Method for high-throughput screening of high-yield strains of antioxidant substances

Abstract

The invention discloses a high-throughput screening method for high-yield strains of antioxidant substances, and belongs to the technical field of high-throughput screening. According to the invention, a biosensor is constructed through G4 / hemin peroxidase mimetic enzyme, rhodamine B and hydrogen peroxide to sense a plurality of antioxidant substances. The reaction efficiency of the sensor is higher than that of other sensors, and the reaction can be almost completed while hydrogen peroxide is added. The sensor can be used for all antioxidant substances, and the research and development cost is reduced. Compared with other sensors, the response range is wider, the response multiple is higher, under the action of 100 mg / L EGT, the fluorescence of a rhodamine sensor can reach 85 times, the fluorescence of a ribose switch sensor only reaches 5 times, and meanwhile, the response range is more stable than other sensors.

Description

Technical Field

[0001] The invention relates to a method for high-throughput screening of antioxidant high-yield strains, belonging to the technical field of high-throughput screening. Background Art

[0002] A biosensor is an instrument that is sensitive to biological substances and converts their concentration into electrical signals for detection. It has the functions of a receiver and a converter. Biosensors use immobilized biological sensitive materials (such as enzymes, antibodies, antigens, microorganisms, cells, tissues, nucleic acids and other bioactive substances) as recognition elements, combined with appropriate physical and chemical transducers (such as oxygen electrodes, photosensitive tubes, field effect tubes, piezoelectric crystals, etc.) and signal amplification devices. According to different classification standards, biosensors can be divided into many types. According to the classification of life substances used in the receptors, biosensors can be divided into microbial sensors, immune sensors, tissue sensors, cell sensors, enzyme sensors, DNA sensors, etc. However, there are still certain deficiencies in biosensor research. First, the stability of biosensors still needs to be improved, especially the anti-interference ability of environmental factors such as temperature and humidity. Secondly, the sensitivity and selectivity of current biosensors still cannot meet the needs of some complex systems, such as fermentation systems. Compared with other biosensors, the advantages of enzyme biosensors mainly include low cost, good specificity, fast analysis speed, high accuracy, simple operating system, and the advantages and high sensitivity of insoluble enzyme systems. The research and application of enzyme biosensors have been very extensive, including but not limited to the detection of blood sugar content, determination of amino acid content, determination of blood lipids, determination of penicillin concentration, determination of urea, and determination of enzyme content in blood. However, it has not been applied to the work of screening high-yield strains. In addition, the current sensors only respond to a specific substance. For example, there are many kinds of antioxidants, so the existing sensors are not suitable for the screening of high-yield strains of antioxidants. Summary of the invention

[0003] The purpose of the present invention is to provide a method for high-throughput screening of strains with high antioxidant production, wherein a G-quadruplex structure (G4) is formed by a DNA fragment of a structural unit rich in G bases, and the parallel G4 structure in the molecule forms a complex with hemin to have high peroxidase activity. The effect of rapid and efficient degradation of rhodamine B by simulating the catalytic action of peroxidase by Hemin / G quadruplex is manifested as fading of red color, and the addition of antioxidants can inhibit the oxidation reaction, and the red color does not disappear at this time. The antioxidant activity of the antioxidants can be reflected by the red fluorescence intensity, thereby solving the technical problem that the existing sensors are not suitable for screening strains with high antioxidant production.

[0004] The first technical solution provided by the present invention is a biosensor responsive to antioxidant substances, comprising a sensing system composed of G4 / hemin peroxidase mimetic enzyme, rhodamine B and hydrogen peroxide.

[0005] In certain embodiments, the construction of G4 / hemin peroxidase mimetic enzyme: G4-DNA solution and hemin solution are mixed at a volume ratio of 80:1, incubated at 30° C., 300 r. for 2-3 h, and the nucleotide sequence of the G4-DNA is TGAGGGTGGGTAGGGTGGGTAA.

[0006] In certain embodiments, in the sensing system, the concentration of the G4 / hemin peroxidase mimetic enzyme is 0.1-5.0 μmol / L, the concentration of the rhodamine B is 5-100 mg / L, and the concentration of the hydrogen peroxide is 0.001875-0.015%.

[0007] In certain embodiments, the sensing system includes 1 μmol / L of G4 / hemin peroxidase mimetic enzyme, 50 mg / L of rhodamine B, and 0.0075% of hydrogen peroxide.

[0008] In certain embodiments, the antioxidant substances include EGT, vanillin, SOD, ferulic acid, dihydroquercetin, quercetin, vitamin E, astaxanthin and ginsenoside F2, etc.

[0009] The second technical solution provided by the present invention is a high-throughput screening method for strains with high production of antioxidant substances. The method comprises adding the strain to be screened into the biosensor described in the first technical solution, characterizing the antioxidant activity of the antioxidant substances in the culture solution by the red fluorescence intensity in the sensing system, and screening out the strains with high production of antioxidant substances.

[0010] In some embodiments, the steps include:

[0011] S1. Preparation of bacterial suspension: adding the bacterial suspension of the strain to be screened to the biosensor described in the first technical solution to obtain a mixed solution;

[0012] S2, droplet generation, using the mixed solution of S1 to generate droplets using a droplet microfluidic cell sorting system and a droplet generation chip;

[0013] S3, droplet sorting, after the droplet culture of S2 is completed, the droplet microfluidic cell sorting system and the droplet sorting chip are used to sort the droplets with higher red fluorescence, which are positive droplets;

[0014] S4, plate culture and verification, the positive droplets of S3 are demulsified and plated, the single strain obtained by culture is verified for yield, and the strain with high yield of antioxidant substances is screened out.

[0015] In certain embodiments, in S1, the bacterial suspension of the strain to be screened is adjusted to an OD of 0.05 and added to the sensing system.

[0016] In certain embodiments, in S2, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600 psi, the pressure of channel 2 is set to 400 psi, the generation speed is set to 1000 / sec, and the generation diameter is set to 25 μm.

[0017] In certain embodiments, in S2, the generated droplets are cultured for 18-48 hours, with 48 hours being the best, and the incubation temperature is 30°C.

[0018] In some embodiments, in S3, channel 1 is connected to the droplet generation oil, channel 2 is connected to the droplet, the pressure of channel 1 is 600psi, the pressure of channel 2 is 450psi, and the sorting is performed at a speed of 300 pieces / second. The laser power is set to 100mW, the PMT value is 0.45, the electric field strength is 45, and the sorting time is 220μs.

[0019] In certain embodiments, in S3, the positive droplets screened are the top 1% high fluorescence droplets.

[0020] In certain embodiments, in S4, the demulsification method is to add 100 μL of 1H,1H,2H,2H-perfluoro-1-octanol and 100 μL of culture medium to the droplets obtained by sorting, flick with a finger for 3 minutes, let stand for about 5 minutes, and aspirate the aqueous phase off the coating plate.

[0021] The present invention also provides a third technical solution, which is the use of the biosensor described in the first technical solution in high-throughput screening of antioxidant high-producing strains.

[0022] In certain embodiments, the antioxidant substances include EGT, vanillin, SOD, ferulic acid, dihydroquercetin, quercetin, vitamin E, astaxanthin and ginsenoside F2, etc.

[0023] The technical effects of the present invention are as follows:

[0024] 1. The sensor used in the present invention has a higher reaction efficiency than other sensors. Other sensors require reaction time, while the sensor in the present invention can complete the reaction almost at the same time as hydrogen peroxide is added.

[0025] 2. The sensor of the present invention can target all antioxidant substances, thus reducing R&D costs.

[0026] 3. Compared with other sensors, the sensor of the present invention has a wider response range and a higher response multiple. Under the action of 100 mg / LEGT, the fluorescence of the rhodamine sensor can reach 85 times, while that of the riboswitch sensor can only reach 5 times.

[0027] 4. The sensor in the present invention is more stable than other sensors.

[0028] 5. There is no literature report on combining rhodamine and hydrogen peroxide mimetic enzyme system with high-throughput screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the sensor of the present invention.

[0030] Figure 2 This is a map of the pET28a-GFP plasmid.

[0031] Figure 3 The growth of the strain under the action of different concentrations of hydrogen peroxide.

[0032] Figure 4 For different concentrations of H 2 O 2 EGT response curve under action.

[0033] Figure 5 The results of microscopic examination were performed after the droplet culture was statically cultured at 37°C for 16 h.

[0034] Figure 6 The results of microscopic examination were performed after 40 h of droplet culture.

[0035] Figure 7 Verify the results for demulsification coating.

[0036] Figure 8 It is pET21a-Apt-GFP plasmid.

[0037] Fig. 9 In the sensor response curve, a is the rhodamine sensor and b is the riboswitch sensor.

[0038] Fig.10 Sensor stability A. Rhodamine sensor B. Riboswitch sensor.

[0039] Fig.11 The fluorescence changes of the droplets before and after injection under the action of different concentrations of EGT.

[0040] Fig.12 This is the result of microscopic observation after sorting.

[0041] Fig.13 For droplet generation.

[0042] Fig.14 For droplet microinjection.

[0043] Fig.15 For droplet sorting.

[0044] Fig.16 Verify the results for the orifice plate. DETAILED DESCRIPTION

[0045] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0046] The culture medium used in the embodiment is:

[0047] 1. Preparation of G4-DNA solution: Dissolve the intramolecular parallel G4-DNA (TGAGGGTGGGTAGGGTGGGTAA) in buffer and heat at 95°C for 10 min, cool to room temperature, stand at 4°C overnight for use, and the concentration is 10 μmol / L.

[0048] 2. Preparation of hemin solution: Dissolve hemin in dimethyl sulfoxide to a concentration of 1.3 mg / mL.

[0049] 3. Construction of peroxidase mimetic enzyme: Mix the above G4-DNA solution and hemin solution in a volume ratio of 80:1, incubate at 30°C, 300r for 2-3h to obtain peroxidase mimetic enzyme.

[0050] 3. Buffer: 50 mM Tris-HCl, 100 mM KCl, pH 7.4.

[0051] 4. Inorganic salt culture medium: 4g / L (NH 4 ) 2 HPO 4 , 13.3g / L KH 2 PO 4 , 1.7 g / L citric acid, 1% trace salt solution, 1.2 g / L MgSO 4 , 0.5 g / L glucose, 10 g / L glycerol, adjust the pH to 7.0 with NaOH, and sterilize by high pressure at 121°C for 20 min.

[0052] 5. EGT fermentation medium: 4g / L (NH 4 ) 2 HPO 4 , 13.3g / L KH 2 PO 4 , 1.7 g / L citric acid, 1% trace salt solution, 1.2 g / L MgSO 4, 0.5 g / L glucose, 10 g / L glycerol, 1 g / L methionine, 1 g / L arabinose, adjust pH to 7.0 with NaOH, sterilize by autoclave at 121°C for 20 min

[0053] Plasmids and strains used in the examples:

[0054] 1. The vector pET28a was purchased from Yunzhou Biotechnology.

[0055] 2. Escherichia coli BW25113 was purchased from Mingzhou Biotechnology.

[0056] 3. pCas plasmid was purchased from CoMiao Biotechnology.

[0057] Example 1 Selection of antioxidant substances

[0058] The schematic diagram of the sensor of the present invention is as follows Figure 1 As shown, the rhodamine sensor was verified using biosynthesized antioxidants according to the reaction system shown in Table 1. The antioxidants included EGT, vanillin, SOD, ferulic acid, dihydroquercetin, quercetin, vitamin E, astaxanthin, and ginsenoside F2.

[0059] Table 1 Reaction system:

[0060]

[0061]

[0062] Table 2 Reaction results:

[0063] Antioxidants Phenomenon Comparison Red fades EGT Red does not fade Vanillin Red does not fade SOD Red does not fade Ferulic acid Red does not fade Dihydroquercetin Red does not fade Quercetin Red does not fade Vitamin E Red does not fade Astaxanthin Red does not fade Ginsenoside F2 Red does not fade

[0064] From the results in Table 2, it can be seen that the red fluorescence of the control group without adding antioxidants faded, indicating that the sensor can react normally. After adding antioxidants, the red fluorescence remained red and did not fade, indicating that antioxidants can inhibit the decomposition of rhodamine. Subsequently, the yield can be detected by detecting the red fluorescence intensity, which can be applied to high-throughput screening.

[0065] Example 2 Rhodamine sensor system optimization

[0066] Taking the antioxidant substance EGT as an example to optimize the rhodamine sensor system:

[0067] 1. Selection of G4 / hemin peroxidase mimetic enzyme concentration

[0068] Using the reaction system in Table 1, the effects of final concentrations of 0.1, 0.2, 0.5, 1.0, 2.5, and 5.0 μmol / L peroxidase mimics on the degradation reaction were verified. The results showed that when the peroxidase mimics had a lower concentration of 0.1, 0.2, and 0.5 μmol / L, the reaction time was longer; when the concentration was higher, 2.5 and 5.0 μmol / L, the reaction time was shorter, but the amount of DNA required was larger, so the cost was relatively large. Therefore, a medium concentration of 1 μmol / L (final concentration) peroxidase mimics was selected for the degradation reaction.

[0069] 2. Selection of Rhodamine B solution concentration

[0070] Using the reaction system in Table 1, the effects of different rhodamine B concentrations of 5, 10, 20, 50, and 100 mg / L on the reaction were compared. The results showed that at lower concentrations of 5, 10, and 20 mg / L, the reaction time was shorter, but the fluorescence value was lower, which was not convenient for detecting higher concentrations of antioxidant substances. At a higher concentration of 100 mg / L, it could still be degraded well, but its concentration was higher and the antioxidant concentration was lower and could not be well distinguished. Therefore, a medium concentration of 50 mg / L rhodamine B was selected for the degradation reaction.

[0071] 3. Optimization of hydrogen peroxide concentration

[0072] The GFP gene (SEQ ID NO: 1) was connected to the linearized vector pET28a by homologous recombination to obtain the pET28a-GFP plasmid ( Figure 2 ). The pET28a-GFP plasmid was introduced into BW25113 to obtain BW25113-pET28a-GFP.

[0073] 1) Different concentrations of H 2 O 2 Growth of strains under the action of

[0074] The BW25113 strain was inoculated into EGT fermentation medium at 1% and activated overnight at 37°C and 200 rpm. 600 Then dilute to about 0.05 with EGT fermentation medium, add rhodamine and G4 / Hemin according to Table 1 and mix well. Add H at final concentrations of 0.001875%, 0.00375%, 0.0075% and 0.015% 2 O 2 After reacting for 1 hour, the cells were spread on LB plates and cultured at 37°C overnight to observe their growth.

[0075] The results are as follows Figure 3 As shown, 0.015% H 2 O 2Under the action of 0.001875%, 0.00375%, and 0.0075% H 2 O 2 The growth of the strain was not affected.

[0076] 2) Offline verification of different concentrations of H 2 O 2 Response curve of EGT under action

[0077] Add the reaction system according to Table 3, mix well, and then dilute with 50 μL of fermentation medium. 550-580 , and make a standard curve. The results are as follows Figure 4 As shown, H 2 O 2 When the concentration is 0.0075% and 0.015%, the fluorescence is proportional to the concentration of EGT. The detection range of EGT is 1-100 mg / L. 2 O 2 When the concentration is 0.001875% and 0.00375%, the fluorescence is proportional to the concentration of EGT. The detection range of EGT is 10-100 mg / L, but there is no high concentration of H 2 O 2 Good linearity.

[0078] Table 3 Reaction system:

[0079] Components Volume (μL) 1250mg / mL Rhodamine 2 G4 / Hemin 5 EGT fermentation medium Add to 50 EGT Dilute from 100 mg / L, add 1 μL <![CDATA[H 2 THE 2 ]]> 1 (First dilute to 50 times the final concentration)

[0080] 3) Online verification H 2 O 2 Optimum concentration

[0081] Inoculate BW25113-pET28a-GFP and culture at 37°C, 200 rpm for 16 h. Centrifuge and resuspend. Adjust OD with mixed reagent 600About 0.05. The mixed reagent is: add 40 μL G4 / Hemin and 20 μL Rhodamine to 190 μL bacterial suspension, mix well, generate droplets on DREM cell using droplet microfluidic cell sorting system and droplet generation chip, connect channel 1 to droplet generation oil, connect channel 2 to bacterial suspension, set channel 1 pressure to 600 psi and channel 2 pressure to 400 psi on the control software, generate droplets with a diameter of 25 μm at a rate of 1000 per second and collect them in a Teflon tube for 30 minutes, inject hydrogen peroxide into droplets in a 1:1 ratio on DREM cell using droplet microfluidic cell sorting system and microinjection chip, dilute hydrogen peroxide to 0.015% first, connect channel 1 to droplet sorting oil, connect channel 2 to droplets, and connect channel 3 to hydrogen peroxide to be injected, adjust channel 1 pressure to 350 psi, channel 2 pressure to 350 psi, channel 3 pressure to 480 psi, and electric field strength to 50 on the control software, and inject at a rate of 350 per second. The concentrations of the microinjection reagent were 0.03%, 0.015%, 0.0075%, and 0.00375%, respectively, and no injection was used as a control (Table 2). After incubation for 16 hours, the growth of bacteria in the droplets was observed under a microscope. After microscopic examination, the emulsion was directly broken and the plate was smeared, and the growth of the colonies on the plate was observed again.

[0082] Table 4 Microinjection concentration

[0083] 0.00375％ 0.0075％％ 0.02％ 0.03％ Diameter before injection 25μm 25μm 25μm 25μm Diameter after injection 30μm 32μm 31μm 31μm Injection volume ratio 72.80％ 109.70％ 90.70％ 90.70％ Final concentration of hydrogen peroxide 0.00158％ 0.039％ 0.0071％ 0.0143％

[0084] After the droplets were cultured at 37°C for 16 hours, they were observed under a microscope. After microinjection of hydrogen peroxide at different concentrations, the bacteria in the droplets no longer divided and grew. However, under a microscope, the bacteria were still active and not dead. After another 24 hours of culture, the growth of the bacteria was observed.

[0085] The results of 40h culture were consistent with those of 16h culture. The droplets injected with hydrogen peroxide still did not grow, and the droplets contained single or double cells but the bacteria were still active.

[0086] After the collected droplets were cultured, 50uL LB medium and 50uL demulsifier were added. After shaking for 1min, the supernatant was taken and plated. The results are shown in Figure 7 The results show that when the final concentration of hydrogen peroxide was 0.00158%, 0.0039%, 0.0071% and 0.0143%, Escherichia coli was not killed, but its division and proliferation were inhibited. When diluted with excessive culture medium, Escherichia coli can grow on the plate. However, when the injection concentration was 0.03%, the number of growths on the plate was significantly reduced, and some bacteria may have been killed in the droplets. In addition, compared with the control group without hydrogen peroxide injection (non-microinjection group), after hydrogen peroxide injection, the colon did not express GFP protein and showed green, and hydrogen peroxide may have affected the expression of this gene.

[0087] In order to ensure that the growth of the strain and the fluorescence response multiple were not affected, 0.0075% H 2 O 2 The injection volume was verified on the DREM cell.

[0088] Example 3 Comparison of different sensors

[0089] 1) Response range comparison

[0090] Inoculate BW25113, culture at 37°C, 200 rpm for 16 h, centrifuge and resuspend. Use EGT fermentation medium to adjust the OD of the bacterial suspension to 600 to 0.5, and add peroxidase mimetic enzyme, rhodamine B, bacterial suspension and EGT to each component according to Table 5, H 2 O 2 Finally, add H 2 O 2 The final concentration was 0.0075%, and the total system was 50 μL. The concentrations of EGT were 0, 1, 2, 5, 8, 10, 20, 50, 80, and 100 mg / L. After mixing evenly, the mixture was incubated at FI 550-580 Detect the fluorescence intensity and draw a standard curve.

[0091] Table 5 Rhodamine sensor reaction system

[0092] Components Volume (μL) Hemin / G-quadruplex 5 Rhodamine B 2 <![CDATA[H 2 THE 2 ]]> 1 bacterial suspension 41 EGT 1

[0093] According to the ergothioneine (EGT) riboswitch screened by CN116656669A, the ergothioneine (EGT) sensor was constructed. The riboswitch sequence used was (SEQ ID NO: 2), and the homologous recombination method was used (reference method in the following document: Gibson DG, Young L, Chuang RY, et al. 2009b. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods [J], 6: 343-345). The EGT riboswitch connected with promoter J23119 (nucleotide sequence is shown in SEQ ID NO: 3) and GFP gene (nucleotide sequence is shown in SEQ ID NO: 1) were connected to the linearized vector pET21a ( Figure 8), pET21a-Apt-GFP plasmid was obtained, which is the EGT sensor. The pET21a-Apt-GFP plasmid was transferred into BW25113 to obtain BW25113-pET21a-Apt-GFP. At the same time, EGT was added to the BW25113-pET21a-Apt-GFP bacterial solution. The concentration of EGT was 0, 1, 2, 5, 8, 10, 20, 50, 80, 100 mg / L. After mixing evenly, the mixture was reacted at room temperature for 1 hour. 460-515 Detect the fluorescence intensity and draw a standard curve.

[0094] The response curves of the rhodamine sensor and the riboswitch sensor are shown in Fig. 9 As shown in Figure 2, the response range of the rhodamine sensor is 1-100 mg / L, and the linearity is very good. 2 is 0.999, the response range of the riboswitch sensor is 20-100 mg / L, the fluorescence is proportional to the concentration of EGT, R 2 It is 0.9659. Compared with the two, the response range of the rhodamine sensor is wider and the linearity is better. Under the action of 100 mg / L EGT, the fluorescence of the rhodamine sensor can reach 85 times, while that of the riboswitch sensor can reach 5 times. That is, the response multiple of the rhodamine sensor is higher, which is more conducive to the screening of high-yield strains.

[0095] 2) Stability comparison

[0096] Inoculate BW25113, culture at 37°C, 200 rpm for 16 h, centrifuge and resuspend. Use EGT fermentation medium to adjust the OD of the bacterial suspension to 600 to 0.5, and add peroxidase mimetic enzyme, rhodamine B, bacterial suspension and EGT to each component according to Table 3, H 2 O 2 Finally, add H 2 O 2 The final concentration was 0.0075%, the final concentration of EGT was 100 mg / L, and a total of 50 μL of the system was mixed evenly and incubated at FI for 0, 1, 4, 8, 12, 24, 48, and 72 h. 550-580 Detect the fluorescence intensity.

[0097] At the same time, EGT with a final concentration of 100 mg / L was added to the BW25113-pET21a-Apt-GFP bacterial solution, mixed evenly and reacted at room temperature for 1 h. 460.515 Detect the fluorescence intensity.

[0098] The experimental results are as follows Fig.10 As shown, the fluorescence of the rhodamine sensor can remain stable for 72 hours, while the fluorescence of the riboswitch sensor decreases after 12 hours and is 50% of the initial fluorescence after 72 hours.

[0099] Example 4 Online verification of fluorescence reaction

[0100] Inoculate BW25113, culture at 37°C, 200 rpm for 16 hours, centrifuge and resuspend. Set up 2 groups. The first group uses EGT fermentation medium to adjust the OD of the bacterial suspension. 600 To 0.05, add 40 μL G4 / Hemin and 20 μL Rhodamine to 190 μL bacterial suspension and mix well; the second group used EGT fermentation medium to adjust the bacterial suspension to OD 600 To 0.05, add 40 μL G4 / Hemin, 20 μL Rhodamine and 1 μL 2.5 g / L EGT to 189 μL bacterial suspension to make the final concentration of EGT 10 mg / L, and mix well.

[0101] Droplets were generated on the DREM cell using a droplet microfluidic cell sorting system and a droplet generation chip. Channel 1 was connected to droplet generation oil, and channel 2 was connected to a bacterial suspension. The pressure of channel 1 was set to 600 psi and that of channel 2 to 400 psi in the control software. Droplets with a diameter of 25 μm were generated at a rate of 1000 per second and collected in a Teflon tube for 30 minutes. After the droplets were collected, they were sealed with MMC oil and cultured at 37°C for 24 hours.

[0102] After the culture, the droplet microfluidic cell sorting system and the microinjection chip were used to inject hydrogen peroxide into the droplets in a 1:1 ratio in the DREM cell. The hydrogen peroxide was first diluted to 0.015%, and the channel 1 was connected to the droplet sorting oil, the channel 2 was connected to the droplets, and the channel 3 was connected to the hydrogen peroxide to be injected. The pressure of channel 1 was adjusted to 350psi, the pressure of channel 2 was adjusted to 350psi, the pressure of channel 3 was adjusted to 480psi, and the electric field strength was adjusted to 50 on the control software. The injection was carried out at a speed of 350 / second. After the injection was completed, the droplet microfluidic cell sorting system and the droplet sorting chip were immediately used. The channel 1 was connected to the droplet sorting oil, and the channel 2 was connected to the droplets. The pressure of channel 1 was adjusted to 600psi, and the pressure of channel 2 was adjusted to 450psi on the control software. The sorting was carried out at a speed of 300 / second. The laser power was set to 100mW, the PMT value was 0.45, the electric field strength was 45, and the sorting time was 220μs. The droplet fluorescence signal value was observed. After the observation, the droplets containing EGT and those without EGT were mixed in a ratio of 1:1, and then sorted using the droplet microfluidic cell sorting system and the droplet sorting chip. The droplets collected and screened at the channel outlet close to the electrode were positive droplets, and the channel outlet far from the electrode was negative droplets. After the sorting was completed, the droplet phase pressure was turned off, the oil pressure was maintained, and the droplets were flushed into the collection bottle with oil. The collection tube was pulled out and the mouth was facing upward, so that the internal liquid phase flowed into the collection bottle due to gravity, and the fluorescence was observed under a microscope.

[0103] The change of droplet fluorescence signal value before and after hydrogen peroxide injection under the action of different concentrations of EGT is shown in the figure. Fig.11 As shown in the figure, the signal value of the droplet without EGT becomes 0 after hydrogen peroxide is injected, indicating that the fluorescence of rhodamine degradation fades after the addition of hydrogen peroxide, while the signal of the droplet containing EGT decreases but does not disappear completely after hydrogen peroxide is injected, indicating that there are antioxidants in the droplet that inhibit the degradation of rhodamine. In high-throughput screening experiments, strains with high EGT production can be obtained by screening high-fluorescence droplets.

[0104] The droplets containing EGT and those without EGT were mixed in a ratio of 1:1 and then sorted. The sorting results were observed under a microscope ( Fig.12 ) It can be seen that the droplets sorted out from the negative channel have no fluorescence under red fluorescence, while the droplets sorted out from the positive channel have fluorescence, indicating that the antioxidant EGT in the droplets in the positive channel inhibits the decomposition of rhodamine.

[0105] Example 5 High-throughput sorting application

[0106] (1) Preparation of bacterial suspension:

[0107] The egt1 gene (SEQ ID NO: 4) and the egt2 gene (SEQ ID NO: 5) were connected to the linearized vector pET28a by homologous recombination to obtain the pET28a-egt1-egt2 plasmid.

[0108] The egt1 gene (SEQ ID NO: 4) and the egt2 gene (SEQ ID NO: 5) were targeted on the genome of Escherichia coli BW25113 using the CRISPR-Cas9 technology (refer to the method in the following literature: KOMOR AC, KIM YB, PACKER MS, ZURIS JA, LIU DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage [J]. Nature, 2016, 533(7603): 420-424) to obtain the strain BW25113-egt1-egt2, and the pET28a-egt1-egt2 plasmid was introduced into the two chassis cells of BW25113-egt1-egt2 and BW25113, respectively, to obtain the high-yield strain NC and the low-yield strain GRA.

[0109] The EGT high-producing strain NC and the low-producing strain GRA were cultured in LB medium at 37°C and 200 rpm overnight. The bacterial culture was taken to measure the OD 600Centrifuge and resuspend twice with EGT fermentation medium, dilute to about 0.05. Mix the bacterial solution at a ratio of 1:1. Add 40 μL G4 / Hemin and 20 μL Rhodamine to 190 μL of the mixed bacterial solution and mix well.

[0110] (2) Droplet generation

[0111] Using droplet microfluidic cell sorting system and droplet generation chip ( Fig.13 ), channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, the pressure of channel 1 is set to 600 psi, the pressure of channel 2 is set to 400 psi on the control software, droplets with a diameter of 25 μm are generated at a rate of 1000 / s and collected in a Teflon tube for 1 hour. After the droplets are collected, they are sealed with MMC oil and cultured at 30°C for 48 hours.

[0112] (3) Droplet microinjection

[0113] After the culture, the droplet microfluidic cell sorting system and droplet microinjection chip ( Fig.14 ) Inject hydrogen peroxide into the droplets at a ratio of 1:1. The hydrogen peroxide is first diluted to 0.015%. Channel 1 is connected to the droplet sorting oil, channel 2 is connected to the droplets, and channel 3 is connected to the hydrogen peroxide to be injected. The pressure of channel 1, channel 2, and channel 3 is adjusted to 350 psi, 350 psi, and 480 psi on the control software. The electric field strength is 50, and micro-injection is performed at a rate of 350 / sec.

[0114] (4) Droplet sorting

[0115] After the injection is completed, the droplet microfluidic cell sorting system and droplet sorting chip ( Fig.15 ), channel 1 is connected to the droplet sorting oil, channel 2 is connected to the droplets, and the pressure of channel 1 is adjusted to 600psi and the pressure of channel 2 to 450psi on the control software, and the sorting is performed at a rate of 300 per second. Set the laser power to 100mW, the PMT value to 0.45, the electric field strength to 45, the sorting time to 220μs, and adjust the screening threshold to screen out droplets with stronger fluorescence intensity. The droplets screened at the channel outlet close to the electrode are positive droplets, and the channel outlet away from the electrode is negative droplets. After the sorting is completed, turn off the droplet phase pressure, maintain the oil pressure, use oil to flush the droplets into the collection bottle, pull out the collection tube, and turn the mouth upwards so that the internal liquid phase flows into the collection bottle due to gravity, and observe the fluorescence under a microscope.

[0116] (5) Plate culture

[0117] Add 100 μl of 1H,1H,2H,2H-perfluoro-1-octanol and 100 μl of culture medium to the droplets obtained by sorting, flick with a finger for 3 minutes, and let stand for about 5 minutes to see two phases, the lower layer is transparent oil, and the upper layer is water. Pipette out the water phase and coat the plate. Place the coated LB plate in a 30°C incubator and culture for 24 hours.

[0118] (6) Orifice plate verification

[0119] The monoclone obtained after the positive droplet was demulsified and plated was activated with LB medium in a 96-deep-well plate. Each well contained 300 μL of medium and was cultured at 30°C and 800 rpm for 6 h to obtain the seed medium. Then 60 μL of the seed medium bacterial suspension was added to a 96-deep-well plate containing 540 μL of fermentation medium. After cultured at 30°C and 800 rpm for 24 h, the EGT yield in each well was detected.

[0120] The plate verification results are as follows Fig.16 As shown, the average yield of the positive channel is 78.38 mg / L, and the average yield of the negative channel is 31.12 mg / L. The positive, i.e., thioneine high-yielding strain NC, and the negative, i.e., thioneine low-yielding strain GRA can be basically separated. That is, the sensor can be applied to high-throughput screening of EGT high-yielding strains.

[0121] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A biosensor responsive to antioxidant substances, characterized in that: The sensing system includes G4 / hemin peroxidase mimetic enzyme, rhodamine B and hydrogen peroxide. In the sensing system, the concentration of the G4 / hemin peroxidase mimetic enzyme is 0.1-5.0 μmol / L, the concentration of the rhodamine B is 5-100 mg / L, and the concentration of the hydrogen peroxide is 0.001875-0.015%.

2. The biosensor according to claim 1, characterized in that The G4-DNA solution and the hemin solution were mixed at a volume ratio of 80:1, and incubated at 30° C. and 300 rpm for 2-3 hours. The nucleotide sequence of the G4-DNA was TGAGGGTGGGTAGGGTGGGTAA.

3. The biosensor according to claim 1 or 2, characterized in that: The sensing system includes 1 μmol / L of G4 / hemin peroxidase mimetic enzyme, 50 mg / L of rhodamine B, and 0.0075% of hydrogen peroxide.

4. The biosensor according to any one of claims 1 to 3, characterized in that: The antioxidant substances include EGT, vanillin, SOD, ferulic acid, dihydroquercetin, quercetin, vitamin E, astaxanthin, and ginsenoside F2.

5. A high-throughput screening method for strains with high antioxidant production, characterized in that: The method comprises adding the strain to be screened into the biosensor according to any one of claims 1 to 4, characterizing the antioxidant activity of the antioxidant substances in the culture solution by the red fluorescence intensity in the sensing system, and screening out the strain with high antioxidant production.

6. The method according to claim 5, characterized in that The steps include: S1. Preparation of bacterial suspension: adding a bacterial suspension of the strain to be screened to the biosensor according to any one of claims 1 to 4 to obtain a mixed solution; S2, droplet generation, using the mixed solution of S1 to generate droplets using a droplet microfluidic cell sorting system and a droplet generation chip; S3, droplet sorting, after the droplet culture of S2 is completed, the droplet microfluidic cell sorting system and the droplet sorting chip are used to sort the droplets with higher red fluorescence, which are positive droplets; S4, plate culture and verification, the positive droplets of S3 are demulsified and plated, the single strain obtained by culture is verified for yield, and the strain with high yield of antioxidant substances is screened out.

7. The method according to claim 6, characterized in that In S2, channel 1 is connected to the droplet generation oil, channel 2 is connected to the bacterial suspension, and the pressure of channel 1 is set to 600 psi, the pressure of channel 2 is set to 400 psi, the generation speed is set to 1000 / s, and the generation diameter is set to 25 μm. The incubation time of the generated droplets is 18-48h, with 48h being the best, and the incubation temperature is 30°C.

8. The method according to claim 6, characterized in that In S3, channel 1 is connected to the droplet generation oil, channel 2 is connected to the droplet, the pressure of channel 1 is 600psi, the pressure of channel 2 is 450psi, and the sorting is performed at a speed of 300 pieces / second. The laser power is set to 100mW, the PMT value is 0.45, the electric field strength is 45, and the sorting time is 220μs; The positive droplets screened were the top 1% of high-fluorescence droplets.

9. Use of the biosensor according to any one of claims 1 to 4 in high-throughput screening of strains with high antioxidant production.

10. The use according to claim 9, characterized in that: The antioxidant substances include EGT, vanillin, SOD, ferulic acid, dihydroquercetin, quercetin, vitamin E, astaxanthin, and ginsenoside F2.

Images