Application of MSR1 gene and coding thereof in regulation and control of sepsis DC necroptosis

Abstract

The invention relates to the technical field of biomedicine, in particular to application of an MSR1 gene in sepsis DC necroptosis regulation and control. When the MSR1 gene is knocked out to reduce sepsis, the DC is subjected to necroptosis, and a new action target is provided for treating sepsis.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of MSR1 gene and its coding in regulating DC necroptosis in sepsis. Background Art

[0002] Sepsis is usually caused by microbial infection, which triggers a systemic inflammatory response, leading to the activation of multiple cells and molecules and the release of inflammatory mediators. These mediators are originally used to fight infection, but in sepsis, the inflammatory response may be out of control, triggering fatal organ dysfunction. In my country, about 1 million patients die from sepsis each year, among which the mortality rate of sepsis patients in intensive care units is as high as 35.5%. With the intensification of the aging trend of the population, the incidence and mortality of sepsis are increasing year by year, causing huge medical burden and social pressure.

[0003] Prior art, such as the invention patent with patent application number 2016102794739, provides an exosome, a method for preparing exosomes, and their use in preparing drugs or preparations for treating sepsis, specifically involving optimizing the treatment of human umbilical cord mesenchymal stem cells with recombinant human IL-1β to enhance their immunosuppressive function, and extracting the exosomes produced for the treatment of sepsis. The exosomes can effectively alleviate sepsis symptoms and increase the survival rate of septic mice by inhibiting T cells and macrophages.

[0004] However, studies have found that dendritic cells (DC) play an important role in both immune activation and immune tolerance, and one DC can activate 100 to 3,000 T cells, which is 100 to 1,000 times the ability of macrophages and B cells to activate T cells. Dendritic cells (DC) play a central role in activating and regulating immune responses. The role of dendritic cells in immune system diseases and neurological diseases also makes them a potential target for the treatment of these diseases.

[0005] MSR1, also known as scavenger receptor A (SR-A) or cluster of differentiation 204 (CD204), was first described by Brownn and Goldstein in 1979. They proved that MSR1 mediated the uptake and degradation of acetylated low-density lipoprotein, leading to increased cholesterol deposition in cells. MSR1 is mainly expressed on macrophages and DCs. Recent studies have found that MSR1 also exists on the surface of lymphocytes and may be involved in the pathogenesis of asthma and chronic obstructive pulmonary disease. Since macrophages mainly clear pathogens through phagocytosis and cytokine production, MSR1 plays an important role in the process of clearing foreign pathogens. Through the study of MSR1's regulation of dendritic cells, we can more accurately and effectively regulate immune activation and inhibition, improve the efficiency of immune response, and provide new ideas and methods for the treatment of immune-related diseases. Summary of the invention

[0006] In order to solve the problems in the above background technology, the object of the present invention is to provide a use of a preparation for inhibiting or knocking out the expression of the MSR1 gene in the preparation of a product for preventing or treating sepsis DC necroptosis.

[0007] Preferably, the preparation is gRNA-B1 or gRNA-B2 that inhibits the expression of the MSR1 gene; the sequence of the gRNA-B1 is: GGCCTTTGCACGTGAAGAGG-AGG, as shown in SEQ ID NO.1; the sequence of the gRNA-B2 is: ACTTGGGGAAATAAGGTAC-AGG, as shown in SEQ ID NO.2.

[0008] Preferably, the agent that inhibits or knocks out the expression of the MSR1 gene can inhibit the decrease in the phosphorylation levels of the necroptosis proteins RIPK1, RIPK3 and MLKL in septic DCs of mice.

[0009] Preferably, the preparation that inhibits or knocks out the expression of the MSR1 gene can inhibit the reduction of the level of cytokines in necroptosis cytokines in septic DCs in mice, and the markers of the cytokines are HMGB1, IL-1α, IL-33, LDH and TNF-α.

[0010] In summary, the beneficial effects of the present invention are:

[0011] Beneficial effects of the present invention: The method provided by the present invention - knocking out the MSR1 gene can effectively reduce the phosphorylation level of DC necroptosis-related proteins during sepsis; reduce the proportion of DC necroptosis, necroptosis-related DAMPs and cytokine levels;

[0012] Knockout of the MSR1 gene in this application has a significant protective effect on DC necroptosis under sepsis conditions, alleviating the systemic inflammatory response triggered by sepsis;

[0013] The present application reduces the necroptosis of DCs during sepsis by knocking out the MSR1 gene, thereby providing a new target for the treatment of sepsis.

[0014] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented in accordance with the contents of the specification. In order to make the above and other purposes, features and advantages of the present invention more obvious and easy to understand, the following specifically cites a preferred embodiment and describes it in detail with the accompanying drawings as follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 :Western Blot was used to detect the expression of WT mice and Msr1 - / - Changes of necroptosis-related proteins in mouse spleen DC after in vitro stimulation and MSC-Exo treatment;

[0016] Figure 2 :(A) Flow cytometry was used to detect the expression of WT mice and Msr1 - / - The proportion of DC necroptosis in mouse spleen DC after in vitro stimulation and MSC-Exo treatment; (B) SYTOX-Green staining was used to detect the proportion of DC necroptosis in WT mice and Msr1- / - mice spleen DC after in vitro stimulation and MSC-Exo treatment;

[0017] Figure 3 :The effect of MSR1 gene knockout on the p-MLKL fluorescence intensity and the proportion of positive cells in DCs under sepsis conditions was observed using laser confocal microscopy;

[0018] Figure 4 :The effect of MSR1 gene knockout on the fluorescence intensity and positive cell ratio of p-RIPK3 in DCs under sepsis conditions was observed by laser confocal microscopy;

[0019] Figure 5 :The effect of MSR1 gene knockout on the levels of necroptosis-related cytokines in DC culture supernatant under sepsis conditions;

[0020] Figure 6 :Effects of conditional knockout of MSR1 gene on the expression levels of DC necroptosis-related proteins in septic mice;

[0021] Figure 7 :Effect of conditional knockout of MSR1 gene on the proportion of DC necroptosis in septic mice;

[0022] Figure 8 :The effect of conditional knockout of MSR1 gene on p-MLKL fluorescence intensity and positive cell ratio in DC of septic mice was observed by laser confocal microscopy;

[0023] Fig. 9 :The effect of conditional knockout of MSR1 gene on the fluorescence intensity and proportion of p-RIPK3 positive cells in DC of septic mice was observed by laser confocal microscopy;

[0024] Fig.10 :Effects of conditional knockout of MSR1 gene on necroptosis-related DAMPs and cytokines in septic mice. DETAILED DESCRIPTION

[0025] In order to make the content of the present invention more clearly understood, the present invention is further described below based on specific embodiments in conjunction with the accompanying drawings.

[0026] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0027] 1. Experimental Preparation

[0028] The following experiments used SPF wild-type (WT) C57BL / 6J mice, male, provided by Beijing Huafukang Biological Co., Ltd. - / - Mice and mice with conditional knockout of Msr1 gene expression (Cd11c cre Msr1 fl / fl ) mice were commissioned to Guangzhou Saiye Biotechnology Co., Ltd. to construct and raise to 7±1 weeks of age, wherein the mice with conditional knockout of Msr1 gene expression refer to siRNA or sgRNA that knocks out Msr1 gene expression, and the weight of each mouse is about 22.5±2.5g, wherein the sequence of Msr1 gene is Forward GGGAGTGTAGGCGGATCA, as shown in SEQ ID NO.3; Reverse GGAGATGATAGTAGGGTGCTCTG, as shown in SEQ ID NO.4. The sequence of sgRNA is gRNA-B1: GGCCTTTGCACGTGAAGAGG-AGG; the sequence of gRNA-B2 is: ACTTGGGGAAATAAGGTAC-AGG. The mice were placed in an SPF animal room with a temperature of 22°C and a humidity of 65%. They were fed adaptively for 1 week, maintained with good ventilation and provided with drinking water at any time.

[0029] Animal grouping: 24 normal Msr1 fl / flMice and 24 conditional knockout mice of MSR1 gene were randomly divided into 3 groups according to the random number table method, with 8 mice in each group. One group was opened and the cecum was turned over and the abdomen was closed, which was the sham operation group; one group was subjected to CLP modeling, which was the model group; and one group was injected with MSC-exo through the tail vein immediately after the CLP modeling was completed, with a dose of 100 μg / mouse, which was the treatment group. The sham operation group, model group and treatment group were sampled 24 hours after modeling, and the eyeballs were removed after anesthesia to collect blood. After the blood collection was completed, the mice were killed by cervical dislocation for sampling.

[0030] Splenic DCs were isolated from WT and Msr1 - / - Mouse spleen DCs were stimulated with PBS, LPS+z-VAD, and LPS+z-VAD+mesenchymal stem cells (MSC-Exo) respectively. Cells and cell culture supernatants were collected from each group after 24 hours and stored in a -20℃ refrigerator for subsequent processing.

[0031] The method of LPS+z-VAD combined stimulation in each group of the following experiments was as follows: 2 hours after the cells were inoculated in the cell culture flask, an in vitro sepsis model was established by LPS stimulation at a concentration of 1 μg / mL. The cells were pre-stimulated with z-VAD-FMK (z-VAD), a broad-spectrum caspase kinase inhibitor, at a working concentration of 20 μM. After the cells were pre-stimulated with z-VAD for 30 minutes, LPS stimulation was combined to induce cell necrosis.

[0032] The method of establishing a mouse sepsis model by the CLP method in the experiment is as follows: the mice were fasted for 12 hours before the operation, but were not allowed to drink water. The mice were anesthetized by intraperitoneal injection of chloral hydrate (5%), and the anesthetic dose (10 mL / kg) was determined according to the weight of the mice. After anesthesia, the mice were fixed on the operating board in the supine position; the abdominal skin of the mice was disinfected with iodine tincture, and incisions were made layer by layer along the midline of the abdomen with a length of 1 cm; the cecum was quickly found after the abdomen was opened, and sterile No. 4 thread was used to ligate it 1.0 cm away from the end of the cecum, and a 22G needle was used to penetrate the cecum once at the distal end of the ligation, and the ligated intestinal tube was squeezed to allow part of the intestinal contents to overflow, and the cecum was returned to the abdominal cavity in situ, sutured layer by layer, and the abdomen was closed; 1 mL of 0.9% saline was injected subcutaneously behind the neck of the mice, and the mice were transferred to the breeding cage, and insulation measures were taken. After waking up, the mice could eat and drink freely.

[0033] Mouse mononuclear cells used in the experiment were isolated by the following steps:

[0034] S1, mice were killed by cervical dislocation, the abdominal skin was cut open after alcohol disinfection, and the spleen was bluntly separated and placed in a sterile centrifuge tube containing pre-cooled sterile phosphate-buffered saline (PBS);

[0035] S2, process spleen tissue in a clean bench, use forceps to remove connective tissue such as spleen capsule, carefully tear the spleen into pieces, and carefully transfer it to a cell filter (75 μm) to fully grind the spleen tissue. During the grinding process, rinse the filter with PBS intermittently. After the grinding is completed, mix the filtrate and transfer it to a centrifuge tube to obtain a spleen cell suspension;

[0036] S3, dilute the spleen cell suspension with PBS, then centrifuge the spleen cell suspension in a centrifuge at a speed of 1500 rpm for 5 min, discard the supernatant, precipitate, and then resuspend with PBS;

[0037] S4, add 4 mL of mononuclear cell separation solution to a new 15 mL centrifuge tube, slowly add an equal volume of spleen cell suspension treated in step S3 to the upper layer of mononuclear cell separation solution, carefully transfer to a centrifuge for centrifugation at a speed of 3000 rpm for 15 min;

[0038] S5. After centrifugation, carefully pipette the cells in the middle cloud layer of the centrifuge tube into a new 15 mL centrifuge tube, wash them three times with PBS, and then count them.

[0039] (4) The mouse peripheral blood mononuclear cells used in the following experiments were isolated by the following steps:

[0040] S1, after the mice were anesthetized, the eyeballs were removed and blood was collected and placed in EDTA anticoagulant tubes;

[0041] S2, transfer the blood in the EDTA anticoagulant tube to a 15mL centrifuge tube in a sterile clean bench, then place the centrifuge tube in a centrifuge and centrifuge at room temperature at a speed of 3000rpm for 10min, then carefully draw the plasma from the upper layer of the centrifuge tube and place it in a 1.5mL EP tube, then place the EP tube in a -80℃ refrigerator for freezing for subsequent testing;

[0042] S3, thoroughly mix the blood cells in the lower layer of the centrifuge tube with PBS containing 0.5uM ethylenediaminetetraacetic acid (EDTA) at a ratio of 1:2 to obtain a diluted lower layer blood cell suspension, and add an equal volume of mouse peripheral blood lymphocyte separation solution to another centrifuge tube;

[0043] S4, slowly dripping the diluted lower layer blood cell suspension onto the upper layer of mouse peripheral blood lymphocyte separation solution, and then placing the mixture into a centrifuge for centrifugation at room temperature, with a centrifugal force of 550±50g and a centrifugal time of 30min, wherein the centrifuge acceleration is 9 and the centrifuge deceleration is 1;

[0044] S5, after step S4, carefully aspirate the cells in the middle cloud layer of the centrifuge tube, add PBS to mix, and then put it into a centrifuge for centrifugation at room temperature, with a centrifugal speed of 1500 rpm and a centrifugal time of 5 min. Repeat the washing of the cells twice;

[0045] S6. After cell washing, resuspend the cells to obtain mouse peripheral blood mononuclear cell suspension, and count them for subsequent experiments.

[0046] 2. Experimental Analysis

[0047] Experiment 1: Western Blot analysis of WT mice and Msr1 - / - Levels of necroptosis-related proteins in mouse spleen DC after in vitro stimulation and MSC-Exo treatment

[0048] Western Blot

[0049] Step 1: PAGE gel preparation and electrophoresis

[0050] Use deionized water to clean the glass plate, align the bottom of the cleaned glass plate and put it into the gel maker, use an inclined insert to fix the glass plate, check whether there is a gap at the bottom of the glass plate, add water and let it stand for 20 minutes, and check whether there is leakage at the bottom; prepare electrophoresis buffer and electrotransfer buffer; discard the liquid in the glass plate, mix separation gel A liquid and separation gel B liquid in equal amounts to obtain a mixed liquid one, then add 10% ammonium persulfate with a concentration of 1% of the volume of the mixed liquid one, and then put it into a vortex oscillator for oscillation to obtain a separation gel, put the separation gel into the middle layer of the glass plate, and seal it with pure water for 20 minutes; after the separation gel solidifies, observe whether the interface between the separation gel and water is flush; discard the liquid in the plate, mix the concentrated gel A liquid and the concentrated gel Equal amounts of liquid B were mixed to obtain mixed solution II, 10% ammonium persulfate accounting for 1% of the volume of mixed solution II was added, and then the mixture was placed in a vortex oscillator for oscillation to obtain concentrated gel, and the concentrated gel was added to the middle layer of the glass plate. After removing the bubbles, the comb ruler was slowly inserted vertically; after the upper layer of gel solidified, electrophoresis buffer was added to the gel caster, and the comb ruler was slowly pulled out vertically, and equal amounts of protein samples were added to the loading wells, with a protein amount of 20 μg added to each well, and pre-stained protein markers were added to the holes at both ends of the sample, 5 μL and 2.5 μL respectively; the gel caster and the glass plate were transferred to the electrophoresis tank, an appropriate amount of electrophoresis buffer was added, the power supply was connected and the parameters were set, the voltage was adjusted to 180 V, and the electrophoresis time was set to 50 min.

[0051] Step 2: Transfer

[0052] Prepare 6 sheets of 7×9 cm filter paper and 1 sheet of 7×9 cm PVDF membrane, where the pore size on the PVDF membrane is 0.45 μm, and the PVDF membrane needs to be activated with methanol for 2 minutes before use; take out the glass plate in the electrophoresis tank, carefully separate the two glass plates and take out the gel, and cut the gel; soak the filter paper, sponge pad and gel in the electrophoresis solution, open the transfer clamp, place them according to the white on the left and the black on the right, and place a sponge pad and 3 layers of filter paper on each side; place the gel on the upper layer of the filter paper on the black clamp, carefully cover the PVDF membrane activated by methanol on the gel, ensure that there are no bubbles, and finally clamp the clamp and put it in the electrotransfer tank; fill the electrotransfer tank with electrotransfer buffer, connect the power supply and set the power supply parameters, adjust the current to 200 mA, and the electrotransfer time to 110 minutes. Place the electrotransfer tank in ice to cool down during the entire transfer process.

[0053] Step 3: Immune Response

[0054] After the transfer, the PVDF membrane was carefully taken out and placed in TBST buffer, washed on a shaker for 5 minutes, placed in a quick blocking solution, placed on a horizontal shaker, and blocked at room temperature for 10 minutes; after blocking, the PVDF membrane was washed with TBST buffer for 5 minutes each time, repeated 3 times; the primary antibody was diluted, the phosphorylated antibody was diluted with 5% BSA at a dilution ratio of 1:500, and the non-phosphorylated antibody was diluted with TBST buffer at a dilution ratio of 1:1000. The PVDF membrane was placed in the diluted primary antibody, placed on a shaker, and incubated overnight at 4°C; the primary antibody was recovered, and the PVDF membrane was washed with TBST buffer, repeated 3 times, each time for 5 minutes; the species of the primary antibody was determined, and the corresponding secondary antibody was diluted with TBST buffer at a dilution ratio of 1:5000. The PVDF membrane was placed in the corresponding secondary antibody solution, placed on a shaker, and incubated at room temperature for 1 hour; after incubation, the secondary antibody was recovered, and the PVDF membrane was washed with TBST buffer, repeated 3 times, each time for 5 minutes.

[0055] Step 4: Chemiluminescence

[0056] Prepare chemiluminescent solution, with A and B solutions in a 1:1 volume ratio, and avoid light; clean the background plate of the exposure instrument, place the PVDF membrane on the background plate, and evenly drip the chemiluminescent solution on the membrane; adjust the exposure parameters and save the exposure image.

[0057] Step 5: Gel Image Analysis

[0058] The images obtained by exposure were semi-quantitatively analyzed using ImageJ software, and the grayscale values ​​of different samples were calculated and recorded.

[0059] Experimental results: Compared with the control group, WT mice and Msr1 - / -The ratios of p-RIPK1 / RIPK1 (P<0.01), p-RIPK3 / RIPK3 (P<0.01), and p-MLKL / MLKL (P<0.01) in mouse spleen DC increased significantly after in vitro stimulation, and MSC-Exo treatment could significantly reduce the phosphorylation levels of RIPK1 (P<0.01), RIPK3 (P<0.01), and MLKL (P<0.01). - / - The levels of p-RIPK1 (P<0.01), p-RIPK3 (P<0.05) and p-MLKL (P<0.01) in the splenic DCs of mice were significantly lower than those in the stimulated WT mice.

[0060] The results showed that MSR1 gene knockout could significantly reduce the phosphorylation level of necroptosis-related proteins in DC during sepsis. Figure 1 .

[0061] Experiment 2: Flow cytometry was used to detect the expression of WT mice and Msr1 - / - The proportion of DC necroptosis in mouse spleen after in vitro stimulation and MSC-Exo treatment

[0062] Experimental methods: Flow cytometry and SYTOX-Green staining were used to detect the proportion of necroptosis in spleen DCs of WT mice and Msr1 mice after in vitro stimulation and MSC-Exo treatment (Annexin+7-AAD+ cells)

[0063] (1) Flow cytometry analysis of the proportion of necroptotic cells

[0064] S1, collect cells from each group and count them according to 2.5×10 5 The cells / tubes were placed in a flow tube, and 1 ml of PBS was added to each tube to allow the cells to be evenly distributed in the flow tube. The cells were then centrifuged at a speed of 1500 rpm for 5 min.

[0065] S2, discard the supernatant and resuspend the cell pellet with 1 mL of Binding Buffer, centrifuge again at 1500 rpm for 5 min, discard the supernatant and resuspend the cell pellet with 100 μL of Binding Buffer;

[0066] S3, add 5 μL Annexin V and 2.5 μL 7-AAD dye to each flow tube, tap the tube wall to evenly disperse the cells after adding the reagents, and incubate at room temperature in the dark for 15 min;

[0067] S4, set up double-negative tubes (without Annexin V and 7-AAD), single-stained tubes (only Annexin V was added), and single-stained tubes (only 7-AAD was added) as controls;

[0068] S5. After incubation, add 200 μL Binding Buffer to each tube, flick the tube wall to mix, and then detect and analyze necrosis and apoptosis cells (Annexin V + 7-AAD + ) ratio; FlowJo V 10.0 software was used to reanalyze the data of each group.

[0069] (2) Flow cytometry analysis of the proportion of peripheral blood immune cells

[0070] S1, isolated and counted mouse peripheral blood mononuclear cells, 3×10 5 Place the cells / tube in a flow tube, add 1 ml of PBS to each tube to allow the cells to be evenly distributed in the flow tube, and then centrifuge at a speed of 1500 rpm for 5 min, and discard the supernatant;

[0071] S2, discard the supernatant and resuspend the cell pellet with 1 mL PBS, centrifuge again, the speed of the centrifuge is 1500 rpm, the centrifugation time is 5 min, repeat 2 times, and resuspend the cell pellet with 200 μL PBS;

[0072] S3, add 1μL CD3 flow cytometry antibody and 1μL CD4 flow cytometry antibody to each flow cytometry tube, tap the tube wall to evenly disperse the cells after adding the reagents, and incubate at room temperature in the dark for 30 minutes;

[0073] S4, set up double negative tubes (no CD3 flow cytometry antibody and CD4 flow cytometry antibody), single staining tubes (only CD3 flow cytometry antibody) and single staining tubes (only CD4 flow cytometry antibody) as controls;

[0074] S5, after the incubation is completed, 1 mL of PBS is added to each tube for resuspending, followed by centrifugation at a speed of 1500 rpm for 5 min;

[0075] S6, prepare FOXP3 fixation / permeabilization buffer (1X) and FOXP3 permeabilization buffer (1X). FOXP3 fixation / permeabilization buffer (4X) and fixation / permeabilization diluent are mixed at a ratio of 1:3 to obtain FOXP3 fixation / permeabilization buffer (1X); FOXP3 permeabilization buffer (10X) and deionized water are mixed at a ratio of 1:9 to obtain FOXP3 permeabilization buffer (1X);

[0076] S7, discard the supernatant in the flow tube treated in step S5, then add 500 μL of FOXP3 fixation / permeabilization buffer (1X) to each flow tube and incubate at 4°C for 14 ± 2 h;

[0077] S8, after the membrane incubation is completed, wash the cells twice with FOXP3 membrane permeabilization buffer (1X), resuspend the cell pellet with 200 μL FOXP3 membrane permeabilization buffer (1X), blow evenly, add Foxp3 flow cytometry antibody at a rate of 1.5 μL / tube, and incubate at room temperature in the dark for 1 h;

[0078] S9, after incubation, resuspend the cells with 1 mL of FOXP3 permeabilization buffer (1X), and then centrifuge at 1500 rpm for 5 min. Discard the supernatant, then resuspend the cells with 300 μL of PBS and detect them on the machine. Use FlowJo V 10.0 software to analyze the proportions of CD3+T cells, CD3+CD4+T cells and Treg cells in the peripheral blood of mice in different groups.

[0079] (3) Analysis of the proportion of necrotic and apoptotic cells by SYTOX-Green staining

[0080] S1, prepare SYTOX-Green dead cell nucleic acid dye: dilute the SYTOX-Green dead cell nucleic acid dye stock solution with DMSO at a dilution ratio of 1:10000 to a final concentration of 50 nM;

[0081] S2, in vitro experimental part, 100 nM SYTOX-Green dye was added during the cell culture process, and the cell culture process was continued after addition;

[0082] S3, cells from each group were collected and counted, and the cells were counted as 2.0×10 6 The cells / tubes were collected in flow tubes and then placed in a centrifuge for centrifugation at 1500 rpm, room temperature, and 5 min. The cell pellets were then resuspended in 1 mL of PBS and centrifuged again. The centrifugation conditions were the same and repeated 3 times.

[0083] S4, after washing the cells in the flow tube, discard the supernatant completely, resuspend the cell pellet with 60-70 μL PBS, and repeatedly blow and beat with a pipette to obtain a cell suspension;

[0084] S5, take 35 μL of cell suspension and drop it on a glass slide, cover it with a cover slip, spread it flat in a wet box, and send it for examination and filming;

[0085] S6, SYTOX-Green positive cells were observed and photographed using a fluorescence microscope, and Image J software was used to count and analyze the ratio of positive cells to the total number of cells in the field of view.

[0086] Experimental results: Compared with the control group, WT mice and Msr1 - / - The proportion of necroptosis in splenic DC of mice increased significantly after in vitro stimulation (flow cytometry / SYTOX-Green staining: WT, P < 0.0001; Msr1- / -, P < 0.0001). MSC-Exo treatment could significantly reduce the proportion of necroptosis in splenic DC of WT mice (flow cytometry / SYTOX-Green staining: P < 0.0001), while Msr1 - / - Only the SYTOX-Green staining results in mouse spleen DC showed statistical differences (P < 0.05). - / - The proportion of necroptosis of DC in the spleen of mice was significantly lower than that in the WT mice stimulation group (flow cytometry: P < 0.0001; SYTOX-Green staining: P < 0.01).

[0087] The results showed that MSR1 gene knockout could significantly reduce the proportion of DC necroptosis during sepsis. Figure 2 .

[0088] Experiment 3: Laser confocal microscopy observation of the effect of MSR1 gene knockout on p-MLKL fluorescence intensity, p-RIPK3 fluorescence intensity and positive cell ratio in DC under sepsis conditions

[0089] Laser confocal microscopy imaging technology

[0090] S1, cells from each group were collected and counted, and the cells were counted at 2.0×10 6 Cells / tubes were collected in flow tubes;

[0091] S2, place the flow tube in a centrifuge for centrifugation at a speed of 1500 rpm, at room temperature, for 5 min, discard the supernatant completely, add 1 mL of PBS to resuspend the cell pellet, and centrifuge again. Repeat 3 times to wash the cells;

[0092] S3, use 30 μL Trixon and 9970 μL deionized water to prepare a 0.3% Trixon solution for cell membrane disruption, and vortex to mix;

[0093] S4, weigh 0.1 g of BSA and dissolve it in 10 mL of deionized water to obtain a 1% BSA solution;

[0094] S5, add 500 μL of 0.3% Trixon solution to each flow tube treated in step S2, tap the tube wall to mix the cells, and let stand at room temperature in the dark for 10 min;

[0095] S6, after the cell membrane is broken, the flow tube is placed in a centrifuge for centrifugation at a speed of 1500 rpm, at room temperature, for 5 min. Then, the cell pellet is resuspended in 1 mL PBS and centrifuged again. Repeat this 3 times for cell washing.

[0096] S7, add 200 μL of primary antibody solution to 1% BSA solution to obtain a mixed primary antibody solution;

[0097] S8, add 200 μL of mixed primary antibody solution to the flow tube treated in step S6, tap the tube wall to mix the cells, seal with sealing film, and incubate in a 4°C refrigerator overnight;

[0098] S9, after the primary antibody incubation is completed, remove the sealing film, put the flow tube into the centrifuge for centrifugation, the speed of the centrifuge is 1500rpm, the centrifugation temperature is room temperature, the centrifugation time is 5min, use 1mL PBS to resuspend the cell pellet and centrifuge again, repeat 3 times to wash the cells;

[0099] S10, adding 200 μL of secondary antibody solution to 1% BSA solution to obtain a diluted mixed secondary antibody solution;

[0100] S11, add 200 μL of mixed secondary antibody solution to the flow tube treated in step S9, tap the tube wall to mix the cells, seal it with sealing film, and stand it at room temperature away from light for 1 hour;

[0101] S12, after the secondary antibody incubation is completed, remove the sealing film, put the flow tube into the centrifuge for centrifugation, the speed of the centrifuge is 1500rpm, the centrifugation temperature is room temperature, the centrifugation time is 5min, use 1mL PBS to resuspend the cell pellet and centrifuge again, repeat 3 times to wash the cells, pay attention to avoid light during this process, and prepare the slide and cover slip at the same time;

[0102] S13, after washing the cells in the flow tube, discard the supernatant completely, use 60-70μL PBS to resuspend the cell pellet, repeatedly blow and mix evenly with a pipette, take 35μL of the cell suspension and drop it on the slide, then add 5μLDA I solution to the cell droplet, carefully cover with a coverslip, spread it flat in a wet box, and send it for inspection and filming.

[0103] The experimental results are as follows Figure 3 and Figure 4As shown: Compared with the control group, the fluorescence intensity and proportion of positive cells of p-MLKL and p-RIPK3 in splenic DC of WT mice increased significantly after in vitro stimulation, and this phenomenon was significantly improved after MSC-Exo treatment. - / - After in vitro stimulation of mouse spleen DC, the fluorescence intensity of intracellular p-MLKL and p-RIPK3 did not show a significant increase, and the proportion of positive cells did not show a significant increase, which was significantly lower than that of the WT mouse stimulation group.

[0104] The results showed that MSR1 gene knockout could significantly reduce the fluorescence intensity and proportion of positive cells of p-MLKL and p-RIPK3 in DCs during sepsis.

[0105] Experiment 4: Effect of MSR1 gene knockout on the levels of necroptosis-related cytokines in DC culture supernatant under sepsis conditions

[0106] Experimental method: ELISA was used to detect the expression of WT mice and Msr1 - / - Levels of necroptosis-related cytokines in the cell culture supernatants of different groups after mouse splenic DCs were stimulated in vitro and treated with MSC-Exo.

[0107] ELISA test steps

[0108] S1, sample processing method: in the in vitro experiment part, after LPS+z-VAD combined stimulation, the culture medium was collected, and then the culture medium was placed in a centrifuge for centrifugation at room temperature, with a centrifugal speed of 1500 rpm and a centrifugal time of 5 min, and then the supernatant was retained;

[0109] S2, cytokine levels in cell culture supernatant were detected by ELISA kit;

[0110] S3, take out the pre-coated and sealed 96-well plate, equilibrate to room temperature, add the standard and specimen universal diluent to the blank wells, add 100 μL of the diluted cell culture supernatant of each group to the remaining wells, seal the reaction wells with sealing tape, place in a 37°C constant temperature box, and incubate in the dark for 90 minutes;

[0111] S4, after the incubation is completed, the reaction solution in the ELISA plate is aspirated, and the biotinylated antibody working solution is prepared 20 minutes in advance. 100 μL of the biotinylated antibody diluted at 1:100 is added to the reaction well, and the reaction well is sealed with sealing tape, and the plate is placed in a 37°C incubator and incubated for 60 minutes in the dark;

[0112] S5, wash the plate with washing buffer, soak for 1 min each time, repeat 5 times;

[0113] S6, after washing, add 100 μL of diluted peroxidase-labeled avidin into the reaction wells at a dilution ratio of 1:100, then seal the reaction wells with sealing tape and place in a 37°C incubator incubated in the dark for 30 min;

[0114] S7, wash the plate with washing buffer, soak for 90 seconds each time, repeat 5 times;

[0115] S8, add 90 μL of chromogenic substrate to the reaction well, place in a 37°C incubator, and incubate for 20 min in the dark;

[0116] S9. After the incubation is completed, add 100 μL of reaction stop solution to the reaction well and mix gently. According to the microplate reader operation method, detect the OD value of each well at a wavelength of 450 nm within 3 minutes after adding the reaction stop solution, and calculate the concentration of the measured cytokine.

[0117] The experimental results are as follows Figure 5 As shown: Compared with the control group, the levels of HMGB1, IL-1α, IL-33, LDH and TNF-α released by WT mouse spleen DC after in vitro stimulation were significantly upregulated (HMGB1: P < 0.001; IL-1α: P < 0.0001; IL-33: P < 0.001; TNF-α: P < 0.0001; LDH: P < 0.0001), and the levels of these cytokines were significantly decreased after MSC-Exo treatment (HMGB1: P < 0.0001; IL-1α: P < 0.05; IL-33: P < 0.05; TNF-α: P < 0.0001; LDH: P < 0.05). - / - The levels of IL-1α (P<0.01) and TNF-α (P<0.0001) in mouse spleen DC were significantly upregulated after in vitro stimulation, but the cytokine levels in the stimulated groups were significantly lower than those in the WT mouse stimulated groups (HMGB1: P<0.001; IL-1α: P<0.01; IL-33: P<0.01; TNF-α: P<0.001; LDH: P<0.001).

[0118] The results showed that MSR1 gene knockout could effectively reduce the levels of DAMPs and cytokines released by DC necroptosis during sepsis.

[0119] Experiment 5: Conditional knockout of the MSR1 gene can significantly reduce the phosphorylation level of necroptosis-related proteins in DCs during sepsis

[0120] Experimental method: Detection of Cd11c by Western Blot cre Msr1 fl / fl Mice and Msr1 fl / fl Mouse (Cd11ccre Msr1 fl / fl Phosphorylation levels of DC necroptosis-related proteins in mice (control mice) after CLP modeling and MSC-Exo treatment.

[0121] The Western Blot detection steps are the same as those in Experiment 1.

[0122] The experimental results are as follows Figure 6 Compared with the sham operation group, Msr1 fl / fl The ratios of p-RIPK1 / RIPK1 (P<0.05), p-RIPK3 / RIPK3 (P<0.01) and p-MLKL / MLKL (P<0.01) in mouse splenic DCs were significantly increased after CLP modeling, while MSC-Exo treatment could significantly reduce the phosphorylation levels of RIPK1 (P<0.05), RIPK3 (P<0.05) and MLKL (P<0.01). cre Msr1 fl / fl There was no significant difference in the phosphorylation levels of related proteins among the sham operation group, sepsis group and treatment group. cre Msr1 fl / fl The levels of p-RIPK1 (P<0.05), p-RIPK3 (P<0.05) and p-MLKL (P<0.01) in DCs of mouse spleen were significantly lower than those in Msr1 fl / fl Mouse.

[0123] The results showed that conditional knockout of the MSR1 gene could significantly reduce the phosphorylation level of necroptosis-related proteins in DCs during sepsis.

[0124] Experiment 6: Conditional knockout of the MSR1 gene can significantly reduce the proportion of DC necroptosis in septic mice Experimental method: Detect Msr1 by flow cytometry fl / fl Mouse and Cd11c cre Msr1 fl / fl The proportion of necroptosis of splenic DCs in mice after CLP modeling and MSC-Exo treatment (Annexin+7-AAD+ cells).

[0125] The experimental steps of flow cytometry in this experiment were the same as those in the flow cytometry analysis of the proportion of necroptotic cells in Experiment 2.

[0126] The experimental results are as follows Figure 7 Compared with the sham operation group, Msr1 fl / fl Mouse and Cd11c cre Msr1 fl / flThe proportion of necroptosis in spleen DC of mice after CLP modeling was significantly increased (Msr1 fl / fl :P<0.0001;Cd11c cre Msr1 fl / fl :P<0.001), MSC-Exo treatment could significantly reduce Msr1 fl / fl The proportion of DC necroptosis in the spleen of mice was (P<0.0001), while in Cd11c cre Msr1 fl / fl There was no statistical difference between the treatment group and the sepsis group in mice. cre Msr1 fl / fl The proportion of DC necroptosis in the spleen of mice was significantly lower than that in the sepsis group Msr1 fl / fl The difference was statistically significant in mice (P<0.0001).

[0127] The results showed that conditional knockout of the MSR1 gene could significantly reduce the proportion of DC undergoing necroptosis in septic mice.

[0128] Experiment 7: Conditional knockout of the MSR1 gene can significantly reduce the fluorescence intensity and proportion of positive cells of p-MLKL and p-RIPK3 in splenic DCs during sepsis

[0129] Experimental method: Observation of Msr1 by laser confocal microscopy fl / fl Mouse and Cd11c cre Msr1 fl / fl Fluorescence intensity and proportion of positive cells of p-MLKL and p-RIPK3 in splenic DCs of mice after CLP modeling and MSC-Exo treatment.

[0130] The laser confocal microscopy observation steps are the same as those of the laser confocal microscopy imaging technique in Experiment 3.

[0131] The experimental results are as follows Figure 7 and Figure 8 Compared with the sham operation group, Msr1 fl / fl The fluorescence intensity and proportion of p-MLKL and p-RIPK3 positive cells in mouse spleen DC increased significantly after CLP modeling, and this phenomenon was significantly improved after MSC-Exo treatment. cre Msr1 fl / fl The fluorescence intensity of p-MLKL and p-RIPK3 in splenic DC of mice after CLP modeling was slightly upregulated, and the proportion of positive cells increased slightly, but was still significantly lower than that of Msr1 in the sepsis group. fl / fl In addition, Cd11c cre Msr1 fl / flNo significant differences were observed in the fluorescence intensity and positive cell ratio of p-MLKL and p-RIPK3 in splenic DCs between the mouse treatment group and the sepsis group.

[0132] The results showed that conditional knockout of the MSR1 gene could significantly reduce the fluorescence intensity and proportion of positive cells of p-MLKL and p-RIPK3 in splenic DCs during sepsis.

[0133] Experiment 8: Conditional knockout of the MSR1 gene can effectively reduce the levels of necroptosis-related DAMPs and cytokines in the serum of septic mice

[0134] Experimental method: Detection of Msr1 by ELISA fl / fl Mouse and Cd11c cre Msr1 fl / fl The levels of necroptosis-related cytokines in the serum of different groups of mouse spleen DC after CLP modeling and MSC-Exo treatment were determined by ELISA, and the detection steps were the same as those in Experiment 4.

[0135] The experimental results are as follows Fig.10 Compared with the sham operation group, Msr1 fl / fl The levels of HMGB1, IL-1α, IL-33, LDH and TNF-α in the serum of mice were significantly upregulated after CLP modeling (HMGB1: P < 0.0001; IL-1α: P < 0.0001; IL-33: P < 0.01; TNF-α: P < 0.0001; LDH: P < 0.0001). The levels of serum cytokines in Msr1f l / fl mice were significantly decreased after MSC-Exo treatment (HMGB1: P < 0.05; IL-1α: P < 0.01; IL-33: P < 0.05; TNF-α: P < 0.001; LDH: P < 0.01). cre Msr1 fl / fl After CLP modeling, the levels of IL-1α (P < 0.01) and LDH (P < 0.05) in mice were significantly different from those in the sham operation group, but there was no significant difference between the treatment group and the sepsis group. cre Msr1 fl / fl The levels of IL-1α and LDH in mice were increased, but still significantly lower than those in the sepsis group. fl / fl The levels of HMGB1 in mice were significantly different from those in controls (HMGB1: P < 0.05; IL-1α: P < 0.01; IL-33: P < 0.05; TNF-α: P < 0.01; LDH: P < 0.05).

[0136] The results showed that conditional knockout of the MSR1 gene could effectively reduce the levels of necroptosis-related DAMPs and cytokines in the serum of septic mice.

[0137] The above experiments were statistically plotted and analyzed using Graphpad Prism 9.0 software. The quantitative data were expressed as mean ± standard deviation (x ± s). When the data of each group conformed to normal distribution and variance was equal, ANOVA was used for multiple group analysis, and Tukey post hoc test was used for pairwise comparison. P < 0.05 was considered to be significantly different, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The experimental results were repeated more than three times.

[0138] The embodiments described above are only preferred implementation modes of the present invention and cannot be used to limit the protection scope of the present invention. Any non-substantial changes and modifications made by those skilled in the art on the basis of the invention shall fall within the protection scope of the present invention.

Claims

1. Use of a preparation for inhibiting or knocking out the expression of the MSR1 gene in the preparation of a preparation for preventing or treating DC necroptosis in sepsis.

2. The use according to claim 1, characterized in that: The preparation is gRNA-B1 or gRNA-B2 that inhibits the expression of the MSR1 gene; the sequence of the gRNA-B1 is: GGCCTTTGCACGTGAAGAGG-AGG; the sequence of the gRNA-B2 is: ACTTGGGGAAATAAGGTAC-AGG.

3. The use according to claim 1, characterized in that: Preparations that inhibit or knock out the expression of the MSR1 gene can inhibit the decrease in the phosphorylation levels of necroptosis proteins RIPK1, RIPK3, and MLKL in septic mouse DCs.

4. The use according to claim 1, characterized in that: The preparations that inhibit or knock out the expression of the MSR1 gene can inhibit the reduction of the levels of cytokines in necroptosis of DCs in mice with sepsis, and the markers of the cytokines are HMGB1, IL-1α, IL-33, LDH and TNF-α.

Images