Phosphite dehydrogenase mutant, biological material, screening method, catalyst and application

Abstract

The invention discloses a phosphite dehydrogenase mutant, a biological material, a preparation method and application, and compared with wild phosphite dehydrogenase, the phosphite dehydrogenase mutant has one or more amino acid residue mutations in the 29th site, the 31st site, the 59th site, the 68th site, the 185th site and the 275th site. According to the mutant, the regeneration efficiency of reduced coenzyme NADH is effectively improved, and the catalytic efficiency of the mutant N29T / Q185C / K275E is 1.7 times that of wild type phosphite dehydrogenase; the mutant is mild in reaction condition and wide in range, the reaction temperature is 15-40 DEG C, the reaction pH is 4-10, the stability is improved compared with that of wild phosphite dehydrogenase, and the mutant has high application value.

Description

Technical Field

[0001] The invention relates to phosphite dehydrogenase, and in particular to a phosphite dehydrogenase mutant, a biomaterial, a screening method, a catalyst and an application. Background Art

[0002] Phosphite dehydrogenase (PDH) is an oxidoreductase that catalyzes the 2- ) is oxidized to phosphate (PO4 3- ), and the oxidized coenzyme NAD + Converted into the reduced coenzyme NADH. Phosphite dehydrogenase was first discovered in the Gram-negative bacterium Pseudomonas stutzeri. In recent years, with the rapid development of genome mining and functional screening technology, different isozymes have also been found in a variety of microorganisms. These enzymes achieve the conversion of phosphorus compounds in microorganisms by oxidizing trivalent phosphorus to pentavalent phosphorus, providing a new research basis for the application expansion of phosphite dehydrogenase.

[0003] Phosphite dehydrogenase has a wide range of application prospects and shows great potential in many fields:

[0004] In the field of industrial production, the coenzyme regeneration system composed of phosphite dehydrogenase and phosphite can efficiently convert the oxidized coenzyme NAD + It is converted into reduced coenzyme NADH to achieve the recycling of coenzyme. At the same time, its byproduct phosphate is easy to remove, which simplifies the product purification process and reduces production costs, making phosphite dehydrogenase show unique advantages;

[0005] In the field of environmental protection, the ability of phosphite dehydrogenase to catalyze the conversion of phosphite into phosphate can be used to treat phosphite pollutants in industrial wastewater. This efficient and controllable reaction method is a green and environmentally friendly solution. In addition, environmental pollution problems caused by excessive use of phosphate fertilizers and phosphorus-containing herbicides can also be treated and alleviated by phosphite dehydrogenase.

[0006] In the field of genetic engineering, by introducing phosphite dehydrogenase genes into plant genomes, plants can be endowed with the ability to utilize phosphite in the soil and improve resource utilization. This genetic engineering modification not only helps solve the problem of phosphate fertilizer pollution, but also reduces agricultural production costs, and has important ecological and economic value.

[0007] Although phosphite dehydrogenase has shown broad application potential, its low catalytic efficiency and poor stability are still the main challenges restricting its practical application. How to improve the catalytic efficiency and stability of phosphite dehydrogenase in the coenzyme regeneration system is an important research direction to promote its industrialization and environmental governance applications. Summary of the invention

[0008] Purpose of the invention: The purpose of the present invention is to provide a phosphite dehydrogenase mutant with high catalytic activity and good stability; the second purpose is to provide biological materials and screening methods related to the mutant; the third purpose is to provide the application of the mutant in the synthesis of reduced coenzyme NADH.

[0009] Technical solution: The phosphite dehydrogenase mutant of the present invention is based on the wild-type phosphite dehydrogenase amino acid sequence shown in SEQ ID NO: 1, and has one or more amino acid residue mutations at positions 29, 31, 59, 68, 185, and 275.

[0010] Preferably, in the amino acid mutation, the asparagine residue at position 29 mutates to a threonine residue, the lysine residue at position 31 mutates to a serine residue, the asparagine residue at position 59 mutates to a serine residue, the glutamic acid residue at position 68 mutates to a histidine residue, the glutamine residue at position 185 mutates to a cysteine ​​residue, and the lysine residue at position 275 mutates to a glutamic acid residue.

[0011] The nucleotide sequence of the present invention is based on the wild-type phosphite dehydrogenase nucleotide sequence shown in SEQ ID NO: 2, contains corresponding base mutations, and encodes the amino acid sequence of the aforementioned phosphite dehydrogenase mutant.

[0012] The recombinant vector of the present invention comprises the aforementioned nucleotide sequence.

[0013] The recombinant microorganism of the present invention comprises the aforementioned nucleotide sequence or the aforementioned recombinant vector.

[0014] The method for screening phosphite dehydrogenase mutants of the present invention comprises:

[0015] (1) screening wild-type phosphite dehydrogenases from different sources to obtain a suitable wild-type phosphite dehydrogenase;

[0016] (2) using the three-dimensional structure of the wild-type phosphite dehydrogenase obtained in step 1 as a template, performing visualization analysis to screen key sites that affect enzyme activity and stereoselectivity;

[0017] (3) Mutating the key sites screened in step 2 to obtain a phosphite dehydrogenase mutant having one or more point mutations.

[0018] Preferably, in step 2, wild-type phosphite dehydrogenase from Planococcus maritimus is used.

[0019] The catalyst of the present invention comprises the aforementioned phosphite dehydrogenase mutant.

[0020] The invention relates to the use of the phosphite dehydrogenase mutant or catalyst in the synthesis of reduced coenzyme NADH.

[0021] Preferably, the reaction temperature of the application is 15-40°C, and the reaction pH is 4-10.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The obtained mutant can effectively improve the regeneration efficiency of the reduced coenzyme NADH, and the catalytic efficiency of the mutant N29T / Q185C / K275E is 1.7 times that of the wild-type phosphite dehydrogenase; 2. The reaction conditions are mild and wide, the reaction temperature is 15-40°C, the reaction pH is 4-10, and the stability is improved compared with the wild-type phosphite dehydrogenase. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The relative activity diagram of wild-type phosphite dehydrogenase and mutant in synthesizing reduced coenzyme NADH;

[0024] Figure 2 The relative activity of phosphite dehydrogenase mutant N29T / Q185C / K275E in synthesizing reduced coenzyme NADH at different temperatures;

[0025] Figure 3 The relative activity of phosphite dehydrogenase mutant N29T / Q185C / K275E in synthesizing reduced coenzyme NADH at different pH;

[0026] Figure 4 This is the Michaelis-Menten rate curve of the phosphite dehydrogenase mutant N29T / Q185C / K275E. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below.

[0028] Example 1: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant N29T

[0029] 1. Construction of phosphite dehydrogenase mutant plasmid

[0030] 1.1 Obtaining pET22b-PDH

[0031] The wild-type gene of phosphite dehydrogenase from Planococcus maritimus was synthesized by Jinweizhi (Suzhou) Company and constructed on the pET22b vector. The vector was transformed into the E. coli DH5α strain, and the recombinant bacteria E. coli DH5α / pET22b-PDH was inoculated into a 5mL test tube with medium and cultured at 37°C and 220rpm for 12 hours. After the culture, the bacteria were centrifuged at 12000rpm for 1min and the cells were collected. The plasmid was extracted from E. coli DH5α / pET22b-PDH using a high-purity plasmid mini-extraction kit as a template for iterative mutation to construct the plasmid pET22b-PDH mutant.

[0032] 1.2 Construction of recombinant E. coli BL21(DE3) / pET22b-PDH N29T mutant

[0033] The gene mutation was performed by whole plasmid PCR to obtain the target mutant gene. The primers designed for N29T mutation are as follows:

[0034] N29T upstream primer: gcaaccagaccgataaaccgctgacctac

[0035] N29T downstream primer: gtttatcggtctggttgctgatcacttcg

[0036] The PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0037] Table 1 PCR reaction system

[0038]

[0039]

[0040] Table 2 PCR reaction conditions

[0041]

[0042] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0043] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into E.coliDH5α competent cells, spread on the surface of LB solid culture medium containing 100μg / mL ampicillin, cultured at 37℃ for 12h, picked a single colony to LB liquid culture, identified the successfully constructed positive transformant by PCR, and verified the correctness of the mutation site by sequencing. After verification, a part of it was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80℃ for use, and a part of the bacteria was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20℃ refrigerator.

[0044] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-PDH N29T.

[0045] 2. Cultivation of phosphite dehydrogenase mutants and preparation of crude enzyme solution

[0046] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-PDH was spread on a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured at 37 ° C and 200 rpm overnight. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance. At OD 600 When the concentration reached about 0.6, IPTG was added to a final concentration of 0.5 mM and induced at 18°C ​​for 14 h.

[0047] After obtaining the bacterial cells by centrifugation, resuspend them in buffer, disrupt the cells by ultrasonication in an ice bath (working for 3 seconds, interval for 6 seconds, working time for 15 minutes), and centrifuge at 12000 rpm for 20 minutes at 4°C. After collecting the supernatant, filter it through a 0.22μm water filter to obtain the crude enzyme solution.

[0048] Example 2: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant K31S

[0049] The K31S mutant was prepared based on Example 1. In step 1.2, the primers were changed, and the other steps remained unchanged. The primers were as follows:

[0050] K31S upstream primer: cagaacgatagcccgctgacctacgaaaaactg

[0051] K31S downstream primer: ggtcagcgggctatcgttctggttgctgatcac

[0052] Example 3: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant N59S

[0053] The N59S mutant was prepared based on Example 1. In step 1.2, the primers were changed, and the other steps remained unchanged. The primers were as follows:

[0054] N59S upstream primer: cgataaaagcttcctggataacagcaaaaac

[0055] N59S downstream primer: tccaggaagcttttatcgatacggtccggcat

[0056] Example 4: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant K275E

[0057] The K275E mutant was prepared based on Example 1. In step 1.2, the primers were changed and the other conditions remained unchanged. The primers were as follows:

[0058] K275E upstream primer: ccgaaagaaatcaaccaggaactgctgaacc

[0059] K275E downstream primer: CTGGTTGATTTCTTTTCGGACGATCTTTGATAG

[0060] Example 5: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant N29T / E68H

[0061] The N29T / E68H mutant was prepared based on Example 1. The plasmid obtained in Example 1 was used as the DNA template in step 1.2. The primers were changed and the other steps remained unchanged. The primers were as follows:

[0062] N29T / E68H upstream primer: caaaaacctgcacatcatcagcggcgcgctgc

[0063] N29T / E68H downstream primer: gatgatgtgcaggtttttgctgttatccagg

[0064] Example 6: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant N29T / K275E

[0065] N29T / K275E mutant Based on Example 1, the plasmid obtained in Example 1 was used as the DNA template in step 1.2, the primers were changed, and the other conditions remained unchanged. The primers are as follows:

[0066] N29T / K275E upstream primer: ccgaaagaaatcaaccaggaactgctgaacc

[0067] N29T / K275E downstream primer: CTGGTTGATTTCTTTTCGGACGATCTTTGATAG

[0068] Example 7: Construction, culture and crude enzyme solution preparation of phosphite dehydrogenase mutant N29T / Q185C / K275E

[0069] N29T / Q185C / K275E mutant Based on Example 1, the plasmid obtained in Example 6 was used as the DNA template in step 1.2, the primers were changed, and the other conditions remained unchanged. The primers are as follows:

[0070] N29T / Q185C / K275E upstream primer: gacgaacagtgcctgaacaccaaatacctgg

[0071] N29T / Q185C / K275E downstream primer: gtgttcaggcactgttcgtcgatggagtccag

[0072] Example 8: Performance test of the obtained phosphite dehydrogenase mutant

[0073] 1. Wild-type phosphite dehydrogenase and its mutants catalyze the oxidation of coenzyme NAD + Reduced to reduced coenzyme NADH

[0074] The corresponding engineered bacteria expressing phosphite dehydrogenase and its mutants were cultured according to the construction of Examples 1-7 and the obtained crude enzyme solution was used as a catalyst.

[0075] The reaction system is: OD 600 = 20 crude enzyme solution, 2.5mM oxidized coenzyme NAD + , 10 mM phosphite, the reaction buffer is 50 mM phosphate buffer at pH = 7. The reaction temperature is controlled at 30°C by a water bath, the reaction is carried out for 5 min, and the absorbance change of the product NADH at 340 nm within 5 min is detected by an ELISA instrument to compare the relative activity.

[0076] The test results are shown in Table 3 and Figure 1 shown.

[0077] Table 3 Reduction of wild-type phosphite dehydrogenase and mutants to generate reduced coenzyme NADH

[0078] strain Cell concentration Relative activity WT <![CDATA[OD 600 =20]]> 100％ N29T <![CDATA[OD 600 =20]]> 127％ N59S <![CDATA[OD 600 =20]]> 157％ K31S <![CDATA[OD 600 =20]]> 142％ K275E <![CDATA[OD 600 =20]]> 130％ N29T / E68H <![CDATA[OD 600 =20]]> 152％ N29T / K275E <![CDATA[OD 600 =20]]> 156％ N29T / Q185C / K275E <![CDATA[OD 600 =20]]> 170％

[0079] Depend on Figure 1It can be seen that the catalytic conversion rates of all mutants are higher than that of wild-type phosphite dehydrogenase, especially the catalytic efficiency of mutant N29T / Q185T / K275E is 1.7 times that of wild-type phosphite dehydrogenase.

[0080] 2. Phosphite dehydrogenase mutant (N29T / Q185C / K275E) catalyzes the oxidation of coenzyme NAD + Optimum temperature for reduction to reduced coenzyme NADH

[0081] The corresponding engineered bacteria expressing phosphite dehydrogenase and its mutants were cultured according to the construction of Example 7 and the obtained crude enzyme solution was used as a catalyst.

[0082] The reaction system is: OD 600 = 20 crude enzyme solution, 2.5mM oxidized coenzyme NAD + , 10mM phosphite, the reaction buffer is 50mM phosphate buffer with pH=7. The reaction temperature is controlled at 15℃, 20℃, 25℃, 30℃, 35℃, 40℃ by water bath, the reaction is 5min, and the absorbance change of the product NADH at 340nm within 5min is detected by microplate reader to compare the relative activity. The test results are shown in Figure 2 .

[0083] Depend on Figure 2 It can be seen that the best catalytic effect was observed at 35°C, and the enzyme activity was good in the range of 15-40°C.

[0084] 3. Phosphite dehydrogenase mutant (N29T / Q185C / K275E) catalyzes the oxidation of coenzyme NAD + Optimal pH for reduction to reduced coenzyme NADH

[0085] The corresponding engineered bacteria expressing phosphite dehydrogenase and its mutants were cultured according to the construction of Example 7 and the obtained crude enzyme solution was used as a catalyst.

[0086] The reaction system is: OD 600 = 20 crude enzyme solution, 2.5mM oxidized coenzyme NAD +, 10mM phosphite, the reaction buffer is 50mM pH = 4 citric acid-phosphate buffer, 50mM pH = 5 citric acid-phosphate buffer, 50mM pH = 6 potassium phosphate buffer, 50mM pH = 6.5 potassium phosphate buffer, 50mM pH = 7 potassium phosphate buffer, 50mM pH = 7.5 Tris-HCl buffer, 50mM pH = 8 Tris-HCl buffer, 50mM pH = 9 Gly-NaOH buffer, 50mM pH = 9.5 Gly-NaOH buffer, 50mM pH = 10 Gly-NaOH buffer. The reaction temperature is controlled at 35°C by a water bath, the reaction is carried out for 5 minutes, and the absorbance change of the product NADH at 340nm within 5 minutes is detected by an enzyme marker to compare the relative activity. The test results are shown in Figure 3 .

[0087] Depend on Figure 3 It can be seen that different pH has a significant effect on the catalytic effect of PDH. The best catalytic effect was observed at pH 7. In addition, the enzyme catalytic activity was relatively high when the pH was in the range of 4-10.

[0088] 4. Phosphite dehydrogenase mutant (N29T / Q185C / K275E) catalyzes the oxidation of coenzyme NAD + Kinetic parameters of reduction to reduced coenzyme NADH

[0089] At different concentrations of NAD + The kinetic parameters of phosphite dehydrogenase and its mutants were determined with the substrate as the substrate. The experiment was carried out at pH = 7, enzyme concentration of 0.005 mM, reaction time of 5 min, first-order reaction velocity as the ordinate, substrate concentration as the abscissa, and nonlinear fitting to obtain V max and K m Parameter value, then find K cat The results are shown in Table 4:

[0090] Table 4 Kinetic parameters of phosphite dehydrogenase mutant N29T / Q185C / K275E

[0091]

Claims

1. A phosphite dehydrogenase mutant, characterized in that: Based on the wild-type phosphite dehydrogenase amino acid sequence shown in SEQ ID NO: 1, one or more amino acid residues at positions 29, 31, 59, 68, 185 and 275 are mutated.

2. The phosphite dehydrogenase mutant according to claim 1, characterized in that Among the amino acid mutations, the asparagine residue at position 29 mutates to a threonine residue, the lysine residue at position 31 mutates to a serine residue, the asparagine residue at position 59 mutates to a serine residue, the glutamic acid residue at position 68 mutates to a histidine residue, the glutamine residue at position 185 mutates to a cysteine ​​residue, and the lysine residue at position 275 mutates to a glutamic acid residue.

3. A nucleotide sequence, characterized in that Based on the wild-type phosphite dehydrogenase nucleotide sequence shown in SEQ ID NO: 2, the amino acid sequence of the phosphite dehydrogenase mutant according to claim 1 or 2 is encoded, including corresponding base mutations.

4. A recombinant vector, characterized in that: The recombinant vector comprises the nucleotide sequence of claim 3.

5. A recombinant microorganism, characterized in that The recombinant microorganism comprises the nucleotide sequence of claim 3 or the recombinant vector of claim 4.

6. A method for screening a phosphite dehydrogenase mutant according to claim 1 or 2, characterized in that: include: (1) screening wild-type phosphite dehydrogenases from different sources to obtain a suitable wild-type phosphite dehydrogenase; (2) using the three-dimensional structure of the wild-type phosphite dehydrogenase obtained in step 1 as a template, performing visualization analysis to screen key sites that affect enzyme activity and stereoselectivity; (3) Mutating the key sites screened in step 2 to obtain a phosphite dehydrogenase mutant having one or more point mutations.

7. The method for screening phosphite dehydrogenase mutants according to claim 6, characterized in that: In the step 2, wild-type phosphite dehydrogenase from Planococcus maritimus is selected.

8. A catalyst, characterized in that The catalyst comprises the phosphite dehydrogenase mutant according to claim 1 or 2.

9. Use of the phosphite dehydrogenase mutant according to claim 1 or 2 or the catalyst according to claim 8 in synthesizing reduced coenzyme NADH.

10. The application according to claim 9, characterized in that: The reaction temperature of the application is 15-40° C., and the reaction pH is 4-10.

Images