Exosome miRNA combined biomarker for predicting curative effect of triple negative breast cancer neoadjuvant chemotherapy and application of exosome miRNA combined biomarker

Abstract

The invention provides an exosome miRNA (micro Ribonucleic Acid) combined biomarker for predicting the curative effect of neoadjuvant chemotherapy of triple negative breast cancer. The exosome miRNA combined biomarker comprises miR-100, miR-105 and miR-224. The invention also provides a liposome silicon nano multichannel probe for predicting the curative effect of the neoadjuvant chemotherapy of the triple negative breast cancer, and the probe is provided with a fluorescently labeled oligonucleotide sequence for tracking and positioning the exosome miRNA combined biomarker. When the combined serum exosome biomarker is applied to neoadjuvant chemotherapy drug resistance detection of a real clinical triple-negative breast cancer sample, the effect is real and reliable and is obviously superior to that of a single target or even two targets, rapid and in-situ detection of the miRNA combined biomarker can be achieved by adopting the probe, and the detection sensitivity is high. The diagnostic value of the liquid biopsy applied to anticipating the curative effect of the breast cancer neoadjuvant chemotherapy can be improved, and the prognosis of a breast cancer patient can be improved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical analysis and detection technology, and in particular to an exosome miRNA combination biomarker, a liposome silicon nano multi-channel probe and applications thereof for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer. Background Art

[0002] Triple-negative breast cancer (TNBC) lacks effective targeted therapy due to the lack of hormone receptors and HER2 expression, so chemotherapy is crucial for TNBC. Neoadjuvant chemotherapy (NAC) refers to systemic chemotherapy before the implementation of local treatment methods (such as surgery or radiotherapy), which aims to shrink the tumor and kill invisible metastatic cells as early as possible, so as to facilitate subsequent surgery, radiotherapy and other treatments and improve the treatment effect. Neoadjuvant chemotherapy has become the standard treatment for TNBC, which can make inoperable breast cancer operable and non-breast-conserving surgery breast-conserving. TNBC patients achieve complete pathological response (pCR) after neoadjuvant chemotherapy, which can significantly improve survival, but not all TNBC patients have a good response to neoadjuvant chemotherapy, and some patients even progress during neoadjuvant chemotherapy. Therefore, early identification of effective or resistant individuals is an urgent problem to be solved in the clinic, which is of great significance for the accurate diagnosis and treatment of breast cancer patients.

[0003] Currently, the most widely used method for monitoring the efficacy of NAC is imaging examination, which has the advantage of being able to evaluate changes in cancer lesions before and after NAC. However, this examination method is not only difficult to analyze molecular biological information at the tissue and cell levels, but more importantly, due to the lack of accurate information on cell and tissue pathology, imaging has a lag in monitoring postoperative tumor recurrence and early drug resistance in clinical scenarios. As a supplement to imaging examinations, puncture pathological biopsy is also difficult to implement intensively during the continuous neoadjuvant treatment time before surgery. Blood biopsy is a less invasive method than tissue biopsy, so it allows continuous collection during NAC, which helps to provide detailed and reliable diagnostic and treatment information in a timely manner. However, there is currently a lack of standardized, sensitive and specific NAC blood biopsy predictive diagnostic biomarkers, which poses a challenge to monitoring the efficacy of NAC for breast cancer, especially in the early monitoring of chemotherapy drug resistance.

[0004] Previous studies have confirmed that exosomal miRNAs may affect chemotherapy resistance through multiple pathways, such as mediating intercellular signaling, increasing drug efflux, and reshaping the tumor microenvironment. For example, exosomal miR-21 can affect the growth of hepatocellular carcinoma (HCC) cells by regulating the expression of tumor suppressor genes phosphatase and tensin homolog deleted on chromosome ten (PTEN) and PTEN pseudogene 1 (PTENp1). Exosomal miR-501-3p derived from macrophages can promote the progression of pancreatic ductal adenocarcinoma through the TGF-β signaling pathway mediated by TGF-β receptor III (TGFBR3).

[0005] However, the progression of NAC resistance involves more than just a single gene functional network. A combination of biomarkers or a biomarker panel can more objectively reflect the state of a complex disease. However, there is currently a lack of combined biomarkers that can screen out TNBC patients in a NAC-resistant state through blood biopsy. Summary of the invention

[0006] The purpose of the present invention is to address the deficiencies of the prior art and provide an exosomal miRNA combination biomarker for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer. For the first time, three targeted exosomal miRNAs that are positively correlated with neoadjuvant chemotherapy resistance in triple-negative breast cancer were screened out, and a liposome silicon nano multi-channel probe that can predict the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer was innovatively developed. The probe evaluates the efficacy of NAC by simultaneously detecting and imaging three independent miRNAs in exosomes.

[0007] According to the first aspect of the present invention, there is provided an exosomal miRNA combination biomarker for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer, characterized in that the exosomal miRNA combination biomarker comprises: miR-100, miR-105 and miR-224.

[0008] According to a second aspect of the present invention, a liposome silicon nano multichannel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer is provided, wherein the probe is configured with a fluorescently labeled oligonucleotide sequence for tracking and locating the aforementioned exosomal miRNA combination biomarker.

[0009] As an optional embodiment, the probe includes silica nanoparticles, the surface of which is doped with three quenchers to form qSiNPs; the qSiNPs are loaded with three oligonucleotide sequences labeled with fluorescence at different wavelengths to form qSiNPs@AntRNAs, and the surface of qSiNPs@AntRNAs is coated with DOTAP cationic liposomes (Liposome) to form liposome silicon nano multi-channel probe Lipo@qSiNPs@AntRNAs;

[0010] Among them, the oligonucleotide sequences labeled with three different wavelength fluorescences are Ant-100, Ant-105 and Ant-224, and the three quenchers correspond to three different wavelength fluorescences, so that the fluorescence on the oligonucleotide sequences is quenched by the corresponding quenchers.

[0011] As an optional embodiment, the three quenchers are BHQ1-NHS, BHQ2-NHS and BHQ3-NHS respectively.

[0012] As an optional embodiment, the DOTAP cationic liposome is assembled from DOTAP, cholesterol, DOPE and DSPE-PEG2000.

[0013] According to a third aspect of the present invention, a method for detecting the aforementioned exosomal miRNA combination biomarker is provided, comprising the following steps:

[0014] Extracting exosomes from the sample to be tested;

[0015] The aforementioned liposome silicon nano multichannel probe is incubated with the extracted exosomes at a desired temperature to fuse the liposome silicon nano multichannel probe with the exosomes to form a probe-exosome fusion vesicle, and the fluorescence intensity in the probe-exosome fusion vesicle is detected to achieve in situ detection of exosomal miRNA combination biomarkers;

[0016] Among them, the liposome silicon nano multi-channel probe can quickly release qSiNPs@AntRNAs nanoparticles after fusion with the exosomes. After the oligonucleotide chain is complementary to the target miRNAs in the exosomes, the fluorescent group at the 5' end of the oligonucleotide chain can be separated from the corresponding quencher and emit fluorescence to indicate the position of the target miRNAs, thereby realizing the fluorescence tracking and positioning of multiple targets in the exosomes.

[0017] According to a fourth aspect of the present invention, there is provided a method for preparing the aforementioned liposome silicon nano multichannel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer, comprising the following steps:

[0018] S1. Utilization The silica nanoparticles doped with three quenchers were synthesized by the method to obtain qSiNPs, and the qSiNPs were incubated with three different fluorescently labeled oligonucleotide sequences 6FAM_miR-224, TMR_miR-105 and Cy5_miR-100 at the desired temperature. After the incubation, the mixture was centrifuged and the supernatant was discarded to collect the intermediate product qSiNPs@AntRNAs.

[0019] S2. After premixing qSiNPs@AntRNAs and Liposome, they were vortexed quickly and then incubated. After the incubation, the system was centrifuged to remove excess liposome components to obtain the liposome silicon nano-multichannel probe Lipo@qSiNPs@AntRNAs.

[0020] As an optional embodiment, the use The process of synthesizing silica nanoparticles doped with three quenchers on the surface is as follows:

[0021] The mixed solution of BHQ1-NHS, BHQ2-NHS and BHQ3-NHS was incubated with APTES and 2% DIPEA at 37° C. overnight to obtain a first solution;

[0022] Under continuous stirring, n-hexanol and Triton-X are added to cyclohexane to obtain a second solution, and then TEOS and deionized water are mixed until turbid, added to the second solution, and mixed evenly to form a third solution, and the first solution is added dropwise to the third solution, and after mixing evenly, 25% ammonia solution is added, and finally stirred at room temperature overnight to obtain a fourth solution;

[0023] Acetone was added to the fourth solution to react, and centrifugation was performed after the reaction was completed. The precipitate obtained after the centrifugation was repeatedly washed alternately with ethanol and water to obtain qSiNPs.

[0024] As an optional embodiment, the mass concentration ratio of Ant-100, Ant-105 and Ant-224 is 1:1:1.

[0025] As an optional embodiment, the DOTAP cationic liposomes are assembled from DOTAP, cholesterol, DOPE and DSPE-PEG2000, wherein the molar concentration ratio of DOTAP, cholesterol, DOPE and DSPE-PEG2000 is 65:30:3.75:1.25.

[0026] It can be seen from the above technical solutions of the present invention that the exosome miRNA combination biomarker proposed in the present invention is a new group of miRNA combination biomarkers. When the combined serum exosome biomarker is applied to the detection of neoadjuvant chemotherapy resistance in real clinical triple-negative breast cancer samples, its effect is real and reliable, which is significantly better than a single target or even two targets. In addition, since the target is derived from high-throughput sequencing of clinical patient serum samples, it ensures both sensitivity and specificity of detection and has clinical transformation value.

[0027] The liposome silicon nano multi-channel probe proposed in the present invention encapsulates the silicon-based surface through a cationic liposome biomembrane, and can deliver the silica nanoplatform into the exosomes of the patient's serum sample by means of membrane fusion without destroying the exosomes. This in situ detection method that does not use chemical or biological extraction avoids the degradation and contamination of extracellular vesicles. In addition, since the silica nanosurface is equipped with a fluorescent probe that can simultaneously detect three types of miRNAs in exosomes, rapid and in situ detection of multiple targets can be achieved, which helps to improve the diagnostic value of liquid biopsy in predicting the efficacy of neoadjuvant chemotherapy for breast cancer and improve the prognosis of breast cancer patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a synthetic schematic diagram of the liposome silicon nano multi-channel probe of the present invention.

[0029] Figure 2 It is the target screening of serum exosome miRNAs in patients with TNBC neoadjuvant chemotherapy in the example of the present invention; wherein, Figure 2 A is a diagram of the high-throughput sequencing scheme of serum exosome miRNA in 6 patients with TNBC undergoing neoadjuvant chemotherapy; Figure 2 B and 2C are the heat maps and volcano plots of the nine upregulated miRNAs among the differentially expressed genes in sequencing; Figure 2 D is the qRT-PCR graph of miRNAs analysis in exosomes extracted from the supernatant of breast cancer cells MDA-MB-231 and MDA-MB-231 / Taxol.

[0030] Figure 3 is the in vitro study result of the liposome silicon nano multi-channel probe in the example of the present invention; wherein, Figure 3 A is the particle size distribution diagram of qSiNPs, Liposome and Lipo@qSiNPs@AntRNAs; Figure 3 B is the transmission electron microscopy images of qSiNPs, Liposome and Lipo@qSiNPs@AntRNAs; Figure 3 C is the Zeta potential analysis diagram of qSiNPs, Liposome, qSiNPs@AntRNAs and Lipo@qSiNPs@AntRNAs; Figure 3 D-3I is the fluorescence analysis of the optimized incubation concentration of qSiNPs@AntRNAs and free miRNAs, (3D-3E) 6FAM_miR-224 channel: emission 518 nm, (3F-3G) TMR_miR-105 channel: emission 580 nm, (3H-3I) Cy5_miR-100 channel: emission 668 nm; Figure 3 J-3L is to verify the selectivity analysis of qSiNPs@AntRNA for miRNAs.

[0031] Figure 4 is the in vivo study result of the liposome silicon nano multi-channel probe in the example of the present invention; wherein, Figure 4 A is a schematic diagram of the fusion of biological probe and exosome vesicles; Figure 4 B is a transmission electron microscopy image of exosomes and fusion vesicles; Figure 4 C is a diagram of setting up 4 groups of experiments to verify the in situ detection function of the biological probe on exosomes. The four experimental groups (from left to right) are: Group 1: Lipo@qSiNPs@AntRNAs; Group 2: qSiNPs@AntRNAs+EVs; Group 3: Lipo@qSiNPs@AntRNAs+miRNAs; Group 4: Lipo@qSiNPs@AntRNAs+EVs. Scale bar: 5 μm. Figure 4 D-4E is a flow cytometry bioprobe for detecting exosomes derived from MDA-MB-231 and MDA-MB-231 / Taxol; Figure 4 F-4H is a fluorescence microplate reader that detects fluorescence intensity to analyze the biological probe for MDA-MB-231 and MDA-MB-231 / Taxol-derived exosomes; Figure 4 I is the confocal image analysis of biological probes to detect exosomes from MDA-MB-231 and MDA-MB-231 / Taxol.

[0032] Figure 5 In the example of the present invention, the liposome silicon nano multi-channel probe is used to detect serum exosomes of TNBC patients to predict the efficacy of neoadjuvant chemotherapy; wherein, Figure 5 A is the fluorescence signal after the flow cytometry bioprobe was incubated with serum exosomes from 6 TNBC patients, and the age difference between the paired patients was ≤5 years; Figure 5 B is a 3D scatter plot showing the therapeutic response of TNBC patients to neoadjuvant chemotherapy, where each dot represents the expression levels of miR-224, miR-105, and miR-100 in the serum exosomes of a TNBC patient; Figure 5 C is a forest plot depicting the ability of the three miRNAs to distinguish the efficacy of neoadjuvant chemotherapy; Figure 5D-5F is the ROC curve showing the diagnostic performance of different classifiers based on single indicator (D), dual indicator (E) and triple indicator (F) for neoadjuvant chemotherapy resistance in TNBC patients. DETAILED DESCRIPTION

[0033] In order to better understand the technical content of the present invention, specific embodiments are given and described as follows in conjunction with the accompanying drawings.

[0034] Various aspects of the present invention are described in this disclosure with reference to the accompanying drawings, in which many illustrative embodiments are shown. The embodiments of the present disclosure are not necessarily intended to include all aspects of the present invention. It should be understood that the various concepts and embodiments introduced above, as well as those described in more detail below, can be implemented in any of many ways.

[0035] The precise detection and accurate analysis of exosomal miRNA has become a key issue to further promote the clinical transformation of liquid biopsy technology.

[0036] Conventional detection methods for exosomal miRNA usually have limitations such as the integrity of exosomes is destroyed and thus in situ detection cannot be achieved, and only a single target can be detected at a time. The gold standard for RNA detection, quantitative reverse transcription polymerase chain reaction (qRT-PCR), has serious limitations in clinical applications. This technology requires a high sample volume, a long time, and a large amount of equipment support, so it is time-consuming, labor-intensive, and costly.

[0037] In addition, during the process of obtaining exosomes, "noise RNA" may be generated in the complex environment of the human body, which will have a great impact on the analysis of the results; at the same time, although some existing commercial exosome extraction and detection kits have achieved a certain degree of miniaturization and real-time detection of exosome miRNA based on fluorescence response, these detection methods can only detect single targets, and the accuracy of the results of single biomarker detection is quite limited. In addition, few research schemes have achieved in situ detection in the serum system, and most technical solutions still require the expected enrichment and extraction of exosomes. These deficiencies limit the scope of its clinical application.

[0038] Based on this, the present invention constructs a new group of miRNA combination biomarkers to increase the sensitivity and accuracy of detecting the efficacy of neoadjuvant chemotherapy for breast cancer, and designs a new liposome silicon nanoprobe on this basis, which quickly enters exosomes through membrane fusion pathway to realize in situ detection of related biological targets in exosomes. By detecting exosome miRNAs related to neoadjuvant chemotherapy resistance, it is used to identify the drug resistance state of chemotherapy patients, predict, dynamically monitor and later evaluate the drug efficacy in the early, middle and late stages of neoadjuvant chemotherapy, evaluate the efficacy of neoadjuvant chemotherapy before imaging results, and realize real-time, dynamic, non-invasive and rapid monitoring of patients undergoing neoadjuvant chemotherapy for breast cancer.

[0039] Exosomal miRNA combination biomarkers

[0040] In an exemplary embodiment of the present invention, an exosomal miRNA combination biomarker for predicting the efficacy of neoadjuvant chemotherapy for breast cancer is provided, and the exosomal miRNA combination biomarker includes: miR-100, miR-105 and miR-224.

[0041] Among them, the sequence of miR-100 is AACCCGUAGAUCCGAACUUGUG;

[0042] The sequence of miR-105 is UCAAAUGCUCAGACUCCUGUGGU;

[0043] The sequence of miR-224 is UCAAGUCACUAGUGGUUCCGUUUAG.

[0044] Liposome-based silicon nanoparticle multichannel probe

[0045] In a preferred example of the present invention, based on the aforementioned exosomal miRNA combination biomarker, a liposome silicon nano multichannel probe for predicting the efficacy of neoadjuvant chemotherapy for breast cancer is provided, wherein the probe is configured with a fluorescently labeled oligonucleotide sequence for tracking and locating the aforementioned exosomal miRNA combination biomarker.

[0046] Combination Figure 1 As shown, the exemplary liposomal silicon nano multichannel probe of the present invention includes silica nanoparticles, the surface of which is doped with three quenchers to constitute qSiNPs; the qSiNPs are loaded with three oligonucleotide sequences labeled with fluorescence at different wavelengths to constitute qSiNPs@AntRNAs, and the surface of qSiNPs@AntRNAs is coated with DOTAP cationic liposomes (Liposome) to constitute the liposomal silicon nano multichannel probe Lipo@qSiNPs@AntRNAs.

[0047] Among them, the three oligonucleotide sequences labeled with fluorescence at three different wavelengths are Ant-100, Ant-105 and Ant-224, and the three quenchers correspond to three different wavelengths of fluorescence, so that the fluorescence on the oligonucleotide sequence is quenched by the corresponding quencher, so that when there is no target miRNA in the environment during detection, no fluorescence signal is generated.

[0048] Among them, the sequence of Ant-100 is 5`Cy5-CACAAGTTCGGATCTACGGGTT;

[0049] The sequence of Ant-105 is 5`TMR-ACCACAGGAGTCTGAGCATTTGA;

[0050] The sequence of Ant-224 is 5`6FAM-CTAAACGGAACCACTAGTGACTTGA.

[0051] It can be understood that Ant-100 is a labeling of Cy5 fluorescent dye on the oligonucleotide sequence complementary to miR-100, Ant-105 is a labeling of TMR fluorescent dye on the oligonucleotide sequence complementary to miR-105, and Ant-224 is a labeling of 6FAM fluorescent dye on the oligonucleotide sequence complementary to miR-224.

[0052] As an optional example, the three quenchers are BHQ1-NHS, BHQ2-NHS and BHQ3-NHS.

[0053] As an alternative example, DOTAP cationic liposomes are assembled from DOTAP, cholesterol, DOPE and DSPE-PEG2000.

[0054] As an optional example, the particle size of qSiNPs is 50nm-55nm, and the particle size of Lipo@qSiNPs@AntRNAs is 120nm-130nm.

[0055] As an optional example, the Zeta potential of qSiNPs is 6 mV to 8 mV, the Zeta potential of qSiNPs@AntRNAs is -14 mV to -16 mV, the Zeta potential of Liposome is 11 mV to 13 mV, and the Zeta potential of Lipo@qSiNPs@AntRNAs is 0.2 mV to 0.4 mV.

[0056] Method for detecting the aforementioned exosomal miRNA combination biomarker

[0057] In another exemplary embodiment of the present invention, a method for detecting the aforementioned exosomal miRNA combination biomarker is provided, comprising the following steps:

[0058] Extracting exosomes from the sample to be tested;

[0059] The aforementioned liposome silicon nano multichannel probe is incubated with the extracted exosomes at a desired temperature, and the DOTAP cationic liposome membrane wraps the nanosilicon spheres, which increases the affinity with the biomembrane when incubated with the negatively charged exosomes, thereby improving the biocompatibility of the liposome silicon nano multichannel probe. Without destroying the exosome biomembrane, the liposome silicon nano multichannel probe fuses with the exosomes to form a probe-exosome fusion vesicle;

[0060] After the liposome silicon nano multi-channel probe is fused with the exosome, it can quickly release the qSiNPs@AntRNAs nanoparticles. After the oligonucleotide chain is complementary to the target miRNAs in the exosome, it can separate the fluorescent group at the 5' end of the oligonucleotide chain from the corresponding quencher. Based on the FRET fluorescence resonance energy transfer principle, it leads to fluorescence emission, indicating the location of the target miRNAs, thereby realizing the fluorescence tracking and positioning of multiple targets in the exosome. In addition, the liposome silicon nano multi-channel probe responds to the three exosome miRNAs targets, showing three different long-wavelength emissions that can be distinguished by the spectrum, which can avoid mutual interference between fluorescence and realize multiple detection and three-color imaging of exosome miRNAs.

[0061] In this way, in situ detection of exosomal miRNA combination biomarkers is achieved by detecting the fluorescence intensity in the probe-exosome fusion vesicles.

[0062] As an optional example, the optimal incubation concentration ratio of the liposome silicon nanomultichannel probe to the exosomes is 1:8, the optimal incubation temperature is 37° C., and the time is 2 h.

[0063] Preparation method of liposome silicon nano multi-channel probe

[0064] The present invention prepares qSiNPs-based probe Lipo@qSiNPs@AntRNAs by doping black hole quenchers (BHQs 1 / 2 / 3) in a simple one-step method; oligonucleotide sequences Ant-224, Ant-105 and Ant-100 respectively labeled with three colors of fluorescence are loaded on the surface of qSiNPs through electrostatic adsorption, and their fluorescence is quenched by BHQs 1 / 2 / 3 respectively based on the FRET mechanism; the liposome shell assembled by DOTAP, cholesterol, DOPE and DSPE-PEG2000 is conducive to the formation of a dense nanoshell and can assist the delivery of qSiNPs during the fusion process.

[0065] When the liposomal silica nanomultichannel probes were co-incubated with exosomes (EVs) derived from drug-resistant tumor cells, Lipo@qSiNPs@AntRNAs could rapidly release qSiNPs@AntRNAs nanoparticles and indicate the locations of target miRNAs through hybridization of complementary sequences, thus achieving fluorescent tracking and localization of multiple targets within exosomes.

[0066] The method for preparing the liposome silicon nano multi-channel probe for predicting the efficacy of neoadjuvant chemotherapy for breast cancer according to the present invention comprises the following steps:

[0067] S1. Utilization The silica nanoparticles doped with three quenchers were synthesized by the method to obtain qSiNPs, and the qSiNPs were incubated with three different fluorescently labeled oligonucleotide sequences Ant-100, Ant-105 and Ant-224 at 37°C for 45 min. After the incubation, the mixture was centrifuged and the supernatant was discarded to collect the intermediate product qSiNPs@AntRNAs.

[0068] S2, qSiNPs@AntRNAs and Liposome were premixed and vortexed quickly for 10 seconds, followed by incubation at 4°C for 30 minutes. After the incubation, the system was centrifuged at 10,000 g for 12 minutes to remove excess liposome components and obtain the liposome silicon nanomultichannel probe Lipo@qSiNPs@AntRNAs.

[0069] As an optional example, the use The process of synthesizing silica nanoparticles doped with three quenchers on the surface is as follows:

[0070] BHQ1-NHS (50 μL, 0.01 mg mL -1 ), BHQ2-NHS (50μL, 0.01mg·mL -1 ) and BHQ3-NHS (50 μL, 0.01 mg mL -1 ) was dissolved in DMF to form a mixed solution, and the mixed solution was incubated with APTES and 2% DIPEA at 37° C. overnight to obtain a first solution;

[0071] Under continuous stirring, n-hexanol and Triton-X are added to cyclohexane to obtain a second solution, and then TEOS and deionized water are mixed until turbid, added to the second solution, and mixed evenly to form a third solution, and the first solution is added dropwise to the third solution, and after mixing evenly, 25% ammonia solution is added, and finally stirred at room temperature overnight to obtain a fourth solution;

[0072] Acetone was added to the fourth solution to react, and centrifugation was performed after the reaction was completed. The precipitate obtained after the centrifugation was repeatedly washed alternately with ethanol and water to obtain qSiNPs.

[0073] As an optional example, the mass concentration ratio of Ant-100, Ant-105 and Ant-224 is 1:1:1, and the concentrations of all are preferably 0.2 μM.

[0074] As an alternative example, qSiNPs were incubated with three different fluorescently labeled oligonucleotide sequences Ant-100, Ant-105, and Ant-224 at a concentration of 100 μg mL -1 .

[0075] As an optional example, DOTAP cationic liposomes are assembled from DOTAP, cholesterol, DOPE and DSPE-PEG2000, wherein the molar concentration ratio of DOTAP, cholesterol, DOPE and DSPE-PEG2000 is 65:30:3.75:1.25.

[0076] As an optional example, the mass concentration ratio of qSiNPs@AntRNAs to Liposome is 1:1.

[0077] It can be understood that the liposome silicon nano multi-channel probe of the present invention can carry different exosomal miRNAs targets according to the application scenario, so as to predict the efficacy of neoadjuvant chemotherapy for patients with different breast cancer types.

[0078] For better understanding, the present invention is further described below in conjunction with several specific examples, but the preparation process is not limited thereto, and the content of the present invention is not limited thereto.

[0079] Unless otherwise specified, the materials in the examples were prepared according to existing methods or directly purchased from the market.

[0080] Table 1 shows the relevant DNA and RNA sequences in the following examples.

[0081] Table 1. DNA and RNA sequences involved in the test

[0082]

[0083]

[0084] Example 1

[0085] [Target screening of serum exosomal miRNA in patients with TNBC receiving neoadjuvant chemotherapy]

[0086] According to the Miller & Payne (MP) grading system, they were divided into two groups: (1) neoadjuvant chemotherapy-sensitive group, MP grade IV or V; (2) neoadjuvant chemotherapy-resistant group, MP grade I or II.

[0087] Three blood samples were selected from the chemotherapy-sensitive group (MP grade IV), and three blood samples were selected from the chemotherapy-resistant group (MP grade II). The blood samples were collected in anticoagulant blood collection tubes and centrifuged within 1 hour to obtain serum. Serum exosomes were pre-enriched to purify exosomal miRNAs, and the purity, concentration and RNA integrity number (RIN) value were measured for sample quality control.

[0088] Based on CPM-normalized miRNAs, R software was used to screen differentially expressed miRNAs, and the top ten differentially expressed miRNAs were analyzed based on the miRNA target gene database.

[0089] Using miRNA high-throughput sequencing to study isolated serum exosome samples, the screening of clinical samples and miRNA sequencing are shown below. Figure 2 As shown in A, the heat map ( Figure 2 B) and volcano plot ( Figure 2 C) shows 9 upregulated miRNAs among the differentially expressed genes in the sequencing, indicating that these 9 exosomal miRNAs are upregulated in the neoadjuvant chemotherapy-resistant group compared with the sensitive group.

[0090] Subsequently, exosomes were collected and purified from the supernatant of breast cancer cells of MDA-MB-231 (wild-type breast cancer cell line) and MDA-MB23-1 / Taxol (paclitaxel-resistant breast cancer cell line) by ultracentrifugation, and the purified exosomes were subsequently characterized and analyzed.

[0091] The process of isolating exosomes from cell culture supernatant using traditional ultracentrifugation is as follows:

[0092] The cell culture medium was centrifuged at 300g for 10 min, 2000g for 10 min, and 8000g for 30 min to gradually remove dead cells and cell debris; the supernatant was filtered with a 0.22μm filter to remove apoptotic bodies and microvesicles; at 4°C, centrifuged at 110000g for 70 min, the supernatant was discarded, the precipitate was resuspended with PBS, and after a second centrifugation, it was resuspended with 0.01M PBS or ultrapure water to obtain purified exosomes.

[0093] Figure 2qRT-PCR analysis in D showed that the expressions of miR-30a, miR-100, miR-105, miR-224, and miR-767 in the exosomes of MDA-MB23-1 / Taxol were significantly higher than those in the exosomes of MDA-MB-231, among which miR-100, miR-105, and miR-224 ranked the top three.

[0094] In summary, miR-100, miR-105, and miR-224 were identified as exosomal miRNA targets associated with neoadjuvant chemotherapy resistance in TNBC patients.

[0095] Example 2

[0096] [Preparation of Lipo@qSiNPs@AntRNAs]

[0097] BHQ1-NHS (50 μL, 0.01 mg mL -1 ), BHQ2-NHS (50μL, 0.01mg·mL -1 ) and BHQ3-NHS (50 μL, 0.01 mg mL -1 ) was dissolved in DMF to form a mixed solution, and the mixed solution was incubated with APTES and 2% DIPEA at 37°C overnight to obtain solution A.

[0098] At room temperature, maintain a constant stirring speed of 500 rpm, add n-hexanol (1.08 mL) and Triton-X (1.06 mL) into cyclohexane (4.5 mL) to form solution B, mix 60 μL TEOS and 120 μL deionized water until a suspension is formed, and add to solution B to form solution C. After 5 minutes, add solution A dropwise into solution C at a slow rate of addition. After 5 minutes, add 36 μL 25% ammonia solution and stir overnight to obtain solution D.

[0099] 12 mL of acetone was added to solution D, and the reaction was terminated after 5 min. After the reaction, the system was centrifuged at 13000 rpm for 10 min. The precipitate obtained after centrifugation was washed alternately with sewage ethanol and water for 6 times to obtain qSiNPs.

[0100] Ant-224 (0.2 μM), Ant-105 (0.2 μM) and Ant-100 (0.2 μM) were added to qSiNPs (100 μg mL -1 ), the mixed system was incubated at 37°C for 45 min, and after the reaction was completed, the purified qSiNPs@AntRNAs were further obtained by centrifugation and washing.

[0101] DOTAP cationic liposomes (DOTAP, cholesterol, DOPE and DSPE-PEG2000 were assembled at a molar ratio of 65:30:3.75:1.25) were coated on the surface of qSiNPs@AntRNAs. 200 μL qSiNPs@AntRNAs (1 mg mL -1 ) and 200 μL Liposome (1 mg mL -1 ) were premixed and vortexed for 10 seconds, followed by incubation at 4°C for 30 minutes and centrifugation at 10,000 g for 12 minutes to remove excess liposome components in the system to obtain the liposome silicon nanomultichannel probe Lipo@qSiNPs@AntRNAs.

[0102] Example 3

[0103] [In vitro study of liposome-based silicon nanostructured multi-channel probes]

[0104] (1) The probe was characterized by particle size, transmission electron microscopy and Zeta potential. The results are as follows Figure 3 As shown in A-3C. Figure 3 A and 3B show that the size of qSiNPs is about 50.7nm, the size of Liposome is about 91.3nm, and Lipo@qSiNPs@AntRNAs has a spherical morphology and a uniform size of about 122nm. The gradual increase in the diameter of the nanoparticles means that DOTAP liposomes have an excellent performance in delivering quenched silica nanoplatforms, with good stability and satisfactory encapsulation ability.

[0105] Figure 3 C shows that due to the adhesion of APTES to the nanosurface, qSiNPs are positively charged (about 7.3 mV). Ant-224, Ant-105 and Ant-100 are strongly adsorbed to the qSiNPs surface through electrostatic action, which makes qSiNPs@AntRNAs carry a significant negative charge (about -15.3 mV). After the probe is encapsulated by Liposome (about 12.1 mV), it carries a slight positive charge as a whole, about 0.3 mV, indicating that the encapsulation is successful and the synthesis of Lipo@qSiNPs@AntRNAs is successful.

[0106] (2) To evaluate the multiplex detection capability of qSiNPs@AntRNAs, qSiNPs@AntRNAs and free miRNAs (qSiNPs@AntRNAs (100 μg mL -1 ) were incubated with different concentrations of three miRNAs (miR-224, miR-105 and miR-100) for 45 min. Figure 3 As shown in D-3I, its fluorescence intensity increases proportionally with the addition of free miRNAs, indicating that the fluorescent oligonucleotides carried by qSiNPs@AntRNAs completely match and recognize the sequences of free miR-224, miR-105, and miR-100.

[0107] (3) Material loading rate refers to the ratio of the mass of the effective ingredients in the material to the mass of the total ingredients, usually expressed as a percentage. It reflects the content and proportion of the effective ingredients in the material and is an important indicator for measuring material performance and quality.

[0108] First, mixed solutions of Ant-224, Ant-105 and Ant-100 with different concentrations were prepared, and the UV absorbance of the mixed solutions of each concentration was measured to obtain the UV absorbance standard curve of the mixed solutions. -1 ) and a mixed solution of Ant-224 (0.2 μM), Ant-105 (0.2 μM) and Ant-100 (0.2 μM) were incubated for 1 h. The supernatant was retained after centrifugation and the ultraviolet absorbance of the supernatant was measured. The loading rates of qSiNPs for Ant-224, Ant-105 and Ant-100 were obtained by analyzing the absorbance calibration curve, which were 1.41 μmol·g -1 , 0.71 μmol·g -1 , 1.44 μmol·g -1 .

[0109] The above results show that the detection of the three target miRNAs by Lipo@qSiNPs@AntRNAs of the present invention is independent of each other, and there is no obvious fluorescence crosstalk.

[0110] (4) To determine the selectivity of qSiNPs@AntRNA for its target miRNAs, miR-NC, miR-224, miR-105, and miR-100 at a concentration of 80 nM were co-cultured with qSiNPs@AntRNA (0.1 mg mL -1 ) and incubate for 45 min.

[0111] Figure 3 J-3L showed that the interfering sequence miR-NC hardly bound to the nanoparticle surface and produced a fluorescence signal significantly lower than that of the target miRNA, indicating that qSiNPs@AntRNAs retained a high degree of sequence specificity and was able to detect the presence of the target.

[0112] Example 4

[0113] [Study of liposome silicon nanomultichannel probes in exosomes of breast cancer cells]

[0114] (1) Figure 4 As shown in A, the fusion vesicle pattern of the biological probe incubated with exosomes (EVs) is first depicted, and then Figure 4 In B, transmission electron microscopy characterization of exosomes collected from breast cancer cell supernatants and probe-exosome fusion vesicles showed that the diameter of the fusion vesicles was 250 nm to 300 nm when membrane fusion occurred.

[0115] (2) In order to verify that the fluorescence signal is indeed derived from miRNA in exosomes, four groups of experiments were set up for verification: Group 1, Lipo@qSiNPs@AntRNAs; Group 2, qSiNPs@AntRNAs+EVs; Group 3, Lipo@qSiNPs@AntRNAs+miRNAs; Group 4, Lipo@qSiNPs@AntRNAs+EVs. The above four groups were incubated at 37°C for 2h. After the reaction, 100μL of the solution was added to the confocal culture dish, and excited with wavelengths of 494nm, 565nm and 643nm. The fluorescence imaging of the four experimental groups was compared under a confocal microscope.

[0116] like Figure 4 As shown in Figure C, the fluorescence of the first three groups is weak and almost invisible, while the fluorescence of the fourth group is strong. Only a trace amount of fluorescence is detected in the second group. This is because qSiNPs@AntRNAs cannot enter the exosomes protected by the biological membrane, and the weak fluorescence in the third group is due to the encapsulation of the liposome shell blocking the hybridization between the fluorescent oligonucleotides and the free miRNAs; combined with the magnification of the confocal image, the double-layer membrane structure of the fusion vesicle is particularly highlighted, which can prove that the liposome encapsulation design of the present invention can effectively deliver the qSiNPs-based nanoplatform into the biological vesicle exosomes by targeting exosomal miRNAs. The three-color fluorescent imaging not only verifies the effective fusion between the engineered biological probe and the exosomes, but also confirms that the probe can achieve true in situ detection of exosomal miRNAs.

[0117] (3) Further explore whether the liposome silicon nano multichannel probe of the present invention can distinguish MDA-MB-231 (wild-type breast cancer cell line) and MDA-MB23-1 / Taxol (paclitaxel-resistant breast cancer cell line) by detecting miRNAs associated with chemotherapy resistance in exosomes.

[0118] Lipo@qSiNPs@AntRNAs (0.05 mg mL -1 ) and the exosomes from the above two cell sources (0.4 mg mL -1) were incubated at 37°C for 2 h, and the fluorescence intensity of the fusion vesicles at 518 nm, 580 nm, and 668 nm emission waves were analyzed by flow cytometry and fluorescence photometer.

[0119] like Figure 4 As shown in D-4E, flow cytometry analysis showed that the fluorescence signal of exosomes secreted by MDA-MB-231 / Taxol was significantly higher than that of exosomes secreted by MDA-MB-231. Figure 4 Fluorescence microplate reader detection of F-4H and Figure 4 The same results were observed in the confocal fluorescence imaging analysis of I.

[0120] The above results illustrate that the liposome silicon nano multichannel probe of the present invention can detect the relatively high expression of miRNAs related to chemotherapy resistance in MDA-MB-231 / Taxol exosomes. These results are sufficient to show that the liposome silicon nano multichannel probe of the present invention can distinguish paclitaxel-resistant breast cancer cell lines from wild-type breast cancer cell lines, indicating that the probe of the present invention can predict the paclitaxel resistance or sensitivity of TNBC patients based on the expression levels of exosome miR-224, miR-105 and miR-100.

[0121] Example 5

[0122] [Liposome-based silica nanoparticle multichannel probe predicts the efficacy of neoadjuvant chemotherapy in TNBC patients]

[0123] In order to further apply the bioprobe to predict the efficacy of neoadjuvant chemotherapy in TNBC patients, TNBC patients were first divided into two groups according to the MP grading system in the postoperative pathology report: neoadjuvant chemotherapy-sensitive group and neoadjuvant chemotherapy-resistant group. TNBC patients with an age difference of 5 years or less were paired to obtain 3 pairs of age-matched patients. Subsequently, Lipo@qSiNPs@AntRNAs (0.05 mg·mL -1 ) and exosomes from different patients (0.4 mg mL -1 ) were incubated at 37°C for 2 h and analyzed by fluorescence detection using flow cytometry. Figure 5 As shown in A, flow cytometry analysis showed that the fluorescence signal in serum exosomes of patients with neoadjuvant chemotherapy resistance was stronger than that of patients with neoadjuvant chemotherapy sensitivity.

[0124] Serum exosomes were collected from 27 neoadjuvant chemotherapy-resistant TNBC patients and 21 neoadjuvant chemotherapy-sensitive TNBC patients. The expression of serum exosome miR-224, miR-105 and miR-100 was detected by Lipo@qSiNPs@AntRNAs. The results showed that the expression of miR-224, miR-105 and miR-100 in serum exosomes was significantly higher than that in controls. Figure 5The distribution in the 3D scatter plot of B shows obvious clustering differences between the neoadjuvant chemotherapy-sensitive group and the neoadjuvant chemotherapy-resistant group, proving that Lipo@qSiNPs@AntRNAs can identify the response of TNBC patients to neoadjuvant chemotherapy. Therefore, Lipo@qSiNPs@AntRNAs can be used to predict the efficacy of neoadjuvant chemotherapy in TNBC patients.

[0125] like Figure 5 As shown in C, forest plot analysis found that the three channels showed excellent performance in independently distinguishing chemotherapy-sensitive and -resistant states, and the p-values ​​of independent detection of the three channels were all less than 0.05; Figure 5 The receiver operating characteristic (ROC) curve of D-5F provides a more intuitive method to compare the three exosomal miRNAs biomarkers for predicting the efficacy of neoadjuvant chemotherapy for breast cancer. In situ tracking of three fluorescence channels is significantly more sensitive and accurate than detection relying on a single target, which indicates that the exosomal miRNA combination biomarker of the present invention can increase the sensitivity and accuracy of detecting the efficacy of neoadjuvant chemotherapy for breast cancer, and based on this, the liposome silicon nano multi-channel probe of the present invention can be used for simultaneous detection and three-color imaging of multiple miRNAs in TNBC patients, which will be beneficial for evaluating the clinical efficacy of neoadjuvant chemotherapy and making treatment decisions in advance.

[0126] Based on the above tests, it can be seen that the exosome miRNA combination biomarker of the present invention is positively correlated with neoadjuvant chemotherapy resistance. When this combined serum exosome biomarker is applied to the detection of neoadjuvant chemotherapy resistance in real clinical samples, its effect is real and reliable, which is significantly better than a single target or even two targets. In addition, since the target is derived from high-throughput sequencing of clinical patient serum samples, it ensures both sensitivity and specificity of detection and has clinical transformation value.

[0127] On this basis, the liposome silicon nano multi-channel three-color nano detection platform designed by the present invention can realize the synchronous and visualized detection of multiple exosomal miRNAs, and quickly and effectively detect multiple exosomal targets at the same time. The multiple detection and three-color imaging of exosomal miRNAs can effectively assist in eliminating the detection interference of other biological molecules in complex samples (including human serum); at the same time, the delivery system uses the vesicle fusion mechanism to quickly realize the in situ detection of miRNAs in target exosomes by the material, avoiding the degradation and contamination of exosomes caused by chemical or biological extraction. Based on the combined three-indicator exosomal miRNAs biomarker, the intelligent nano response technology of three-color imaging is successfully applied to human serum to screen out breast cancer patients resistant to neoadjuvant chemotherapy, greatly improving the accuracy of NAC efficacy diagnosis.

[0128] By using the liposome silicon nano multi-channel probe of the present invention to detect miRNA combination biomarkers, the sensitivity and accuracy of detecting the efficacy of neoadjuvant chemotherapy for breast cancer can be increased, providing complete and reliable information for the early detection of neoadjuvant chemotherapy resistance, which is beneficial to evaluating the clinical efficacy of neoadjuvant chemotherapy and making treatment decisions in advance.

[0129] Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. A person with ordinary knowledge in the technical field to which the present invention belongs may make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be determined by the definition of the claims.

Claims

1. An exosomal miRNA combination biomarker for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer, characterized in that: The exosomal miRNA combination biomarker includes: miR-100, miR-105 and miR-224.

2. A liposome silicon nano multi-channel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer, characterized in that: The probe is configured with a fluorescently labeled oligonucleotide sequence for tracking and locating the exosomal miRNA combination biomarker of claim 1.

3. The liposome silicon nano multi-channel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer according to claim 2, characterized in that: The probe includes silica nanoparticles, the surface of which is doped with three quenchers to form qSiNPs; the qSiNPs are loaded with three oligonucleotide sequences labeled with fluorescence at different wavelengths to form qSiNPs@AntRNAs, and the surface of qSiNPs@AntRNAs is coated with DOTAP cationic liposomes (Liposome) to form liposome silicon nano multi-channel probe Lipo@qSiNPs@AntRNAs; Among them, the oligonucleotide sequences labeled with three different wavelength fluorescences are Ant-100, Ant-105 and Ant-224, and the three quenchers correspond to three different wavelength fluorescences, so that the fluorescence on the oligonucleotide sequences is quenched by the corresponding quenchers.

4. The liposome silicon nano multi-channel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer according to claim 3, characterized in that: The three quenchers are BHQ1-NHS, BHQ2-NHS and BHQ3-NHS.

5. The liposome silicon nano multi-channel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer according to claim 3, characterized in that: The DOTAP cationic liposome is assembled from DOTAP, cholesterol, DOPE and DSPE-PEG2000.

6. A method for detecting the exosomal miRNA combination biomarker according to claim 1, characterized in that: The steps include: Extracting exosomes from the sample to be tested; Incubate the liposome silicon nano multichannel probe according to any one of claims 2 to 5 with the extracted exosomes at a desired temperature to fuse the liposome silicon nano multichannel probe with the exosomes to form a probe-exosome fusion vesicle, and detect the fluorescence intensity in the probe-exosome fusion vesicle to achieve in situ detection of exosomal miRNA combination biomarkers; Among them, the liposome silicon nano multi-channel probe can quickly release qSiNPs@AntRNAs nanoparticles after fusion with the exosomes. After the oligonucleotide chain is complementary to the target miRNAs in the exosomes, the fluorescent group at the 5' end of the oligonucleotide chain can be separated from the corresponding quencher and emit fluorescence to indicate the position of the target miRNAs, thereby realizing the fluorescence tracking and positioning of multiple targets in the exosomes.

7. A method for preparing a liposome silicon nano multi-channel probe for predicting the efficacy of neoadjuvant chemotherapy for triple-negative breast cancer according to any one of claims 2 to 5, characterized in that: The following steps are involved: S1. Utilization The silica nanoparticles doped with three quenchers were synthesized by the method to obtain qSiNPs, and the qSiNPs were incubated with three different fluorescently labeled oligonucleotide sequences 6FAM_miR-224, TMR_miR-105 and Cy5_miR-100 at the desired temperature. After the incubation, the mixture was centrifuged and the supernatant was discarded to collect the intermediate product qSiNPs@AntRNAs. S2. After premixing qSiNPs@AntRNAs and Liposome, they were vortexed quickly and then incubated. After the incubation, the system was centrifuged to remove excess liposome components to obtain the liposome silicon nano-multichannel probe Lipo@qSiNPs@AntRNAs.

8. The preparation method according to claim 7, characterized in that: The utilization The process of synthesizing silica nanoparticles doped with three quenchers on the surface is as follows: The mixed solution of BHQ1-NHS, BHQ2-NHS and BHQ3-NHS was incubated with APTES and 2% DIPEA at 37°C overnight to obtain a first solution; Under continuous stirring, n-hexanol and Triton-X are added to cyclohexane to obtain a second solution, and then TEOS and deionized water are mixed until turbid, added to the second solution, and mixed evenly to form a third solution, and the first solution is added dropwise to the third solution, and after mixing evenly, 25% ammonia solution is added, and finally stirred at room temperature overnight to obtain a fourth solution; Acetone was added to the fourth solution to react, and centrifugation was performed after the reaction was completed. The precipitate obtained after the centrifugation was repeatedly washed alternately with ethanol and water to obtain qSiNPs.

9. The preparation method according to claim 7, characterized in that: The mass concentration ratio of Ant-100, Ant-105 and Ant-224 is 1:1:

1.

10. The preparation method according to claim 7, characterized in that: The DOTAP cationic liposome is assembled from DOTAP, cholesterol, DOPE and DSPE-PEG2000, wherein the molar concentration ratio of DOTAP, cholesterol, DOPE and DSPE-PEG2000 is 65:30:3.75:1.25.

Images