Preparation and application of a novel highly pathogenic duck reovirus and its egg yolk antibody

Abstract

The present invention discloses a novel highly pathogenic duck reovirus RD240407A and the preparation and application of its egg yolk antibody. Specifically, the deposit number of the novel duck reovirus RD240407A is: CGMCC No.46196. The present invention also provides an inactivated vaccine and egg yolk antibody prepared from the strain. The egg yolk antibody prepared by the novel duck reovirus RD240407A of the present invention has a good immune effect in both the treatment of disease and the prevention before the disease in ducklings and goslings. Compared with the serum antibodies in the prior art, the egg yolk antibody of the present invention has a simple preparation method and does not require blood collection. It only needs to collect the egg yolk of immune highly immune chicken eggs for purification to obtain the egg yolk antibody; it has good stability, significant therapeutic effect, and a simple production method that is suitable for large-scale production and promotion and application.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a novel highly pathogenic duck reovirus and the preparation and application of its egg yolk antibody. Background Art

[0002] The new duck reovirus disease is an infectious disease that has been prevalent in my country in recent years and has seriously harmed the duck and goose industries. The disease can be transmitted both vertically and horizontally. After infection, it causes a decrease in the body's immunity and is prone to mixed infection and secondary infection. The younger the age of the ducklings and goslings, the higher the incidence rate. It is currently widely prevalent in many regions of my country.

[0003] Currently, there are no ideal commercial drugs on the market to prevent and control the disease. There are few reports on yolk antibodies for the emergency prevention and early infection treatment of new duck reovirus from geese and ducks. At the same time, the method of extracting yolk antibodies is still one of the factors restricting the large-scale production of IgY, and the market demand for yolk antibodies is huge.

[0004] Since the toxicity of the virus directly affects the antibody response, it is necessary to screen for novel duck reoviruses that are highly pathogenic and immunogenic. The egg yolk antibodies produced have the advantages of high purity, high titer, and good therapeutic and control effects. Therefore, the existing technology needs to be further improved. Summary of the Invention

[0005] The present invention aims to solve the above problems and provides a novel highly pathogenic duck reovirus RD240407A and the preparation and application of its egg yolk antibody.

[0006] Specifically, the technical solutions provided in this application are as follows:

[0007] In a first aspect, the present application provides a novel duck reovirus RD240407A, and the deposit number of the novel duck reovirus RD240407A is CGMCC No.46196.

[0008] In a second aspect, the present invention provides a use of the novel duck reovirus RD240407A as described in the first aspect in preparing an inactivated vaccine.

[0009] In a third aspect, the present invention provides an inactivated vaccine, wherein the antigen in the inactivated vaccine comprises the inactivated novel duck reovirus RD240407A described in the first aspect.

[0010] Furthermore, the preparation method of the inactivated vaccine is as follows:

[0011] S1: The novel duck reovirus strain RD240407A of the first aspect is inoculated into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos via the yolk cavity at a dose of 0.2 ml / egg, and embryos dead within 24 hours are discarded. The allantoic fluids of chicken and duck embryos that died between 36 and 120 hours ago and showed typical pathological changes are collected. The collected allantoic fluids of the chicken and duck embryos are mixed at a ratio of 1:2 (v / v) and centrifuged at 6000 rpm for 15 minutes. The sterile supernatant is quantitatively aliquoted and frozen for storage.

[0012] S2: The chicken embryo virus solution and the duck embryo virus solution obtained in S1 were mixed, and 10% formaldehyde solution was added and shaken to mix thoroughly. The final concentration of the formaldehyde solution was 0.1%. The virus solution was then poured into another sterile stainless steel barrel and stirred and inactivated at 37°C for 24 hours. After the inactivation was completed, samples were taken for inactivation testing. The inactivated virus solution was stored at 2-8°C for later use.

[0013] S3: Prepare the immunogen in a ratio of 3:1 (V / V) between the oil phase and the aqueous phase. Take 3 parts of the oil phase and place them in a high-speed shear instrument. While stirring at 15,000 r / min, slowly add 1 part of the aqueous phase and stir for 6 minutes to fully emulsify the mixture. After emulsification, aseptically divide the mixture into 250 ml sterile bottles, indicate the name, preparation time, filling amount, etc. on the outer wall of the bottle, and store at 2-8°C.

[0014] In a fourth aspect, the present invention provides use of the novel duck reovirus RD240407A as described in the first aspect in preparing egg yolk antibodies.

[0015] In a fifth aspect, the present invention provides an egg yolk antibody, which is prepared using the novel duck reovirus RD240407A described in the first aspect as an antigen.

[0016] Furthermore, the preparation method of the egg yolk antibody is as follows:

[0017] S1: Prepare vaccine to immunize laying hens and collect high-immunity eggs;

[0018] S2: eggshell disinfection and egg yolk pretreatment;

[0019] The eggshell disinfection comprises soaking the eggs in a 0.1% 42°C chlorhexidine solution for 15 minutes, draining the eggs, rinsing the eggs with running water to remove surface dirt, spraying and fumigating the eggs with 0.1% glutaraldehyde for 30 minutes, blowing the eggs dry, and then cracking the eggs;

[0020] The egg yolk pretreatment comprises: separating the egg white and yolk with an egg beater; mixing and stirring the egg yolk and the yolk in a ratio of 1:1 (v / v, egg yolk: 0.02 mol / L disodium hydrogen phosphate solution); filtering the egg yolk liquid with a 60-mesh steel wire sieve to remove impurities in the egg yolk liquid; transferring the egg yolk liquid to a settling tank, and adding the remaining 2 times volume of disodium hydrogen phosphate solution; and stirring at 1000 rpm for 60 minutes.

[0021] S3: Acidification extraction: Slowly add 1x sedimentation liquid to the sedimentation tank at a ratio of 1:1 (v / v, egg yolk: sedimentation agent). At this point, the solution is milky yellow, uniform, and turbid. Use 30% citric acid solution to adjust the pH value of the sedimentation liquid to 6.0. Sedimentation treatment at 4°C for 12 hours. After sedimentation is completed and the titer of the supernatant is not less than 1:16, collect the supernatant.

[0022] S4: Caprylic acid degreasing: Add caprylic acid to a final concentration of 0.1% to the extracted supernatant to remove fat. After thorough mixing, let it stand at room temperature for 2-6 hours. Remove impurities through filter cloth to obtain the antibody stock solution.

[0023] S5: Sterile filtration: Sterilize by filtering with a 0.22 μm microporous filter;

[0024] S6: Ultrafiltration to remove viruses: Use ultrafiltration membrane with a molecular weight cut-off of 1000 kDa to remove viruses;

[0025] S7: Ultrafiltration concentration: Use ultrafiltration membrane with a molecular weight cutoff of 100 kDa to concentrate the egg yolk antibody twice;

[0026] S8: Antibody titer determination: The titer of reosome antibody agar expansion should be no less than 1:16;

[0027] S9: Packaging: Pack in quantitative quantities, seal tightly, and store at 2-8℃.

[0028] Based on the above technical solution, the method of S1: preparing immune laying hens and collecting highly immune eggs is as follows:

[0029] For the first vaccination, inject the prepared immunogen intramuscularly into 140-day-old laying hens, 0.5 ml per chicken;

[0030] Second vaccination: 15 days after the first vaccination, intramuscular injection of the prepared immunogen, 1.0 ml / animal;

[0031] For the third immunization, 15 days after the second immunization, intramuscular injection of the prepared immunogen was performed, 1.5 ml per animal;

[0032] For the fourth vaccination, 2 ml / animal was injected intramuscularly with the prepared immunogen 30 days after the third vaccination.

[0033] Eggs were collected for testing 14 days after the fourth vaccination. When the titer of the egg agar diffusion test was not less than 1:64, the high-immunity eggs were collected and stored at 4°C for later use.

[0034] Based on the above technical solution, the yolk antibody is used for prevention before infection and / or treatment after infection.

[0035] Based on the above technical solution, the injection dosage of the egg yolk antibody is 1 mL / each

[0036] The present invention has the following advantages / benefits:

[0037] 1. The present invention isolated a highly pathogenic new duck reovirus strain, RD240407A, from geese, with a deposit number of CGMCC No. 46196. Yolk antibodies prepared using this strain exhibit excellent immune efficacy. Experimental data indicates that the egg yolk antibodies prepared using the new duck reovirus strain, RD240407A, have a significant immune efficacy of 95%-99.5% in both the treatment and pre-infection prevention of ducklings and goslings.

[0038] 2. Compared with the serum antibodies in the prior art, the egg yolk antibodies of the present invention have a simple preparation method. No blood sampling is required. The egg yolk antibodies can be purified by collecting the yolks of immune hyperimmune chicken eggs. They have good stability, significant therapeutic effects, and a simple production method suitable for large-scale production and promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only one embodiment of the present invention. Those skilled in the art can also derive other implementation drawings based on the provided drawings without inventive effort.

[0040] Figure 1 : Electrophoretogram of the detection of the novel duck reovirus RD240407A strain of the present invention, wherein lane 1: marker; lane 2: RD240407A; lane 3: NDRV negative control.

[0041] Figure 2 : Liver lesion diagram of dead duck embryo of the present invention.

[0042] Figure 3 :Electron micrograph of the novel duck reovirus RD240407A strain of the present invention DETAILED DESCRIPTION

[0043] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. The following embodiments are only for illustrating the present invention, and are not intended to limit the scope of the present invention in any way. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention. The experimental methods used in the present invention are conventional methods unless otherwise specified. The materials, reagents, etc. used in the present invention, unless otherwise specified, can be obtained from commercial channels. In addition, other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0044] Example 1: Isolation and identification of a novel duck reovirus strain RD240407A

[0045] Among the following raw materials, sterile PBS solution was purchased from Wuhan Boster Bioengineering Co., Ltd.; 2×TapPCRStarMix was purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.; Tween 80 and Span 80 were purchased from Sinopharm Chemical Reagent Co., Ltd.; other raw materials were commercially available.

[0046] 1.1 Virus collection and isolation

[0047] Liver and spleen tissue samples were aseptically collected from sick geese at a goose farm in Shandong Province suspected of being infected with a novel duck reovirus. Sterile PBS was added to the tissue samples at a 1:2 (w / v) ratio, then ground and homogenized. After three freeze-thaw cycles, the mixture was centrifuged at 6000 rpm for 15 minutes. The supernatant was isolated and purified, filtered through a sterile filter, and stored at -20°C until further use. After three blind passages in the yolk cavity of SPF chicken embryos and two blind passages in standard duck embryos, the novel duck reovirus strain RD240407A was isolated and purified.

[0048] 1.2 Virus identification

[0049] (1) Viral DNA extraction

[0050] The specific operation process was carried out according to the instructions of the StarSceiptⅢOne-Step RT-RCR Kit (Dye) extraction kit, and the sample addition volume was 300 μL.

[0051] (2) Identification primer: NDRV-F: ACTCGTGGCGTCTTATATC

[0052] NDRV-R:TGGCGGAATAGTGAATACAT

[0053] The fragment length of this identification primer is 997 bp.

[0054] (3) PCR amplification system: A 20 μL amplification system was used for amplification. The specific reagents are shown in Table 1:

[0055] Table 1: PCR amplification system (20 μL)

[0056]

[0057] (4) Amplification procedure: 30 cycles of pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 40 s, and extension at 72°C for 40 s; extension at 72°C for 10 min after each cycle, and storage at 4°C. The PCR products were subjected to 1% agarose gel electrophoresis.

[0058] PCR detection electrophoresis diagram Figure 1 The specific sequence is shown in SEQ ID NO: 1:

[0059] GTATGTCCTGGGCTCGGCTACGGAAGGCACCATGCCGCCGTTCCCGTCGGATGTGTATGCCCTGCCGCAGTACGGGTATTGCACAATGCACACCAACCAGAACGGTGCACGATTCAATGACCGGAGTGCATTCTACTGCTTAGAATACTTCCCCAGTC AGATGCTAAGAACAGGCAACAACTTTGAGTTCACGTTTGACTTTGAAGAAGTTCCTTTCCACAGCATGTTCGCTCATTCACAGGACTTAGACAGGCTGATGAACCCCTTAGTGGATCAATACCTCTGGAATTTCAATGAGGTAGACAGCAGCAGAAATG CTCAATTTAAAAAAGCTGTGAAAGGCGCTTATGGCACCATGGGCCGCAATTGGCTGCCAGGACCTAAATTCCTGGACCAGAGAGTTAGGGCCTATACAGGCGGAACAGATAATTATGCAAACTGGAACATCTGGAGTAATGGAAACAAGGTTAATTTG AAGGACAGGCAGTACCTCTTGCAACCCGGACCTGTATCAGCTACTCACACAAAAGTAGAGGCTTCCAGCATCCCAGCCCAAAATATTTTAGGTTTAGCTAAAGATCCATACAGATCTGGCAGCACTACAGCAGGAATAAGTGATATTATGGTCACGGAC

[0060] 1.3 Toxicity test on SPF chicken embryos and ordinary duck embryos

[0061] After the strain RD240407A was diluted 1:100 with PBS (0.01 mol / L, pH=7.2), it was inoculated into 10 8-day-old SPF chicken embryos and 10 9-day-old susceptible duck embryos through the yolk cavity, with 0.2 ml per embryo. The embryos were incubated at 37°C. At least 8 SPF chicken embryos and susceptible duck embryos should die within 24-168 hours of inoculation. The dead embryos should have symptoms such as hemorrhage on the skin and irregular gray-white necrotic spots on the liver. Figure 2 ).

[0062] The experimental results are shown in Table 2:

[0063] Table 2: Death status of SPF chicken embryos and susceptible duck embryos

[0064]

[0065] 1.4 Electron microscopy observation

[0066] Electron microscopy images Figure 3 As shown, under the electron microscope, it was observed that the virus particles were spherical, with a double-layer capsid and no capsule, and the diameter was between 60 and 80 nm, mostly around 75 nm.

[0067] 1.5 Strain preservation

[0068] The strain RD240407A was deposited in the China General Microbiological Culture Collection Center (CGMCC) on September 23, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 46196.

[0069] Example 2: Antigen preparation

[0070] 2.1 Virus proliferation procedure

[0071] The new duck reovirus RD240407A strain isolated in Example 1 was inoculated into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos through the yolk cavity at a dose of 0.2 ml / piece. The dead embryos within 24 h were discarded, and the allantoic fluids of chicken embryos and duck embryos that died 36 to 120 h and had typical lesions were collected. The collected chicken embryos and duck embryos were mixed at a ratio of 1:2 (v / v) and centrifuged at 6000 rpm for 15 min. The sterile supernatant was quantitatively packaged and frozen for storage.

[0072] 2.2 Virus inactivation

[0073] Mix the antigens that have passed the test (SPF chicken embryos and 9-day-old susceptible duck embryos should die at least 8 times within 24-168 hours of inoculation and the PCR electrophoresis bands should be correct and clear), add 10% formaldehyde solution, and shake as you add to mix thoroughly. The final concentration of the formaldehyde solution is 0.1%. Then, pour the virus solution into another sterile stainless steel barrel and stir and inactivate it at 37°C for 24 hours (starting from the time the antigen temperature rises to 37°C, and stirring 3-4 times during this period). After inactivation, samples are taken and inactivation tests are performed. The inactivated virus solution is stored at 2-8°C for later use.

[0074] 2.2.1 Sterility test: Take the inactivated virus solution and test it according to the appendix of the current Chinese Veterinary Pharmacopoeia.

[0075] 2.2.2 Inactivation test: Inoculate the inactivated virus liquid into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos through the yolk cavity, 0.2 ml per embryo, and observe for 168 hours. All SPF chicken embryos and susceptible duck embryos should be alive. Blindly propagate for one generation using this method, and all SPF chicken embryos and susceptible duck embryos should still be alive.

[0076] 2.2.3 Experimental results: The antigen was sterile after inactivation.

[0077] The antigen was completely inactivated and 10 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos were inoculated and blindly passed on to the first generation. All the 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos survived.

[0078] 2.3 Preparation of immunogens

[0079] 2.3.1 Oil phase preparation

[0080] Take 94 parts of white oil for injection and 6 parts of Span 80, mix them, heat to 90°C while stirring, and sterilize them under high pressure at 121°C for 30 minutes. This is the oil phase.

[0081] 2.3.2 Preparation of aqueous phase

[0082] Take 96 parts of antigen and 4 parts of sterilized Tween 80, mix them and shake them thoroughly to completely dissolve the Tween 80, which is the aqueous phase.

[0083] 2.3.3 Emulsification

[0084] Prepare the immunogen at a 3:1 (v / v) ratio of oil phase to aqueous phase. Place 3 portions of the oil phase in a high-speed shear apparatus and, while stirring at 15,000 rpm, slowly add 1 portion of the aqueous phase. Stir for 6 minutes to fully emulsify the mixture. After emulsification, aseptically dispense into 250 ml sterile bottles. Label the bottle with the product name, preparation time, and quantity. Store at 2-8°C.

[0085] 2.4 Immunogen Testing

[0086] 2.4.1 Characteristics

[0087] Appearance: Milky white uniform emulsion

[0088] Dosage form: Water-in-oil. Use a clean pipette to draw a small amount of immunogen and drop it into cold water. Except for the first drop, no other drops should spread.

[0089] Stability: Pipette 10 ml of immunogen into a centrifuge tube and centrifuge at 3000 r / min for 15 min. The amount of aqueous phase precipitated at the bottom of the tube should be 0.1 ml and should not exceed 0.5 ml.

[0090] Viscosity: tested in accordance with the appendix of the current Chinese Veterinary Pharmacopoeia, it is 100cP and not more than 200cP.

[0091] 2.4.2 Sterility test: Test in accordance with the appendix of the current Chinese Pharmacopoeia of Veterinary Medicine, and the product must be sterile after testing.

[0092] 2.4.3 Safety test: 10 14-day-old SPF chickens were injected with 2.0 ml of the immunogen into the leg muscle. The chickens were observed for 14 days. No local or systemic adverse reactions caused by the injection of the immunogen were observed.

[0093] 2.4.4 Effectiveness test:

[0094] Twenty 60-day-old SPF chickens were used, 15 of which were injected with 1 ml of immunogen into the leg muscles, and the other 5 were used as controls. Blood was collected 21 days after immunization, and the serum was separated. The serum agar titer was measured after inactivation at 56°C for 30 minutes. The agar titer of the immunized group was 1:64, and the agar titer of the control group was negative.

[0095] Example 3: Preparation of Reovirus Yolk Antibodies

[0096] 3.1 Immunization Procedure

[0097] For the first vaccination, inject the prepared immunogen intramuscularly into commercial laying hens around 140 days of age at 0.5 ml per bird. For the second vaccination, inject the prepared immunogen intramuscularly 15 days after the first vaccination at 1.0 ml per bird. For the third vaccination, inject the prepared immunogen intramuscularly 15 days after the second vaccination at 1.5 ml per bird. For the fourth vaccination, inject the prepared immunogen intramuscularly 30 days after the third vaccination at 2 ml per bird. Eggs were collected for testing starting 14 days after the fourth vaccination. When the titer of the egg agar diffusion test was no less than 1:64, the highly immune eggs were collected and stored at 4°C until further use.

[0098] 3.2 Preparation of yolk antibodies

[0099] Cleaning and disinfection: Soak the eggs in 0.1% 42℃ Sanisol solution for 15 minutes, remove them from the water, rinse with running water to remove surface dirt, spray fumigate the eggs with 0.1% Weikang (glutaraldehyde) for 30 minutes, blow dry the eggs and then beat them.

[0100] Yolk Pretreatment: Use an egg beater to separate the egg white and yolk; mix and stir in a 1:1 ratio (v / v, egg yolk: 0.02 mol / L disodium hydrogen phosphate solution) until smooth. Filter through a 60-mesh wire sieve to remove impurities from the egg yolk solution. Transfer the egg yolk solution to a settling tank and add the remaining 2 volumes of disodium hydrogen phosphate solution (0.02 mol / L). Stir at 1000 rpm for 60 minutes. At this point, the mixture should have a pH of approximately 7.2, be milky yellow, and be turbid and uniform. Note: Always stir at a low, uniform speed for a sufficient period of time to prevent the egg yolk from denaturing.

[0101] Acidification extraction: Slowly add 1 times sedimentation liquid (PVP and trehalose are 6.66g / L and 4.16g / L respectively, and are fully dissolved in purified water of equal quality with egg yolk) into the sedimentation tank at a ratio of 1:1 (v / v, egg yolk: sedimentation agent). At this time, the solution is milky yellow, uniform and turbid; use 30% citric acid solution to carefully adjust the pH value of the sedimentation liquid to 6.0, and let it settle at 4°C for 12 hours. After the sedimentation is completed and the titer of the supernatant is not less than 1:16, all the supernatant can be transferred out and enter the next process.

[0102] Caprylic acid degreasing: Add caprylic acid to a final concentration of 0.1% to the extracted supernatant to remove fat. After thorough mixing, let it stand at room temperature for 2 to 6 hours. Remove impurities through filter cloth to obtain the antibody stock solution.

[0103] Sterile filtration: Sterilize by filtering with a 0.22um microporous filter.

[0104] Ultrafiltration virus removal: Use an ultrafiltration membrane with a molecular weight cutoff of 1000kDa to remove viruses.

[0105] Ultrafiltration concentration: Use an ultrafiltration membrane with a molecular weight cutoff of 100 kDa to concentrate the egg yolk antibody twice.

[0106] Antibody titer determination: The agar titer of the novel duck reovirus antibody should be no less than 1:16.

[0107] Packaging: Pack in fixed quantities, seal tightly, and store at 2-8°C.

[0108] Example 4: RD240407A strain median lethal dose (ELD 50 )

[0109] The isolated virus stock solution was diluted 10-fold with PBS (0.01mol / L, pH=7.2), with a total of 8 dilutions. Ten 9-day-old susceptible duck embryos (200μL / embryo) were inoculated through the yolk cavity for each dilution, and a blank control group was set up and incubated at 37°C. The duck embryos were observed every day after infection, and the duck embryos that died within 24 hours were discarded. Thereafter, the duck embryos were observed every 24 hours for 168 hours. The cumulative number of dead and alive duck embryos at each dilution was counted, and the experimental data are shown in Table 3. The ELD of the virus in each 0.2mL suspension was calculated according to the Reed-Muench method. 50 .

[0110] Table 3: Mortality of inoculated duck embryos and ELD of RD240407A strain 50

[0111]

[0112] Example 5: RD240407A strain challenge and protection test

[0113] 5.1 RD240407A strain challenge and protection experiment in ducklings

[0114] A total of 950 7-day-old specific pathogen-free ducks were randomly divided into 4 groups and weighed. The specific challenge and protection experimental schemes are shown in Table 4.

[0115] Group 1 (50 rats) served as the negative control group;

[0116] The second group of 300 ducklings was the non-treatment control group. The 7-day-old ducklings were intramuscularly inoculated with RD240407A strain virus, with 0.5 mL (containing 200 ELD 50 );

[0117] The third group (300 ducklings) was the challenge and treatment group. The 7-day-old ducklings were intramuscularly inoculated with RD240407A strain virus, with 0.5 mL (containing 200 ELD 50 ), inject 1ml of egg yolk antibody 24 hours;

[0118] The fourth group of 300 ducklings was the challenge and prevention group. 1 ml of egg yolk antibody was injected intramuscularly in 7-day-old ducklings. 24 hours later, 0.5 ml of RD240407A virus was inoculated intramuscularly. 50 ).

[0119] They were isolated and reared separately, with the specific procedures shown in Table 1. Clinical observations were conducted daily after challenge, and morbidity and mortality were recorded. Seven days after challenge, all ducklings were euthanized and autopsied (lesion assessment method: hemorrhage in the liver and spleen was observed during autopsy).

[0120] Table 4: Duckling RD240407A strain challenge and protection test plan

[0121]

[0122] The experimental data of ducklings are shown in Table 5:

[0123] Table 5: Results of challenge and protection test of ducklings with strain RD240407A

[0124]

[0125] From the experimental data in Table 5, it can be seen that the test scheme for the challenge and protection of ducklings with the RD240407A strain is as follows: in Group 1, the number of ducklings that became ill 7 days after the challenge was 0%; in Group 2, the number of ducklings that became ill in the non-treatment group that became ill 7 days after the challenge was 292 / 300, with an incidence rate of 97.3%; in Group 3, the number of ducklings that became ill in the treatment group that became ill 7 days after the challenge was 9 / 300, with a protection rate of 97.0%; in Group 4, the number of ducklings that became ill in the prevention group that became ill 7 days after the challenge was 5 / 300, with a protection rate of 98.3%.

[0126] 5.2RD240407A strain challenge and protection experiment in goslings

[0127] A total of 650 7-day-old specific pathogen-free geese were randomly divided into four groups and weighed. The specific challenge and protection experimental schemes are shown in Table 5.

[0128] Group 1 (50 rats) served as the negative control group;

[0129] The second group of 200 goslings was the non-treatment control group. The 7-day-old goslings were intramuscularly inoculated with RD240407A virus, with 0.5 mL (containing 200 ELD 50 );

[0130] The third group (200 gooses) was the challenge and treatment group. The 7-day-old goslings were intramuscularly inoculated with RD240407A strain virus, with 0.5 mL (containing 200 ELD 50 ), inject 1ml of egg yolk antibody 24 hours;

[0131] The fourth group (200 gooses) was the challenge and prevention group. Goslings at 7 days old were injected intramuscularly with 1 ml of egg yolk antibody and 24 hours later, the RD240407A strain virus was inoculated intramuscularly. Each goose had 0.5 ml (containing 200 ELD 50 ).

[0132] They were isolated and reared separately, with specific procedures as shown in Table 6. Clinical observations were conducted daily after challenge, and morbidity and mortality were recorded. Seven days after challenge, all goslings were euthanized and autopsied (lesion assessment method: autopsy revealed hemorrhagic liver, splenic sclerosis, and irregular necrotic plaques).

[0133] Table 6: Gosling RD240407A strain challenge and protection test plan

[0134]

[0135] The experimental data of goslings are shown in Table 7:

[0136] Table 7: Goslings RD240407A strain challenge and protection test results

[0137]

[0138] From the experimental data in Table 7, it can be seen that the challenge and protection test scheme of goslings RD240407A strain is as follows: Group 1, the incidence rate of goslings 7 days after challenge is 0%; Group 2, the non-treatment group, the incidence rate of goslings 7 days after challenge is 197 / 200, and the incidence rate is 98.5%; Group 3, the challenge and treatment group, the incidence rate of goslings 7 days after challenge is 4 / 200, and the protection rate is 98.0%; Group 4, the prevention group, the incidence rate of goslings 7 days after challenge is 1 / 200, and the protection rate is 99.5%;

[0139] Based on the experimental data of this embodiment, it was found that the protection rate of ducklings against the reovirus strain was 97.0%-98.3%, and the protection rate of goslings was 98.0%-99.5%. The yolk antibody can effectively prevent and treat the onset of reovirus in ducklings and goslings.

[0140] Example 6: Large-scale group test of RD240407A strain

[0141] 6.1 Large-group experiment with duckling strain RD240407A

[0142] A large-scale duck experimental area in Shandong Province was selected, and two diseased duck houses were selected as experimental subjects, each of which housed 5,000 one-week-old ducks.

[0143] The diseased ducks in the two duck houses were treated separately. Ducks in duck house 1 were injected with 1 mL of yolk antibody purchased from the market. Ducks in duck house 2 were injected with 1 mL of yolk antibody against the RD240407A strain virus. The ducks were observed for 7 consecutive days, and the disease status of the ducklings was recorded. (The diagnosis of the new type of duck reoconstriction is as follows: depression, loss of appetite, decreased water intake, general fatigue, weak legs, difficulty walking, and even inability to stand. Some sick ducks also show signs of respiratory damage such as difficulty breathing and breathing with their mouths open.)

[0144] The experimental results are as follows: Seven days after treatment with reovirus-resistant egg yolk antibodies, ducks in Zone 1 showed a protection rate of 82.5%, while ducks in Zone 2 showed a protection rate of 93.9%. The egg yolk antibodies prepared in this experiment were more effective than commercially available egg yolk antibodies in protecting against reovirus, demonstrating a promising preventive and control strategy.

[0145] 6.2 Large-scale experiment with goslings strain RD240407A

[0146] A large-scale goose experiment site in Shandong Province was selected, and one of the infected goose houses was selected as the experimental subjects. The goose house was divided into two isolation areas, 1 and 2, each housing 2,000 two-week-old geese. The infected geese in areas 1 and 2 were treated separately. Geese in area 1 were injected with 1.5mL / goose of commercially available reoconstrictor yolk antibody; geese in area 2 were injected with 1.5mL / goose of RD240407A strain virus yolk antibody. The geese were observed for 7 consecutive days, and the disease status of the goslings was recorded. (The method for judging the onset of reoconstrictor geese is as follows: depression, loss of appetite, decreased water intake, general fatigue, weak legs, difficulty walking, and even inability to stand. Some sick geese also show signs of respiratory damage such as difficulty breathing and mouth breathing.)

[0147] Results: Seven days after treatment with reovirus-derived egg yolk antibodies, the protection rate of geese in zone 1 was 85.2%, and that in zone 2 was 94.1%. Against the challenge of the novel duck reovirus, the egg yolk antibodies prepared in this experiment were more effective than commercially available egg yolk antibodies, demonstrating a promising preventive and control strategy.

[0148] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solutions and concepts of the present invention, and all these changes or substitutions should fall within the scope of protection of the claims attached to the present invention.

Claims

1. An egg yolk antibody, characterized in that The egg yolk antibody is prepared by using a novel duck reovirus RD240407A as an antigen; the deposit number of the novel duck reovirus RD240407A is CGMCC No.46196; The preparation method of the yolk antibody is as follows: S1: Prepare vaccine to immunize laying hens and collect high-immunity eggs; S2: eggshell disinfection and egg yolk pretreatment; The eggshell disinfection comprises soaking the eggs in a 0.1% 42°C chlorhexidine solution for 15 minutes, draining the eggs, and washing them with running water to remove surface dirt. The eggs are then spray-fumigated with 0.1% glutaraldehyde for 30 minutes, and then cracked after being blown dry. The egg yolk pretreatment comprises: separating the egg white and yolk with an egg beater; mixing the egg yolk and 0.02 mol / L disodium hydrogen phosphate solution in a ratio of 1:1 (v / v) and stirring evenly; filtering the egg yolk liquid with a 60-mesh steel wire sieve to remove impurities in the egg yolk liquid; transferring the egg yolk liquid to a settling tank, and adding the remaining 2 times volume of disodium hydrogen phosphate solution; and stirring at 1000 rpm for 60 minutes. S3: Acidification extraction; Slowly add 1x sedimentation solution to the sedimentation tank at a ratio of 1:1 (v / v) of egg yolk: sedimentation agent. At this point, the solution is milky yellow, uniform, and turbid; Use 30% citric acid solution to adjust the pH value of the sedimentation solution to 6.0, and sediment at 4°C for 12 hours. After sedimentation is completed and the titer of the supernatant is not less than 1:16, collect the supernatant; S4: Caprylic acid degreasing: Add caprylic acid to a final concentration of 0.1% to the extracted supernatant to remove fat. After thorough mixing, let it stand at room temperature for 2-6 hours. Remove impurities through filter cloth to obtain the antibody stock solution. S5: Sterile filtration: Sterilize by filtering with a 0.22 μm microporous filter; S6: Ultrafiltration to remove viruses: Use ultrafiltration membrane with a molecular weight cutoff of 1000 kDa to remove viruses; S7: Ultrafiltration concentration: Use ultrafiltration membrane with a molecular weight cutoff of 100 kDa to concentrate the egg yolk antibody twice; S8: Antibody titer determination: The titer of the new duck reosome antibody agar expansion should be no less than 1:16; S9: Aliquot: Aliquot in fixed quantities, seal tightly, and store at 2-8°C. S1: Preparation of immune laying hens and collection of highly immune eggs are as follows: For the first vaccination, inject the prepared immunogen intramuscularly into 140-day-old laying hens, 0.5 ml per hens; Second vaccination: 15 days after the first vaccination, intramuscular injection of the prepared immunogen, 1.0 ml / animal; For the third immunization, 15 days after the second immunization, intramuscular injection of the prepared immunogen was performed, 1.5 ml per animal; For the fourth vaccination, 2 ml / animal was injected intramuscularly with the prepared immunogen 30 days after the third vaccination. Eggs were collected and tested 14 days after the fourth vaccination. When the titer of the egg agar diffusion test was not less than 1:64, the high-immunity eggs were collected and stored at 4°C for later use. The yolk antibody is used for prevention before infection and / or treatment after infection; The injection dosage of the egg yolk antibody is 1 mL / animal; The application objects of the yolk antibody are ducklings and / or goslings.

Images