fiber sheets, fur, and clothing (final products) such as coats, sweaters, scarves, shawls, shirts, pants, suits, jackets, skirts, blankets, throws, underwear, socks, gloves, etc. obtained therefrom. The fiber products also have the characteristics of the animal fiber, woolen yarn, plied yarn or fine yarn after the above-mentioned wool processing (for example, coarseness, scale spacing, scale thickness, unwanted hair content, component content).

[0226] The fiber products may not contain fibers other than the above-mentioned animal fibers, or may contain fibers other than the above-mentioned animal fibers. For example, the fiber products may be mixed with fibers of different species of animals, fibers of plant origin, or synthetic fibers, or may contain fibers of different species of animals, fibers of plant origin, or synthetic fibers. Fibers other than the above-mentioned animal fibers contained in the fiber products include natural fibers such as silk fibers, spider fibers, silk, cotton, hemp, and flax, synthetic fibers such as polyester, polyamide, acrylic, polyethylene, and polypropylene, and semi-synthetic fibers such as viscose rayon and cuprammonium rayon.

[0227] Example

[0228] The present invention will be described in more detail below with reference to examples, but the present invention is not limited thereto.

[0229] Example 1: Mass spectrometry analysis of animal fibers from mice, cashmere goats, and sheep

[0230] (1) Sample preparation

[0231] Animal fibers of wild-type mice (C57BL / 6N strain; purchased from SLC Co., Ltd., Japan, the same applies below), Cashmere goats, and sheep were added to 8M urea solution, and sonicated to dissolve. 0.26M DTT was added to it, and the sample was incubated at 37°C for 1 hour to reduce the protein in the sample. After that, 0.22M iodoacetamide (IAA) was added to the sample, and the sample was incubated at 37°C for 30 minutes to alkylate the protein. In order to precipitate and purify the protein from the sample, acetone precipitation was performed. In acetone precipitation, first, 10 times the amount of TCA / acetone (10% TCA in acetone) was added relative to the sample amount, and stirred. After the sample was allowed to stand overnight at -20°C, it was centrifuged at 15,000×g at 4°C for 10 minutes. After removing the supernatant, the pellet was washed in a small amount of cold acetone, and the supernatant was removed after centrifugation. After the acetone was volatilized, a 0.5M urea solution was added to redissolve the sample.

[0232] 0.2 mg / ml trypsin acetic acid solution was added to the sample and incubated overnight at 37°C for peptidation. After the incubation, formic acid (10%) was added to stop the reaction. The peptidated sample was desalted and concentrated using a GL-Tip (registered trademark) SDB pipette tip (GL Sciences Co., Ltd., Cat No. 7820-11200), and the peptide concentration was measured (Pierce Quantitative Colorimetric Assay Thermo Fisher, Cat No. 233275).

[0233] (2) Mass spectrometry and data analysis

[0234] The peptide samples thus obtained were analyzed by mass spectrometry (LC-MS / MS). An ultra-high resolution Fourier transform mass spectrometer (Orbitrap Fusion) (Thermo Fisher, Cat. No. IQLAAEGAAPFADBMBHQ) was used for the measurement as LC.

[0235] As a result, it is known that most of the main proteins constituting the animal fibers of mice, cashmere goats, and sheep are common. Animal fibers are formed by the differentiation and proliferation of hair matrix cells present in hair follicles and then keratinization. Therefore, the commonality of the constituent components of animal fibers reflects the commonality of the differentiation, proliferation and keratinization process of hair matrix cells in each animal, that is, the hair growth mechanism. Therefore, it is speculated that animals as a whole have a common hair growth mechanism. In addition, it is believed that the formation of animal fibers (body hair) is common in a wide variety of animal species. For example, the role of Fgf5 is common in various species including dogs, cats, mice and humans, and is also common in cashmere goats (X. Wang et al., Plos One, 11(10): e0164640, 2016). Fgf5 is an inhibitor of hair elongation, expressed in the outer root sheath, and controls the onset of regression in the hair growth cycle (JM Heabert et al., CELL, 78:1017-1025, 1994).

[0236] Example 2: Preparation of knockout mice

[0237] In the following, Krt71, Krt72, Krt73, Krt74, KAP8-1, KAP8-2, Tyr, and Fgf-5 were selected from a large number of genes considered to be involved in a common hair growth mechanism regardless of animal species, and disruption of each of these genes was attempted.

[0238] (1) Preparation of crRNA and tracrRNCas9 protein

[0239] CrRNA (Alt-R (trademark), CRISPR-Cas9 crRNA), tracrRNA (Alt-R (trademark) CRISPR-Cas9 tracrRNA, 5 nmol, Cat# 1072532) and Cas9 protein (Alt R (trademark) Sp Cas9 Nuclease V3, 100 μg Cat# 1081058) for Krt71, Krt72, Krt73, Krt74, KAP8-1, KAP8-2, Tyr, Fgf-5 of mice were purchased from Integrated DNA Technologies, Inc (hereinafter referred to as IDT, the United States). Three crRNA sequences were designed for each target gene, and the resulting crRNAs were added to Opti-MEMI (Thermo Fisher Scientific, Cat# 31985062) to reach 1 μg / μl, and dissolved. The nucleic acid sequence of the DNA target site in the crRNA sequence is shown below. It is expected that three different crRNA sequences can be targeted to three sites, and mutations can be introduced into up to three sites in each gene.

[0240] The sequence of the crRNA target for Krt71 KO (T changed to U on RNA)

[0241] Krt71 crRNA1: CCTACCGGGCAGGAGGCAAA (SEQ ID NO. 1)

[0242] Krt71 crRNA2: AGCGGGAAGAACGGAGGTTT (SEQ ID NO: 2)

[0243] Krt71 crRNA3:ACCTGATGGATACCGCCAGG (SEQ ID NO: 3)

[0244] The sequence of the crRNA target for Krt72 KO (T changed to U on RNA)

[0245] Krt72 crRNA2: GTCATCTCAGGCAGGCTCAG (SEQ ID NO: 4)

[0246] Krt72 crRNA3: AGAAGCCTGTTCTGTGTGGG (SEQ ID NO: 5)

[0247] Krt72 crRNA4: CGGGATAGAGGGTCAACTGG (SEQ ID NO: 6)

[0248] The sequence of the crRNA target for Krt73 KO (T changed to U on RNA)

[0249] Krt73 crRNA1:TCTTACCGGGCAGCCGGCAA (SEQ ID NO: 7)

[0250] Krt73 crRNA2: AGCGGGCGCACAGGGGGATA (SEQ ID NO: 8)

[0251] Krt73 crRNA3: AATCCATCCTTGTGCCTGCC (SEQ ID NO: 9)

[0252] The sequence of the crRNA target for Krt74 KO (T changed to U on RNA)

[0253] Krt74 crRNA1: GATTCCCTCCAAGACTGTAG (SEQ ID NO: 10)

[0254] Krt74 crRNA2: AGCTTTGGATATGGGTATGG (SEQ ID NO: 11)

[0255] Krt74 crRNA3: TCTGTCTGGGGGCATCTACC (SEQ ID NO: 12)

[0256] The sequence of the crRNA target for KAP8-1 KO (T changed to U on RNA)

[0257] KAP8-1 cRNA1: GTCTTCCCAGGATGCTACTG (SEQ ID NO: 13)

[0258] KAP8-1 cRNA2: CAGCCAACACTGTACCCCAG (SEQ ID NO: 14)

[0259] KAP8-1 cRNA3: GGTAGCACCTACTCTCCAGT (SEQ ID NO: 15)

[0260] The sequence of the crRNA target for KAP8-2 KO (T changed to U on RNA)

[0261] KAP8-2 cRNA1: GTAGCTGCCGTAGTAGCTCA (SEQ ID NO: 16)

[0262] KAP8-2 cRNA2: GGCTCTGGCATCCGAGGCTT (SEQ ID NO: 17)

[0263] KAP8-2 cRNA3: GGAGGTTACGGATATGGATC (SEQ ID NO: 18)

[0264] The sequence of the target site of crRNA for Tyr KO (T is changed to U on RNA)

[0265] Tyr crRNA1:TGCCAACAAGTTCTTAGAGG (SEQ ID NO: 19)

[0266] Tyr crRNA2: GGTCATCCACCCCTTTGAAG (SEQ ID NO: 20)

[0267] Tyr crRNA3: CAGTGCTCAGGCAACTTCAT (SEQ ID NO: 21)

[0268] Sequence of the target site of crRNA for Fgf5 KO (T changed to U on RNA)

[0269] Fgf5 crRNA1: CCCAAGCGCTGTGGATCAGG (SEQ ID NO: 22)

[0270] Fgf5 crRNA2: ACGTCGCGCTACTTCTGCCC (SEQ ID NO: 23)

[0271] Fgf5 crRNA3: GTTTCCAGTGGAGCCCTTCG (SEQ ID NO: 24)

[0272] (2) Electroporation

[0273] C57BL / 6N was purchased from SLC, Japan. Sperm masses were recovered from the epididymis of C57BL / 6N males. Incubation was performed in FERTIUP (trademark)-pre-sperm culture medium (Jiudong Co., Ltd. (hereinafter referred to as Jiudong), Japan). Egg masses were recovered from C57BL / 6N females that were induced to ovulate excessively using CARD HyperOva (trademark) (Jiudong) and recovered into CARDmHTF medium (Jiudong). The sperm suspension was added to the medium containing the eggs, thereby performing in vitro fertilization. After 3 hours of fertilization, the eggs were transferred to CARD KSOM medium (Jiudong) 3 times, thereby performing egg washing.

[0274] An electrode (BEX, Cat# LF501PT1-10) connected to GenomeEditor (BEX Co., Ltd. (hereinafter referred to as BEX), Japan, Cat# GEB15) was mounted on a stereomicroscope. The fertilized eggs cultured in CARD KSOM medium were washed twice with Opti-MEMI to remove the medium containing serum. Next, the fertilized eggs were arranged in the gap between the electrodes filled with a Duplex Buffer (IDT) solution (5μl) containing three crRNAs (66ng / μl), tracrRNA (100ng / μl) and Cas9 protein (100ng / μl) targeting the above genes, respectively, and electroporated. The electrical conditions were: 25V (3msec pulse + 97msec interval) for both one polarity and the opposite polarity 3 times each.

[0275] After electroporation, the fertilized eggs were immediately collected from the electrodes, washed once with M2 medium and twice with CARD KSOM medium. The fertilized eggs were then cultured in CARD KSOM medium at 37°C in a 5% CO2 incubator until the two-cell stage.

[0276] Example 3: Confirmation of gene mutation in knockout mice

[0277] The two-cell embryos were transplanted into the oviduct of pseudopregnant mice 0.5 days after mating. A portion of the ear was collected 3 weeks after production, treated in 50mM NaOH 90μl at 98°C for 10 minutes, neutralized with 1M TrisHCl (pH 8.0) 10μl, and the genomic DNA solution was collected. In order to investigate the mutations of each gene based on CRISPR / Cas9, the genomic region adjacent to each target sequence was amplified by PCR using the following specific primers.

[0278] Primer pair for confirmation of Krt71 KO

[0279] mKrt71_Miseq_Fw:

[0280] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATCTACCTTCCTCCTGCACCT (serial number 25)

[0281] mKrt71_Miseq_Rv:

[0282] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACATTGTTCAGAGCCTTGATCTGCT (serial number 26)

[0283] Primer pair for confirmation of Krt72 KO

[0284] Krt72 N-Fw: AATTAGCTGACTCCATCCTGCC (serial number 27)

[0285] Krt72 N-Rv: CCTTGATCTGCTCCCTCTCTTG (SEQ ID NO. 28)

[0286] Krt72-Miseq_Fw:

[0287] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCAGGAGTGCAGCTGTATCC (serial number 107)

[0288] Krt72-Miseq_Rv:

[0289] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACATTGAGTGGGGCCAGAAG (serial number 108)

[0290] Primer pair for confirmation of Krt73 KO

[0291] mKrt73_Miseq_Fw:

[0292] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTGTCTGTGGCTTCTTCAGGAT (sequence number 20)

[0293] mKrt73_Miseq_Rv:

[0294] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGAATTTGTTGTTCAGAGCCT (serial number 30)

[0295] Primer pair for confirmation of Krt74 KO

[0296] mKrt74_Miseq_Fw:

[0297] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTTGGCAACTGAACTTCAGGTC (serial number 31)

[0298] mKrt74_Miseq_Rv:

[0299] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAACTTGTCGTTCAGAGCCTTGAT (serial number 32)

[0300] Primer pairs for confirming KAP8-1 KO

[0301] Krtap8-1 Fw: AAGACCAAGCGCTTTTGAAGTC (sequence number 33)

[0302] Krtap8-1 Rv: AGGTGTCACAAAGCCTTCATGA (SEQ ID NO. 34)

[0303] KAP8-1-Miseq_Fw:

[0304] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGAATGAAAATGAGGGCCTTGTG (serial number 35)

[0305] KAP8-1-Miseq_Rv:

[0306] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGGTGTCACAAAGCCTTCATGA (serial number 36)

[0307] Primer pairs for confirming KO of KAP8-2

[0308] KAP8-2_Miseq_Fw:

[0309] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACAACGGAAGGGTATGTTCATGA (serial number 37)

[0310] KAP8-2_Miseq_Rv:

[0311] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACATTTCTTCTTGACTTGATTCACAGTCAG (serial number 38)

[0312] Primer pairs for confirmation of Tyr KO

[0313] Tyr Fw: CCAGGGGTTGCTGGAAAAGA (sequence number 39)

[0314] Tyr Rv:TCTTTTCGGAGACACTCAAATCA (sequence number 40)

[0315] Primer pairs for confirmation of Fgf5 KO

[0316] Fgf5 Fw:GAGGCTATGTCCACCCTGTG (sequence number 41)

[0317] Fgf5 Rv: GTCCCTCCCAGAACAGGTTT (SEQ ID NO: 42)

[0318] The PCR amplification product of each gene was purified, and the DNA sequence of the target site was analyzed using the second-generation sequencer Miseq (Illumina) and the contract sequencing service provided by Eurofinsgenomics Co., Ltd. (Japan).

[0319] As a result, having Figure 1-1 to Figure 8 One to three knockout mice with the mutant sequence of each gene were obtained. Figure 1-1 to Figure 8In the figure, the wild-type sequence (exon 1) and the mutated sequence (exon 1) of the knockout mouse are compared, and the deleted sequence in the knockout mouse is highlighted, the insertion is underlined, and the substitution is bolded.

[0320] It was confirmed that all the mutations obtained were gene disruptions caused by frameshifts in each gene.

[0321] Example 5: Determination of the fineness of knockout animal fibers using a scanning electron microscope

[0322] The Awl hair of 3-week-old wild-type and Krt71, Krt72, Krt73 or Krt74, or KAP8-1 or KAP8-2 knockout mice was observed. The cross-section of the Awl hair of the mouse at 2 mm from the front end was observed with a scanning electron microscope at 3000 times, and the long diameter was measured. Specifically, embedding, cutting and fixing were performed in the following order, and observation was performed with a scanning electron microscope.

[0323] [Shooting conditions]

[0324] Accelerating voltage: 5kV (high magnification observation mode) WD: 20mm

[0325] Observation angle: 0° (parallel to the hair) Observation magnification: 3000 times

[0326] [Fixed conditions]

[0327] Place each Awl hair (hereinafter referred to as sample) in a silicon mold with a 1mm groove, drip UV curing resin and let it flow into the mold. Adjust the position of the sample so that it does not touch the wall of the mold, and irradiate it under a 10W black light for more than 3 hours. After confirming the curing, scrape off the excess resin.

[0328] [Cut-section production]

[0329] The sample embedded in the resin was observed under a stereo microscope, and a single-edged razor was used to cut the part 2 mm from the tip of the hair. The position 2 mm from the tip of the hair was measured and determined using a JIS standard grade 1 metal ruler. The razor used for cutting was marked with an "×" and was prohibited from being used in subsequent cross-sectioning.

[0330] The observation sample is the hair root side, and the hair tip side is kept separately as a preliminary observation sample. The sample and the preliminary sample are numbered and stored in a sealed plastic box unless necessary.

[0331] [Sputtering Order]

[0332] The observation sample was fixed to a sample stand that could be observed at a right angle using an electron microscope. Au fine particles were applied for 120 seconds using an Au sputtering device (JFC-1200 FINE COATER (manufactured by JEOL Ltd.) (the theoretical value of the Au film thickness is about 20 nm).

[0333] [Electron microscope observation sequence]

[0334] The sample was observed using an electron microscope (VHX-D510 (manufactured by KEYENCE Corporation)). The observation direction was fixed at a position parallel to the embedding resin, and the long axis of the sample was measured after photographing. The photographing conditions were as follows.

[0335] [Shooting conditions]

[0336] Accelerating voltage: 5kV (high magnification observation mode) WD: 8mm

[0337] Observation angle: 0° (parallel to the embedding resin) Observation magnification: 3000 times

[0338] The results are as follows Fig.10 As shown. In addition, at least 10 hairs were collected from one individual of wild-type and knockout (KO) mice for observation. The fiber diameter (long axis) of the hair was standardized using the average fiber diameter of wild-type hair of the same age obtained at the same time.

[0339] As mentioned above Fig.10 As shown, it was reproducibly confirmed that the fiber diameter of the hair of each knockout mouse of Krt71, Krt72, Krt74 and KAP8-1 was reduced. In particular, a reduction in fiber diameter was observed in two or more mutants with different specific modes of destruction, indicating that the destruction of these genes contributes to the reduction in fiber diameter. It should be noted that the trend of the reduction in fiber diameter does not change due to observation using an optical microscope or the presence or absence of fixation in an electron microscope. In addition, it was clarified that the fiber diameter was reduced most strongly in the knockout of either Krt72 or KAP8-1. In particular, a reduction in fiber diameter of more than 10% was observed in Krt72 KO, and a reduction in fiber diameter of about 20% was observed in KAP8-1 KO.

[0340] Example 6: Observation of the scale structure of knockout animal fibers using a scanning electron microscope

[0341] The side of the Awl hair of all knockout mice (3 weeks old) was photographed at 1200 times the front end using a scanning electron microscope. Au particles were applied for 60 seconds (the theoretical value of the Au film thickness is about 5 nm) using an Au sputtering device (DII-29010SCTR Smart Coater, manufactured by JEOL Ltd.). No particular fixation was performed.

[0342] [Shooting conditions]

[0343] Accelerating voltage: 10kVWD: 20mm

[0344] Observation magnification: 1200 times

[0345] Based on images of the hair taken to measure the inter-scalar spacing of the hair, the extent of scaling was measured in each knockout mouse.

[0346] The results are shown in Fig.11 .like Fig.11 As shown, compared with the wild type, the scale spacing in the hair of Krt72 knockout mice and KAP8-1 knockout mice increased, and the number of scales contained in a certain length of hair decreased. In addition, it can be seen that in these knockout hairs, the scale thickness decreased, the outline of the scales was unclear, and the hair became smooth as a whole. In addition, it was confirmed that the hair of Krt72 knockout mice felt significantly smoother when bundled compared with the wild type. This is believed to be caused by the reduction in fiber diameter, the increase in scale spacing, and the reduction in scale thickness.

[0347] Example 7: Observation of fibers in Fgf-5 knockout animals

[0348] The Awl hair of 3-week-old wild-type mice and Fgf-5 knockout mice was collected and measured. The results are shown in Table 10. There was one mouse for each, n is the number of hairs measured, and the hair length (mm) shows their average length. "WT" means wild type.

[0349] [Table 2]

[0350]

[0351] In Fgf-5 knockout mice, hair length increased by 55% compared to wild-type mice.

[0352] Combining Fgf-5 with one or more gene disruptions selected from the group consisting of the above-mentioned Krp family or KAP family can produce an animal having a thinner fiber diameter and producing longer animal fibers.

[0353] Example 8: Observation of fibers in Tyr knockout animals

[0354] The photographs of 3-week-old wild-type mice (C57BL / 6N strain; black) and Tyr knockout mice are shown in Fig.12 It was confirmed that the hair of wild-type mice was black, whereas the hair of Tyr knockout mice turned white (refer to Fig.12 ).

[0355] By combining Tyr with one or more gene disruptions selected from the group consisting of the above-mentioned Krp family or KAP family, an animal having a thinner fiber diameter and producing white animal fibers can be obtained.

[0356] Combining Fgf-5 and Tyr with one or more gene disruptions selected from the group consisting of the above-mentioned Krp family or KAP family can produce an animal having a thinner fiber diameter and producing longer, white animal fibers.

[0357] Example 9: Analysis of Animal Fiber from Goats with Krt Family Gene Disruption

[0358] In this example, goats with a Krt72 gene disruption were prepared, and the diameter of the animal fibers was analyzed. As the animal fibers, undercoat was used.

[0359] (1) Preparation of crRNA and tracrRNCas9 protein

[0360] CrRNA (Alt-R (trademark), CRISPR-Cas9 crRNA), tracrRNA (Alt-R (trademark) CRISPR-Cas9 tracrRNA, 5 nmol, Cat# 1072532), Cas9 electroporation enhancer and Cas9 protein (Alt R (trademark) Sp Cas9 nuclease V3, 100 μg Cat# 1081058) for goat KAP8-1 were purchased from Integrated DNA Technologies, Inc (hereinafter referred to as IDT, the United States). The three crRNAs were added to Opti-MEMI (Thermo Fisher Scientific, Cat# 31985062) to reach 1 μg / μl and dissolved. The sequences of crRNA and electroporation enhancer are shown below.

[0361] [Table 3]

[0362]

[0363] (2) Electroporation

[0364] Male and female goats were purchased from Inoue Shoten. Synchronization was initiated by administering PG (Pronalgon F injection for animals (trademark) Zoetis), synchronization was performed by P4 (Lutinus vaginal tablet 100 mg (trademark) Ferring Pharmaceuticals), and follicle induction was initiated by E2 (animal biohormone injection (trademark) Aska Animal Health). PG and hCG (Gestoron 1500 (trademark) Kyoritsu Pharmaceutical) were administered to the female goat that had undergone excessive ovulation induction by the FSH (AntrinR10 (trademark) Kyoritsu Pharmaceutical) taper method, and then mated with a male goat. After ovulation, laparotomy was performed by inhalation anesthesia, and the uterine horn and ovary were removed and recovered. An indwelling needle (Surflow (trademark) TERUMO) was placed on the uterine horn side, and PBS (EMBRYOTECH (trademark) Nippon Zenyaku Kogyo Co., Ltd.) was used to perform fallopian tube reflux to recover the fertilized egg in vivo. The fertilized eggs were collected in a culture medium (BO-HEPES-IVM (trademark), ivf Bioscience), and then washed by transferring with a culture medium (BO-IVC (trademark), ivf Bioscience) three times.

[0365] An electrode (BEX, Cat# LF501PT1-10) connected to GenomeEditor (BEX Co., Ltd. (hereinafter referred to as BEX), Japan, Cat# GEB15) was mounted on a stereomicroscope. The fertilized eggs cultured in BO-IVC medium were washed twice with Opti-MEMI to remove the medium containing serum. Next, the fertilized eggs were arranged in the gap between the electrodes filled with Opti-mem solution (5μl) containing three crRNAs (120ng / μl) targeting KAP8-1, tracrRNA (120ng / μl) and Cas9 protein (100ng / μl), and electroporation enhancer (150ng / μl), and electroporation was performed. The electrical conditions were: 20V (3msec pulse + 97msec interval) for both one polarity and the opposite polarity 3 times each.

[0366] After electroporation, the fertilized eggs were immediately recovered from the electrodes, washed once with M2 medium and twice with BO-IVC medium. Then, the fertilized eggs were cultured in BO-IVC medium at 39°C and 5% CO2 in an incubator for 7 days until blastocysts formed.

[0367] (3) Mutation confirmation in knockout goats

[0368] Using laparotomy under inhalation anesthesia, the blastocyst embryos on the 7th day of culture were transplanted into the uterine horns of goats for transplantation that were synchronized and cultured on the 7th day. A part of the ear was collected within 1 week of production, treated in 50mM NaOH 90μl at 98°C for 10 minutes, neutralized with 1M Tris HCl (pH8.0) 10μl, and the genomic DNA solution was collected. In order to investigate the mutations of each gene based on CRISPR / Cas9, the genomic region adjacent to each target sequence was amplified by PCR using the following specific primers.

[0369] [Table 4]

[0370]

[0371] The PCR amplification product of each gene was purified, and the DNA sequence of the target site was analyzed using a contract sequencing service provided by Eurofinsgenomics, Inc. (Japan).

[0372] As a result, we obtain Fig. 9 Knockout goats with the mutant sequence. Fig. 9 In the figure, the wild-type sequence and the mutated sequence of the knockout goat are compared, the sequence missing in the knockout goat is highlighted, and the sequence of the coding region is represented by uppercase letters.

[0373] KAP8-1 (heterozygous) has a mutation sequence that causes the deletion of two amino acids (Y30 and G31) in an important region that is highly conserved across species, thereby disrupting the KAP8-1 gene.

[0374] According to the above example, the soft hair (undercoat) of goats 5 months after birth was collected, and the central 10 mm area of ​​the obtained soft hair was embedded with resin, and the long diameter of the hair was measured at 3 points in the area. Fig.13As shown, the average long diameter of the hair of the same goat before genetic modification was 14.55μm, while the average long diameter of the hair of the KAP8-1-destroyed goat was 11.46μm, and a reduction of more than 20% of the long diameter was observed. In addition, the difference in the above average long diameter was statistically significant (p<0.01). In addition, the surface of the soft hair of the wild-type goat and the KAP8-1-destroyed goat was observed using an electron microscope, and the width and number of scales were measured. For the width of the scales, the width of the scales on the upper and lower sides of the hair in the electron microscope image of the surface of the soft hair was measured respectively, and the average value was calculated and set as the scale width. The number of scales is set to the number of scales contained in the soft hair of a certain length in the electron microscope. As a result, in the soft hair of the wild-type goat, the scale width is 13.2μm, while in the KAP8-1-destroyed goat, the scale width is 14.0μm, and the scale width is larger. In addition, regarding the number of scales, the hair of wild goats contained an average of 13.2 scales, while the hair of goats destroyed by KAP8-1 contained only an average of 10.2 scales. This indicates that even in goats, the destruction of hair by KAP8-1 reduces the number of scales contained in hair of a certain length, that is, hair with a smooth feel and high gloss can be obtained.

[0375] Example 10: Immunoblotting of animal fibers from various animal species

[0376] Protein samples were prepared using hair from various animals, and Krt72 or KAP8-1 protein was detected using the immunoblotting method. Specifically, the method was performed as follows.

[0377] (1) Preparation of protein samples

[0378] The hair of various animals was cut into 2-3 mm lengths, washed with ethanol, and incubated at 37°C for 1 day in 8M urea, 0.1M Tris-HCl pH 8.0, 2% SDS, and 100mM DTT. Then, it was incubated at 60°C for 30 minutes and centrifuged at 10,000 rpm for 5 minutes. The supernatant was collected and an equal amount of 4× SDS sample buffer (wako) was added.

[0379] (2) Immunoblotting

[0380] Each protein sample (100 μg) was separated on an SDS gel and transferred to a PVDF membrane (Millopore) by electrophoresis. The transferred PVDF membrane was immersed in Blocking One (Nacalai tesque) and shaken at room temperature for 1 hour for blocking. The primary antibody used was the antibody shown in the table below, diluted with Blocking One 20 times diluted with PBST, and shaken at 4°C for 1 day. The secondary antibody used was Peroxidase AffiniPure Donkey Anti-Rabbit IgG (Jacksonimmune Research), diluted to 1:10000, and shaken at room temperature for 1 hour. Detection was performed using Western ECLblotting substrate (Bio-Rad).

[0381] [Table 5]

[0382]

[0383] The results are as follows Fig.14 Animal fibers obtained from any animal species contain Krt72 and KAP8-1, indicating that these hair components are common across species.

[0384] Example 11: Consistency of the amino acid sequences of each constituent component

[0385] Obtain KAP8-1 of various species from the database ( Fig.15 )、Krt71( Fig.16 )、Krt72( Fig.17 )、Krt74( Fig.18 ), and the consistency of the amino acid sequence was calculated. For the missing protein, Motif Search was used to determine the region that was conserved among animal species, and whether the region was a functional domain was confirmed based on the NCBI database, and the consistency of the amino acid sequence of the domain was calculated on this basis. As a result, any animal species showed high sequence consistency. It can be seen that the destroyed genes have high sequence consistency across species, so it is believed that their protein functions are also conserved across species.

Claims

1. A genetically modified animal or animal fiber thereof, which is a genetically modified animal or animal fiber thereof, wherein: The animal has animal fiber, The genetic modification is the reduction or deletion of the expression or function of one or more genes constituting the Krt family or the KAP family, or the destruction of the one or more genes.

2. A genetically modified animal or animal fiber thereof, which is the genetically modified animal or animal fiber thereof as claimed in claim 1, wherein: (i) animal fibers from animals having the genetic modification have a smaller major diameter than animal fibers from animals not having the genetic modification, and / or (ii-1) the content of the protein encoded by the one or more genes in the animal fiber of the animal with the genetic modification is lower than that in the animal fiber of the animal without the genetic modification, or (ii-2) the animal fiber of the animal with the genetic modification does not contain the protein encoded by the one or more genes.

3. A genetically modified animal or animal fiber thereof, which is the genetically modified animal or animal fiber thereof as described in claim 1 or 2, wherein: Compared to animal fibers from animals without the genetic modification, animal fibers from animals with the genetic modification have a major diameter that is 5% or more, 10% or more, or 15% or more smaller.

4. A genetically modified animal or animal fiber thereof, which is the genetically modified animal or animal fiber thereof according to any one of claims 1 to 3, wherein: The one or more genes constituting the Krt family or the KAP family include at least Kap8-1.

5. The genetically modified animal or animal fiber according to any one of claims 1 to 3, wherein The one or more genes constituting the Krt family or the KAP family include at least one or more genes selected from the group consisting of Krt71, Krt72 and Krt74.

6. The genetically modified animal or animal fiber according to any one of claims 1 to 5, wherein The genetic modification also includes the reduction or deletion of the expression or function of any one or both of the FGF-5 gene and the Tyr gene, or the destruction of the gene.

7. An animal fiber, which is the animal fiber according to any one of claims 1 to 6.

8. A cloth, woven fabric or fiber product comprising the animal fiber according to claim 7.

Images