Aminopeptidase as well as preparation method and application thereof

Abstract

The invention provides aminopeptidase as well as a preparation method and application thereof, and belongs to the technical field of biocatalysts. Escherichia coli cells which contain recombinant expression vectors or are integrated with exogenous nucleic acid corresponding to SEQ ID NO: 1 in genomes are used as host cells, and aminopeptidase containing the sequence SEQ ID NO: 2 is induced and expressed by the host cells. The obtained aminopeptidase has the advantages of high enzymatic activity, high enzymatic reaction level and the like, and can be used for converting beta-alanine methyl ester hydrochloride into L-carnosine when the concentration of a conversion substrate L-histidine is 70g / L.

Description

Technical Field

[0001] The present application relates to an aminopeptidase and a preparation method and application thereof, belonging to the technical field of biocatalysts. Background Art

[0002] Carnosine (L-Carnosine, L-Car) is a dipeptide composed of two amino acids, L-histidine and β-alanine. It can be synthesized in animals and is one of the most widely found active peptides so far.

[0003] At present, the production methods of L-carnosine are divided into chemical synthesis and biosynthesis. Chemical synthesis is the most commonly used method in industrial production. Most of them require the protection or deprotection of amino acids, with complex processes, many by-products, large solvent consumption, and serious environmental pollution. Compared with traditional chemical synthesis methods, biosynthesis, i.e., enzymatic synthesis of L-carnosine, has the advantages of mild reaction conditions, high product purity, high yield, and low environmental pollution.

[0004] In 2018, Kino and other researchers discovered that L-amino acid ligase in Bacillus subtilis can be used to synthesize L-carnosine, but the reaction requires a large amount of ATP, which increases the preparation cost.

[0005] Dipeptide hydrolases can synthesize L-carnosine by catalyzing the reverse reaction of the hydrolysis of L-carnosine. In 2019, Yin Dongya's research group obtained the dipeptide hydrolase SmPepD from Serratia marcescens through genome mining and found that the activity of SmPepD can be regulated by Mn 2+ After activation, the optimized enzyme can catalyze the production of 15.2 g / L of L-carnosine; in 2023, Rao Zhiming's team used protein combinatorial engineering and transport engineering to carry out targeted mutagenesis and gene knockout of SmPepD, and finally produced 133.2 mmol / L of L-carnosine; in 2024, Zhu Dunming's team mutated the dipeptidase gene CpPepD of Clostridium perfringens, and through high-throughput screening, obtained a mutant with a 2.2-fold increase in synthetic activity, producing 15.16 g / L L-carnosine at substrate concentrations of 6 mol / L β-alanine and 0.2 mol / L L-histidine.

[0006] One of the early discovered proteases is the microbial aminopeptidase (EC 3.4.11) in eukaryotic and prokaryotic organisms, which has the function of catalyzing the synthesis of L-carnosine. In 2022, Ju Jiansong's research group obtained a new aminopeptidase for synthesizing L-carnosine through deep-sea sediment metagenomic screening, synthesizing 10 mmol / L L-carnosine; in 2024, Zhang Sufang's research group isolated a high-yield aminopeptidase strain from Pixian Douban B. subtilisLBJ4-5, the enzyme activity reached 179.23U / mL after fermentation.

[0007] In summary, the aminopeptidases reported so far have problems such as low catalytic activity, long reaction time, and low product concentration. Therefore, it is necessary to develop aminopeptidase catalysts with better performance to meet the needs of industrial production. Summary of the invention

[0008] In view of this, the present application provides a new aminopeptidase and its encoding gene and the use of a recombinant aminopeptidase containing the encoding gene as a catalyst / converter in the synthesis of L-carnosine.

[0009] Specifically, the present application is implemented through the following scheme: In a first aspect of the present invention, an aminopeptidase (DmpA) is provided, wherein the aminopeptidase comprises an amino acid sequence as shown in SEQ ID NO: 2. Preferably, the aminopeptidase is a fusion protein having the same function obtained by connecting a tag to the N-terminus of the amino acid sequence as shown in SEQ ID NO: 2.

[0010] In a second aspect, the present invention provides a nucleic acid encoding an aminopeptidase, wherein the nucleotide sequence of the nucleic acid is shown in SEQ ID NO:1.

[0011] SEQ ID NO: 1 was obtained by Illumina Miseq sequencing of Microcystis microcystis MCA4210: total DNA of Microcystis microcystis MCA4210 was used as a template, primers DmpA-F 5' and DmpA-R 5' were used as amplification primers, and an EcoRI restriction site was introduced into primer DmpA-F 5', and a Hind III restriction site was introduced into primer DmpA-R 5', and high-fidelity PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa) was selected for PCR amplification, wherein: DmpA-F 5': ATGGGTCGCGGATCCGAATTCTTAGTAAGCATGGCGGGTCACGAT; DmpA-R 5':CTCGAGTGCGGCCGCAAGCTTATGGAACGTAAACGTATCCGCGAACT.

[0012] The nucleic acid encoding the aminopeptidase of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded.

[0013] The nucleic acid encoding the aminopeptidase of the present invention can be prepared by any appropriate technique known to those skilled in the art. Such techniques are generally described in the art, such as Molecular Cloning Laboratory Manual (J. Sambrook et al., Science Press, 1995). These techniques include, but are not limited to, recombinant DNA technology, chemical synthesis, and the like; for example, overlap extension PCR.

[0014] The third aspect of the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises the nucleic acid corresponding to SEQ ID NO: 1.

[0015] Preferably, the recombinant expression vector is obtained by cloning the nucleic acid corresponding to SEQ ID NO: 1 into an expression vector.

[0016] Methods well known to those skilled in the art can be used to construct the recombinant expression vector. These methods include recombinant DNA technology, DNA synthesis technology, etc. The DNA encoding the aminopeptidase can be effectively connected to the multiple cloning site in the vector to guide mRNA synthesis and then express the aminopeptidase, or used for homologous recombination. In a preferred embodiment of the present invention, the expression vector uses pET-28a.

[0017] The fourth aspect of the present invention provides a host cell, the cell comprising the aforementioned recombinant expression vector or the genome of which is integrated an exogenous nucleic acid corresponding to SEQ ID NO: 1. Preferably, the cell is Escherichia coli, such as Escherichia coli BL21 (DE3).

[0018] In a fifth aspect of the present invention, a method for preparing the above aminopeptidase is provided: culturing the above host cell to induce expression of an aminopeptidase containing SEQ ID NO: 2. Preferably, the induction temperature is 16-37°C, the expression time is 8-28 h, the inducer is IPTG, and the concentration is 0.2-1.0 mmol / L. More preferably, the induction temperature is 16-25°C, the expression time is 12-16 h, the inducer is IPTG, and the concentration is 0.2-0.6 mmol / L.

[0019] In the sixth aspect of the present invention, the use of the above-mentioned aminopeptidase, nucleic acid, recombinant expression vector or host cell for L-histidine and β-alanine methyl ester hydrochloride to generate L-carnosine is provided: the aminopeptidase, nucleic acid, recombinant expression vector or host cell is added as a conversion agent to a buffer solution containing L-histidine and β-alanine methyl ester hydrochloride, so that L-histidine and β-alanine methyl ester hydrochloride are converted into L-carnosine. Preferably, in the buffer solution, the concentration of L-histidine is 20~70g / L, and the concentration of β-alanine methyl ester hydrochloride is 40~100g / L. The conversion temperature is 10~35°C, and the conversion pH, i.e., the pH of the buffer solution, is 5~10. More preferably, the conversion temperature is 15~25°C, the pH of the buffer solution is 8~10, and the concentration ratio of L-histidine to β-alanine methyl ester hydrochloride is 5~8:10.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The invention clones a new aminopeptidase gene DmpA from Microcystis basidiomycetes MCA4210, and provides more gene resources for constructing a recombinant bacterium with high-efficiency aminopeptidase enzyme by using genetic engineering technology. By means of genetic engineering, the DmpA gene is heterologously expressed in Escherichia coli, and a recombinant bacterium with high-efficiency expression of aminopeptidase is obtained. A bioconversion process of L-carnosine by the recombinant bacterium is established, and the condensation of L-histidine and β-alanine methyl ester hydrochloride can be efficiently catalyzed to prepare L-carnosine. The aminopeptidase has the advantages of high enzyme activity and high enzymatic reaction level, and can produce 55g / L L-carnosine, especially when the concentration of substrate L-histidine is 70g / L and the concentration of β-alanine methyl ester hydrochloride is 100g / L, and a yield of more than 55% is achieved. It has the advantages of mild conversion conditions, short conversion time and high product yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 For the detection of DmpA PCR products by agarose gel electrophoresis in Example 1, M corresponds to DNA marker, 1 and 2 correspond to target gene amplification bands, and 3 and 4 correspond to colony PCR verification of recombinant aminopeptidase; Figure 2This is the reaction formula for aminopeptidase to catalyze L-histidine and β-alanine methyl ester hydrochloride to produce L-carnosine; Figure 3 Be the L-carnosine standard curve of reference substance solution and sample solution in Example 3; Figure 4 The crude enzyme activity test results of the protease preparation process at different addition times of the inducer; Figure 5 It is the crude enzyme activity at different induction temperatures during the protease preparation process; Figure 6 It is the crude enzyme activity of different IPTG concentrations during the protease preparation process; Figure 7 It is the crude enzyme activity at different induction times during the protease preparation process; Figure 8 is the yield and rate of L-carnosine at different conversion temperatures; Fig. 9 is the yield and rate of L-carnosine at different conversion pH; Fig.10 The output and yield of L-carnosine at different substrate concentrations. DETAILED DESCRIPTION

[0023] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0024] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0025] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in the existing literature. For details, see Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego,1998; METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe,eds.), Academic Press,San Diego, 1999 and METHODS IN MOLECULARBIOLOGY, Vol.119, Chromatin Protocols (PBBecker, ed.) Humana Press, Totowa, 1999, etc.

[0026] The term "fusion protein" refers to a protein comprising at least a first protein genetically linked to at least a second protein. A fusion protein is produced by linking two or more genes that originally encode different proteins. The fusion protein may further comprise additional domains that are not involved in binding to a target, such as, but not limited to, for example, a multimerization moiety, a polypeptide tag, a polypeptide linker, or a moiety that binds to a target other than PSMA. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and / or a SUMO tag, etc.

[0027] Example 1

[0028] This example is to obtain the aminopeptidase encoding gene DmpA of Microcystis pyrifos MCA4210: The Illumina Miseq sequencing technology was used to sequence and analyze the Microcystis sp. MCA4210. According to the gene annotation information, the complete aminopeptidase encoding gene DmpA sequence was obtained as shown in SEQ ID NO: 1, and the amino acid sequence of the aminopeptidase corresponding to the aminopeptidase encoding gene DmpA was shown in SEQ ID NO: 2.

[0029] Primers were designed using Primer 5.0 as follows: DmpA-F 5': ATGGGTCGCGGATCCGAATTCTTAGTAAGCATGGCGGGTCACGAT; DmpA-R 5':CTCGAGTGCGGCCGCAAGCTTATGGAACGTAAACGTATCCGCGAACT.

[0030] Among them, an EcoRI restriction site was introduced into primer DmpA-F, and a HindIII restriction site was introduced into primer DmpA-R.

[0031] The total DNA of Microcystis basidiomycetes MCA4210 was used as a template, primers DmpA-F and DmpA-R were used as amplification primers, and high-fidelity PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa) was selected for PCR amplification. The specific conditions are as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 sec, 55℃ annealing for 15 sec, 72℃ extension for 1 min10 sec, 30 cycles; 72℃ final extension for 5 min; 1.5% agarose gel electrophoresis to detect PCR products. Figure 1 shown.

[0032] The target DNA fragment size was 1152 bp, which was consistent with the target gene fragment length. After sequencing analysis by a sequencing company, the aminopeptidase encoding gene DmpA sequence was obtained, with a length of 1152 bp (SEQ ID NO: 1).

[0033] Example 2

[0034] This example constructs and transforms the expression vector of aminopeptidase encoding gene DmpA: The fragment obtained in Example 1 was double-digested with EcoR I and Hind III, and then connected to the expression vector pET-28a which was also double-digested with EcoR I and Hind III. The ligation product was transformed into competent cells of Escherichia coli DH5α (purchased from TAKARA), and the expression recombinant plasmid was obtained by screening and verification. The recombinant plasmid was sent to Shanghai Jie Li Biotechnology Co., Ltd. for sequencing analysis. The sequence of the aminopeptidase encoding gene DmpA was the nucleotide sequence shown in SEQ ID NO: 1 in the sequence table. The constructed expression recombinant plasmid was transformed into competent cells of Escherichia coli BL21 (DE3) strain (preserved in the laboratory) according to conventional methods to obtain the genetically engineered bacteria BL21- DmpA.

[0035] Example 3

[0036] This example uses genetically engineered bacteria BL21-DmpA to transform and generate L-carnosine and its enzyme activity determination: The recombinant Escherichia coli BL21- DmpA was inoculated into the fermentation medium at a 1% inoculum and cultured in a shaker at 37°C and 200rpm. When OD600 reached about 0.8, it was induced with 0.2mM IPTG for 16 hours. The recombinant Escherichia coli BL21 (DE3) cells were collected from 100mL of the culture by centrifugation at 8000 rpm and 4°C for 10 minutes, then washed twice with 50 mM Tris-HCl buffer (pH 8.0), and finally resuspended with 10mL of buffer.

[0037] The resuspended material was subjected to ultrasonic disruption and then centrifuged at 12000 rpm at 4°C for 30 min, and the supernatant was collected.

[0038] Prepare the reaction solution: Take a crude enzyme solution with a wet bacterial content of 90g / L and add it to a buffer solution containing 50g / L L-histidine and 100g / L β-alanine methyl ester hydrochloride to catalyze the synthesis of L-carnosine from L-histidine and β-alanine methyl ester hydrochloride. The pH of the buffer solution is 8.0. After reacting at 20℃ for 10 min, the reaction is terminated with 2M HCl.

[0039] Prepare sample solution: take the reaction solution, dilute it 50 times with mobile phase, and set aside; prepare reference solution: prepare L-carnosine standard with contents of 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, 600 mg / L, 700 mg / L, 800 mg / L, 900 mg / L, and 1000 mg / L respectively as reference solution, and set aside.

[0040] Aminopeptidase catalyzes the reaction of L-histidine and β-alanine methyl ester hydrochloride to produce L-carnosine. Figure 2 shown.

[0041] The following high performance liquid chromatography method was used to determine the reference solution and the sample solution, to prepare an L-carnosine standard curve, and to calculate the content of L-carnosine in the sample solution; 1 μmol / L of L-carnosine generated per minute was regarded as one enzyme activity unit, and the protease activity was calculated.

[0042] The HPLC detection conditions are as follows: Stationary phase: NH2 column (InertSustain, 5μm, 4.6*250mm); Mobile phase: 50 mM potassium dihydrogen phosphate aqueous solution (adjusted to pH = 4.0 with phosphoric acid): acetonitrile = 35:65; Flow rate: 0.7 mL / min; Injection volume: 20 μL; UV detection wavelength: 215nm.

[0043] Figure 3 This is the standard curve of L-carnosine.

[0044] In the above process, the fermentation medium includes the following components: peptone 10 g / L, yeast powder 5 g / L, glycerol 10 mL / L, disodium hydrogen phosphate dodecahydrate 17.9 g / L, potassium dihydrogen phosphate 6.8 g / L, ammonium chloride 5.3 g / L, anhydrous sodium sulfate 1.4 g / L, magnesium sulfate heptahydrate 1 g / L, and defoamer 0.5 mL / L.

[0045] Example 4

[0046] In this embodiment, the protease is prepared using the genetically engineered bacteria BL21-DmpA, comprising the following steps: The host cells are cultured in a fermentation medium at 37°C for 1h, 2h, 3h, 4h, 5h, and 6h, respectively, 0mmol / L, 0.2mmol / L, 0.4mmol / L, 0.6mmol / L, 0.8mmol / L, and 1.0mmol / L of IPTG are added, respectively, and expression is induced at 16°C, 20°C, 25°C, 30°C, and 37°C, respectively, and the induction culture is carried out for 8h, 12h, 16h, 20h, 24h, and 28h, respectively, to obtain a fermentation broth, and the fermentation broth is crushed to obtain a crude enzyme solution containing protease.

[0047] In the process of preparing protease, the effects of inducer addition time, induction temperature, IPTG concentration and induction time on crude enzyme activity are shown in Figure 4~Figure 7 The protease activity prepared by the method of the present invention is 115 μmol·min-1 ~145 μmol·min -1 between.

[0048] Example 5

[0049] This example uses genetically engineered bacteria BL21-DmpA to transform and generate L-carnosine, and the steps are as follows: The protease activity in Example 4 is 145 μmol·min -1 The implementation scheme of preparing protease, taking a crude enzyme solution with a wet bacterial content of 90g / L and adding it to a buffer solution containing L-histidine and β-alanine methyl ester hydrochloride (see Table 1 for details), catalyzing L-histidine and β-alanine methyl ester hydrochloride to synthesize L-carnosine, the pH of the buffer solution is 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, respectively, reacting at 10℃, 15℃, 20℃, 25℃, 30℃, 35℃ for 2h, and then terminating the reaction with 2M HCl. The L-carnosine content of the conversion liquid is detected by the HPLC detection method in Example 3, and the yield is calculated with L-histidine.

[0050] In the process of converting to L-carnosine, the effects of conversion temperature, conversion pH and substrate concentration are shown in Figure 8~Figure 10 The maximum yield of L-carnosine obtained by the conversion method of the present invention is 55 g / L, and the yield is 55%, which is about 25 times higher than that of the reported aminopeptidase producing 10 mmol / L L-carnosine, indicating that the aminopeptidase provided by the present invention has high catalytic efficiency in the conversion process of catalyzing the synthesis of L-carnosine using L-histidine and β-alanine methyl ester hydrochloride as substrates.

[0051] Table 1: Substrate concentration groups .

[0052] The above-mentioned embodiments only express several feasible implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention, and the embodiments are not used to limit the scope of protection in the claims of the present invention. For ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, and all equivalent implementations or changes that do not depart from the present invention should be included in the technology of the present invention.

Claims

1. An aminopeptidase, characterized in that: The aminopeptidase comprises an amino acid sequence as shown in SEQ ID NO:

2.

2. A nucleic acid for encoding an aminopeptidase, characterized in that: The nucleotide sequence of the nucleic acid is shown in SEQ ID NO:

1.

3. A nucleic acid encoding an aminopeptidase according to claim 2, characterized in that: The total DNA of Microcystis basidiomycetes MCA4210 was used as a template, and primers DmpA-F 5' and DmpA-R 5' were used as amplification primers. An EcoRI restriction site was introduced into the primer DmpA-F 5', and a Hind III restriction site was introduced into the primer DmpA-R 5'. DmpA-F 5': ATGGGTCGCGGATCCGAATTCTTAGTAAGCATGGCGGGTCACGAT; DmpA-R 5':CTCGAGTGCGGCCGCAAGCTTATGGAACGTAAACGTATCCGCGAACT, High-fidelity PrimeSTAR HS DNA Polymerase with GC Buffer was selected for PCR amplification, and then Illumina Miseq sequencing was used to obtain SEQ ID NO:

1.

4. A recombinant expression vector, characterized in that: The recombinant expression vector contains the nucleic acid corresponding to SEQ ID NO:

1.

5. A host cell, characterized in that: The host cell comprises the recombinant expression vector of claim 4 or a nucleic acid corresponding to exogenous SEQ ID NO: 1 integrated into its genome.

6. A method for preparing an aminopeptidase, characterized in that: Cultivate the host cell according to claim 5 to induce the expression of an aminopeptidase containing the sequence SEQ ID NO:

2.

7. The method for preparing an aminopeptidase according to claim 6, characterized in that: The induction expression temperature is 16~37℃, the expression time is 8~28 h, the inducer is IPTG, and the concentration is 0.2~1.0 mmol / L.

8. Use of the aminopeptidase according to claim 1, the nucleic acid according to claim 2 or 3, the recombinant expression vector according to claim 4 or the host cell according to claim 5 for producing L-carnosine from L-histidine and β-alanine methyl ester hydrochloride.

9. The use according to claim 8, characterized in that: Aminopeptidase, nucleic acid, recombinant expression vector or host cell is added as a conversion agent into a buffer solution containing L-histidine and β-alanine methyl ester hydrochloride to convert L-histidine and β-alanine methyl ester hydrochloride into L-carnosine.

10. The use according to claim 9, characterized in that: In the buffer solution, the concentration of L-histidine is 20-70 g / L, the concentration of β-alanine methyl ester hydrochloride is 40-100 g / L; the conversion temperature is 10-35°C, and the pH of the buffer solution is 5-10.

Images