SiRNA for interfering Tc11a gene expression, core-shell type nano particle as well as preparation method and application of core-shell type nano particle

Abstract

The invention relates to the technical field of biomedicine, in particular to siRNA (small interfering ribonucleic acid) for interfering Tc11a gene expression, a core-shell type nano particle as well as a preparation method and application of the core-shell type nano particle. The invention relates to a method for treating type I diabetes mellitus by using core-shell nanoparticles (siTc11a NPs) of a targeted mouse Tc11a gene on an NOD model mouse, and provides a preparation method of the nanoparticles. The preparation method comprises the following steps: mixing siRNA (small interfering ribonucleic acid) interfering with a Tc11a gene with cationic liposome G0-C14 to obtain a complex; mixing the complex with a polylactic acid-glycolic acid copolymer to obtain a core substance; and mixing the core substance with the lipid polymer to obtain the core-shell nanoparticles. The invention provides a treatment strategy for treating the type I diabetes mellitus through targeted Tcl1a gene regulation and control.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to siRNA for interfering with Tcl1a gene expression, core-shell nanoparticles, and preparation methods and applications thereof. Background Art

[0002] Type 1 diabetes (T1D), also known as insulin-dependent diabetes, is an autoimmune disease characterized by the loss of pancreatic beta cells due to attack by "self" immune cells, resulting in insulin deficiency and, in turn, hyperglycemia. T1D is most often diagnosed in childhood and adolescence, but can occur in people of any age. As the incidence of type 1 diabetes has increased, the peak age of diagnosis has shifted to younger ages. Genetic factors (HLA haplotypes) and environmental factors (viral infections, diet, and gut microbiota) have been implicated in the pathogenesis of T1D, but the mechanisms by which these factors contribute to T1D remain unclear. There is a large body of evidence that the onset and progression of T1D is driven by autoreactivity of immune cells against pancreatic beta cells.

[0003] There is increasing evidence that B cells in immune cells are involved in the early disease process of T1D. In patients with early T1D, a significant increase in the number of B cells in the peripheral blood can be seen, and the same phenotype can also be observed in the NOD (non-obese diabetic) mouse, a disease model of spontaneous T1D. In recent years, more and more articles and data support that in systemic lupus erythematosus, treatment strategies targeting B cells, such as injection of monoclonal antibodies targeting plasma cells, tadalafil and FDA-approved belimumab targeting B cells, have significant effects in the treatment of lupus. The current treatment method for type 1 diabetes is mainly to strictly monitor the patient's glucose and daily exogenous insulin injections. Although these methods are very effective, there is daily compliance and cannot prevent related secondary complications. A new treatment method is needed. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a siRNA that interferes with the expression of the Tcl1a gene, a core-shell nanoparticle, and a preparation method and application thereof. The present invention is a novel treatment method for treating type I diabetes by targeting the regulation of the Tcl1a gene. The Tcl1a gene is an activator that regulates the survival of B cells by regulating the AKT signal transduction pathway in B cells, and has important research significance in the strategy of treating type I diabetes with B cells. The present invention utilizes this core role of the gene and designs a specific nanomaterial, which aims to reduce the killing of pancreatic β cells by B cells by targeting the regulation of the expression of the Tcl1a gene.

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of existing treatment methods. The present invention provides the following technical solutions:

[0006] The invention provides a siRNA for interfering with the expression of Tcl1a gene, wherein the nucleotide sequence of the siRNA is GCACGTGTACTTGGATGAGTT.

[0007] The present invention also provides the use of the siRNA described in the above technical solution in preparing a drug for treating type I diabetes.

[0008] The present invention also provides a method for preparing core-shell nanoparticles encapsulating siRNA targeting the Tcl1a gene, comprising the following steps:

[0009] 1) mixing the siRNA targeting the Tcl1a gene described in the above technical solution with the cationic liposome G0-C14 to obtain a complex;

[0010] 2) mixing the complex obtained in step 1) with polylactic acid-glycolic acid copolymer to obtain a core material;

[0011] 3) Mixing the core material obtained in step 2) with lipid polymer to obtain core-shell nanoparticles.

[0012] Preferably, in step 1), siRNA is mixed with cationic liposome G0-C14 in the form of a solution, and the concentration of the siRNA solution is 0.1 nmol / μL;

[0013] The cationic liposome G0-C14 is mixed with siRNA in the form of a cationic liposome G0-C14 solution, and the concentration of the cationic liposome G0-C14 solution is 5 mg / mL;

[0014] Preferably, the molecular weight of the polylactic acid-co-glycolic acid copolymer in step 2) is 8000Da;

[0015] The polylactic acid-co-glycolic acid copolymer is mixed with the complex in the form of a polylactic acid-co-glycolic acid copolymer solution, wherein the concentration of the polylactic acid-co-glycolic acid copolymer solution is 20 mg / mL;

[0016] Preferably, the lipid polymer in step 3) consists of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine and polyethylene glycol;

[0017] The molecular weight of the lipid polymer is 3400Da;

[0018] The lipid polymer is mixed with the core material in the form of a lipid polymer solution, and the concentration of the lipid polymer solution is 20 mg / mL;

[0019] The present invention also provides core-shell nanoparticles prepared by the preparation method described in the above technical solution, and the particle size of the core-shell nanoparticles is 80nm.

[0020] The present invention also provides the use of the core-shell nanoparticles described in the above technical solution in the preparation of drugs for treating type I diabetes.

[0021] The present invention also provides the use of the core-shell nanoparticles described in the above technical solution in preparing drugs for inhibiting Tcl1a gene expression, inhibiting B cell proliferation and increasing B cell apoptosis.

[0022] The present invention also provides the use of the core-shell nanoparticles described in the above technical solution in the preparation of drugs for restoring the synthesis and secretion of insulin in pancreatic islets of type I diabetes.

[0023] Beneficial effects of the present invention:

[0024] After spontaneous type 1 diabetes NOD mice were injected with siTcl1a NPs, the glucose metabolism function was restored, blood sugar decreased, and the hyperglycemia symptoms were alleviated compared with the spontaneous type 1 diabetes NOD mice injected with PBS. siTcl1aNPs have a good therapeutic effect on the treatment of type 1 diabetes in spontaneous type 1 diabetes NOD mice. After spontaneous type 1 diabetes NOD mice were injected with siTcl1a NPs, the pancreatic islets of spontaneous type 1 diabetes NOD mice were able to restore the ability to synthesize and secrete insulin. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0026] Figure 1 It is a line graph showing the changes in blood glucose within 2 hours after intraperitoneal injection of 10% glucose solution in mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D);

[0027] Figure 2 The flow cytometry detection graph and bar graph are the cell number ratios of B cells in the peripheral blood of mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D) detected by flow cytometry;

[0028] Figure 3 It is a bar graph showing the content of TCL1A protein in peripheral blood of mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D);

[0029] Figure 4The morphology of core-shell nanoparticles (siTcl1a NPs) encapsulated with interfering RNA targeting Tcl1a gene and negatively stained with 2% phosphotungstic acid was taken by transmission electron microscopy (TEM), and the scale bar is 100 nm;

[0030] Figure 5 To count the particle size histograms of empty core-shell nanoparticles without siRNA encapsulated in the core (emptyNPs), core-shell nanoparticles encapsulating ineffective interfering RNA in the core (siCtrlNPs), and siTcl1a NPs;

[0031] Figure 6 The zeta potential statistics of the three particles are shown in Figure 2.

[0032] Figure 7 Statistical graph of the abundance of RNA released by siCtrl NPs and siTcl1aNPs at different pH values;

[0033] Figure 8 The schematic diagram and statistical diagram of the uptake of the three substances by A20 cells detected by flow cytometry after the B cells of the peripheral blood of BALB / c mice were co-cultured with PBS, siCtrl NPs and siTcl1a NPs for 48 hours;

[0034] Fig. 9 It is a bar graph of Tcl1a gene expression in A20 cells after co-culture with PBS, emptyNPs, siCtrl NPs, and siTcl1a NPs for 72 hours;

[0035] Fig.10 The relative growth rate bar graph of A20 cells detected by adding resazurin sodium after A20 cells were co-cultured with PBS, empty NPs, siCtrl NPs and siTcl1a NPs;

[0036] Fig.11 The flow cytometry schematic diagram and bar graph are the apoptotic ratios of A20 cells detected by flow cytometry after A20 cells were co-cultured with PBS, empty NPs, siCtrl NPs and siTcl1a NPs for 72 hours, respectively;

[0037] Fig.12 The bar graphs are the body weight of BALB / c mice before and after injection of PBS, emptyNPs and siTcl1a NPs, respectively, and the bar graphs are the alanine aminotransferase (ALT), aspartyl transferase (AST), serum alkaline phosphatase (ALP), blood urea nitrogen (BUN), serum creatinine (CREA), and total protein (TP) in serum after injection;

[0038] Fig.13 HE staining of the heart, liver, spleen, lung and kidney of different groups of mice after injection of PBS, empty NPs and siTcl1a NPs, the scale bar is 50 μm;

[0039] Fig.14 The figure shows the TCL1A protein content in the peripheral blood of four types of mice after injection of 0.9% saline and siTcl1a NPs into mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D), respectively.

[0040] Fig.15 The flow cytometry detection graph and bar graph of the proportion of B cell numbers in the peripheral blood of four types of mice after injection of 0.9% saline and siTcl1a NPs into mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D) respectively;

[0041] Fig.16 The line graphs of blood glucose changes in intravenous glucose tolerance within 2 hours of the four types of mice before and after injection of 0.9% saline and siTcl1a NPs in mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D), respectively. The left side is the line graph of blood glucose changes in intravenous glucose tolerance within 2 hours of the four types of mice before injection, and the right side is the line graph of blood glucose changes in intravenous glucose tolerance within 2 hours of the four types of mice after injection;

[0042] Fig.17 The left is a bar graph of the blood glucose peaks of the four types of mice within 2 hours of intravenous glucose tolerance before and after injection of 0.9% saline and siTcl1a NPs into mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D). The right is a bar graph of the area under the intravenous glucose tolerance curve of the four types of mice within 2 hours before and after injection of 0.9% saline and siTcl1a NPs into mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D);

[0043] Fig.18 These are immunofluorescence images of insulin and CD45 protein staining in pancreatic specimens of four types of mice after injection of 0.9% saline and siTcl1a NPs into mice without spontaneous type 1 diabetes (Control) and mice with spontaneous type 1 diabetes (T1D), respectively. The scale bar is 50 μm. DETAILED DESCRIPTION

[0044] The invention provides a siRNA for interfering with the expression of Tcl1a gene. The nucleotide sequence of the siRNA is: GCACGTGTACTTGGATGAGTT.

[0045] The present invention also provides the use of the siRNA described in the above technical solution in preparing a drug for treating type I diabetes.

[0046] The present invention also provides a method for preparing core-shell nanoparticles for interfering with Tcl1a gene expression to treat type I diabetes, comprising the following steps:

[0047] 1) mixing the siRNA described in the above technical solution with cationic liposome G0-C14 to obtain a complex;

[0048] 2) mixing the complex obtained in step 1) with polylactic acid-glycolic acid copolymer to obtain a core material;

[0049] 3) mixing the core material obtained in step 2) with a lipid polymer to obtain core-shell nanoparticles. The present invention mixes the siRNA described in the above technical solution with cationic liposome G0-C14 to obtain a complex. In the present invention, the siRNA is preferably dissolved in DEPC water and mixed with the cationic liposome G0-C14 in the form of a siRNA solution, and the concentration of the siRNA solution is preferably 0.1nmol / μL. In the present invention, the cationic liposome G0-C14 is preferably a cationic liposome G0-C14 prepared with dimethylformamide (according to reference 1.Bi Z, Li Q, Dinglin X, et al. Nanoparticles (NPs)-Meditated LncRNA AFAP1-AS1 Silencing to Block Wnt / beta-Catenin Signaling Pathway for Synergistic Reversal of Radioresistance and Effective Cancer Radiotherapy. Adv Sci (Weinh) 2020; 7 (18): 2000915. 2. Huang X, Liu C, Kong N, et al. Synthesis of siRNA nanoparticles to silence plaque-destabilizing gene inatherosclerotic lesional macrophages. Nat Protoc 2022; 17(3): 748-80.) is prepared by the preparation method described in the invention) and mixed with siRNA in the form of a solution, wherein the concentration of the cationic liposome G0-C14 solution is preferably 5 mg / mL. In the present invention, the cationic liposome G0-C14 forms a complex with the negatively charged siRNA through electrostatic interaction, which can improve the loading efficiency of the siRNA.

[0050] The present invention mixes the obtained complex with polylactic acid-glycolic acid copolymer to obtain a core material. In the present invention, the molecular weight of the polylactic acid-glycolic acid copolymer is preferably 8000Da. In the present invention, the polylactic acid-glycolic acid copolymer is preferably configured in 10mL dimethylformamide as a solution and mixed with the complex, and the concentration of the polylactic acid-glycolic acid copolymer solution is preferably 20mg / mL.

[0051] The present invention mixes the obtained core material with a lipid polymer to obtain core-shell nanoparticles. In the present invention, the lipid polymer is preferably composed of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine and polyethylene glycol. In the present invention, the molecular weight of the lipid polymer is preferably 3400Da. In the present invention, the lipid polymer is preferably mixed with the core material in the form of a lipid polymer solution, and the concentration of the lipid polymer solution is preferably 20mg / mL. The present invention uses dimethylformamide to configure the solvent of the lipid polymer solution. After the present invention mixes the obtained core material with the lipid polymer, 5mL of deionized water is preferably added to the mixture under vigorous stirring at 1000 rpm. Subsequently, in order to remove the remaining organic solvent and free compounds, the obtained nanoparticle dispersion is transferred to an ultrafiltration device (molecular weight cutoff 100kDaMWCO, EMD Millipore) and centrifuged. The nanoparticles are resuspended with 1mL PBS (pH 7.4) and then rinsed three times with 5mL PBS.

[0052] The present invention also provides the use of the core-shell nanoparticles described in the above technical solution in the preparation of drugs for treating type I diabetes.

[0053] The present invention also provides the use of the core-shell nanoparticles described in the above technical solution in preparing drugs for inhibiting Tcl1a gene expression, inhibiting B cell proliferation and increasing B cell apoptosis.

[0054] The present invention also provides the use of the core-shell nanoparticles described in the above technical solution in the preparation of drugs for restoring the synthesis and secretion of insulin in pancreatic islets of type I diabetes.

[0055] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0056] Example 1

[0057] The TCL1A protein level in mice with spontaneous type 1 diabetes was found to be significantly increased compared with that in mice without spontaneous type 1 diabetes.

[0058] After all NOD mice were intraperitoneally injected with 1 kg / mL of 10% glucose solution, the blood glucose of the mice was measured by cutting their tails, and the changes in blood glucose of the mice were observed within 2 hours. A line graph of the blood glucose change curve was drawn, as shown in the figure below. Figure 1 As shown, mice can be divided into two groups according to the conditions that the peak blood glucose of the glucose tolerance test (GTT) is greater than 12.5 and the area under the curve (AUC) of the GTT is greater than 1000: mice without spontaneous type 1 diabetes and mice with spontaneous type 1 diabetes.

[0059] The peripheral blood of the two groups of mice was collected and tested by flow cytometry after being labeled with CD45 and CD19. The cell number ratio of B cells in the peripheral blood of the two groups of mice was also statistically analyzed. Figure 2 As shown, it can be seen that the proportion of B cells in the peripheral blood of mice with spontaneous type 1 diabetes is 7.6%, and the proportion of B cells in the peripheral blood of mice without spontaneous type 1 diabetes is 3.26%. It can be inferred that the proportion of B cells in the peripheral blood of mice with spontaneous type 1 diabetes is significantly higher than that of mice without spontaneous type 1 diabetes.

[0060] The peripheral blood of the two groups of mice was collected and the TCL1A protein content in the peripheral blood of the two groups of mice was detected by enzyme-linked immunosorbent assay, and the detection results were statistically analyzed. Figure 3 As shown, the TCL1A protein content in 1 mL of blood of mice with spontaneous type 1 diabetes is about 20 pg, while the TCL1A protein content in 1 mL of blood of mice without spontaneous type 1 diabetes is lower. It can be observed that the TCL1A protein content in the peripheral blood of mice with spontaneous type 1 diabetes is significantly higher than that in the peripheral blood of mice without spontaneous type 1 diabetes.

[0061] Example 2

[0062] Design nanomaterials targeting the expression of the Tcl1a gene, thereby achieving the goal of reducing the expression of this gene in B cells.

[0063] Core-shell nanoparticles (siTcl1a NPs) encapsulated with interfering RNA targeting the Tcl1a gene were obtained by the following preparation method.

[0064] A method for preparing core-shell nanoparticles (siTcl1a NPs) encapsulating interfering RNA targeting the Tcl1a gene comprises the following steps:

[0065] (1) siRNA sequence selection: Based on the siRNA design principles, we selected a 21-nucleotide sequence with a GC content of about 47% for the mouse Tcl1a gene: GCACGTGTACTTGGATGAGTT as siTcl1a RNA. As a control sequence for the siTcl1a RNA sequence, a 21-nucleotide sequence (SEQ ID No. 2): CCTAAGGTTAAGTCGCCCTCG was used as siCtrl RNA.

[0066] (2) siRNA complexed with cationic liposome G0-C14:

[0067] ① Dissolve the siRNA powder in DEPC water to make a siRNA solution with a concentration of 0.1nmol / μL.

[0068] ② Take 10 μL of the above siRNA solution and put it into a 1.5 mL ep tube, then add 50 μL of G0-C14 prepared with dimethylformamide (DMF) at a concentration of 5 mg / mL to form a siRNA / G0-14 complex. Here, the cationic liposome G0-C14 can form a complex with the negatively charged siRNA through electrostatic interaction, which can improve the loading efficiency of siRNA.

[0069] (3) Adding poly(lactic-co-glycolic acid) (PLGA) to the siRNA / G0-14 complex to form a siRNA / G0-C14 / PLGA core:

[0070] ① Use a balance with good precision to accurately weigh 200 mg of polylactic acid-glycolic acid copolymer (PLGA) with a molecular weight of 8000 Da.

[0071] ② Pour 200 mg of PLGA with a molecular weight of 8000 Da into a beaker containing 10 mL of DMF and stir with a magnetic stirrer to prepare a PLGA solution with a concentration of 20 mg / mL. The whole process is carried out in a fume hood.

[0072] ③ Take 150 μL of PLGA solution with a concentration of 20 mg / mL and mix it with the siRNA / G0-14 complex of step (2) to form the siRNA / G0-C14 / PLGA core of the core-shell nanoparticles formed by the polymer-lipid mixture.

[0073] (4) Add DSPE-PEG to the siRNA / GO-C14 / PLGA core to obtain complete core-shell nanoparticles:

[0074] ① Use a balance with good precision to accurately weigh 200 mg of a lipid polymer (DSPE-PEG) with a molecular weight of 3400 Da. The lipid polymer is composed of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) and polyethylene glycol (PEG), wherein the molecular weight of PEG is 3400 Da.

[0075] ② Pour 200 mg of a lipid polymer (DSPE-PEG) with a molecular weight of 3400 Da into a beaker containing 10 mL of DMF and stir with a magnetic stirrer to prepare a lipid polymer (DSPE-PEG) solution with a concentration of 20 mg / mL. The entire process is carried out in a fume hood.

[0076] 3. the lipopolymer (DSPE-PEG) solution that the concentration of 150 μ L is taken is 20mg / mL, mixed with the siRNA / GO-C14 / PLGA core of step (3).Then, under the vigorous stirring of 1000 rev / min, 5mL deionized water is dripped in the mixture.Subsequently, in order to remove remaining organic solvent and free compound, the nanoparticle dispersion obtained is transferred to ultrafiltration device (molecular weight cut-off 100kDaMWCO, EMD Millipore) and centrifuged.The nanoparticle of siRNA load is resuspended with 1mL PBS (pH 7.4), then rinsed three times with 5mL PBS.

[0077] Embodiment 3:

[0078] Characterization of core-shell nanoparticles (siTcl1a NPs) encapsulated with interfering RNA targeting the Tcl1a gene.

[0079] 1. The three synthesized particles, namely, empty core-shell particles (emptyNPs), core-shell nanoparticles encapsulating ineffective interfering RNA (siCtrlNPs), and core-shell nanoparticles encapsulating interfering RNA targeting Tcl1a (siTcl1aNPs), were suspended in 1 mL of ultrapure water and dropped onto a carbon mesh. The three particles were stained with 2% uranyl acetate and allowed to air dry naturally. High-resolution images of the nanoparticles were obtained under a transmission electron microscope (Tecnai G2 Spirit BioTWIN). Figure 4 As shown, the core-shell nanoparticles (siTcl1aNPs) encapsulated with interfering RNA targeting Tcl1a are round in shape, and their particle size is approximately 50 nm under dry conditions.

[0080] 2. After resuspending the three particles in 5 mL of ultrapure water, the particle size, polydispersity index (PDI), and Zeta potential of the three particles were measured by dynamic light scattering (DLS). Figure 5 As shown in the figure, the average particle size of the three particles is between 50-100nm, and the polydispersity index is almost the same. The smaller the particle size of the nanoparticles, the larger the specific surface area, and the stronger the interaction with the surrounding environment. The smaller the PDI, the more uniform the particle size distribution of the nanoparticles in the sample. Figure 5 It can be observed that the diameter of the three nanoparticles suspended in ultrapure water is about 80nm and the average PDI is about 0.08. It can be seen that the particle size and specific surface area of ​​the three nanoparticles are similar, and they can be evenly distributed in ultrapure water. Figure 6As shown, these three particles are all in a state of high Zeta potential (absolute value >|30|mV), indicating that the electrostatic repulsion between the nanoparticles is strong, the particles are not easy to agglomerate, and the system is relatively stable.

[0081] 3. To determine the siRNA release rate of siCtrl NPs and siTcl1a NPs at different pH values, the ineffective interfering RNA and the interfering RNA targeting the Tcl1a gene were respectively labeled with Cy5 fluorescent dye, and then the above synthesis steps were used to synthesize two fluorescently labeled nanoparticles. 5 μL of Cy5-labeled siCtrl NPs solution and Cy5-labeled siTcl1a NPs solution were mixed with 20 times DMSO to prepare standards. The fluorescence intensity of Cy5 in the two nanoparticle solutions was measured using an ELISA instrument, and the cumulative release of siRNA was calculated:

[0082] Cumulative release (%) = (Mt / M0) × 100%

[0083] Wherein, Mt is the amount of siRNA released from the nanoparticle solution at time t, and M0 is the amount of siRNA encapsulated in the nanoparticle solution.

[0084] like Figure 7 As shown, under the same pH conditions, the siRNA release from the core-shell of siCtrl NPs and siTcl1a NPs was approximately 40% to 60%, with almost no difference, proving that both materials have good stability.

[0085] Example 4

[0086] Function of siTcl1a NPs.

[0087] 1. Uptake of designed nanomaterials by B cells:

[0088] Peripheral blood mononuclear cells were extracted from BALB / c mice. After being co-cultured with PBS, siCtrl NPs with Cy5 fluorescent dye, and siTcl1a NPs with Cy5 fluorescent dye in vitro for 48 hours, the expression of CD19 was detected by flow cytometry. + Cy5 in B cells + The ratio of Figure 8 As shown, by counting the CD19 + Cy5 in B cells + From the ratio, it can be seen that compared with PBS without nanoparticles, the B cells in the peripheral blood of BALB / c mice have the ability to take up a large amount of core-shell nanoparticles formed by this polymer-lipid mixture, and the uptake amount is above 95%, with almost no difference.

[0089] 2. siTcl1a NPs have the ability to effectively interfere with Tcl1a gene expression, inhibit B cell proliferation rate, and increase the proportion of B cell apoptosis:

[0090] In vitro, the A20 cell line, which is commonly used to simulate mouse B cells, was co-cultured with PBS, empty NPs, siCtrl NPs, and siTcl1a NPs for 72 hours. The expression of Tcl1a gene in A20 cells was detected by real-time fluorescence quantitative PCR, the relative proliferation rate of A20 cells was detected by measuring the absorbance of cells after adding resazurin sodium, and the expression of Annexin V in A20 cells was detected by flow cytometry. + PI + The apoptotic ratio of A20 cells was detected by the cell number ratio method.

[0091] like Fig. 9 As shown, after A20 cells were co-cultured with siTcl1aNPs, PBS and the other two nanoparticles for 72 hours, the relative expression level of Tcl1a gene in A20 cells co-cultured with PBS and the other two nanoparticles was around 1.0, and only in A20 cells co-cultured with siTcl1aNPs did the relative expression level of Tcl1a gene drop to around 0.5. By comparing the four sets of data, it can be seen that siTcl1aNPs particles have the ability to effectively interfere with the expression of Tcl1a gene.

[0092] like Fig.10 As shown, after the third day of co-culture, the relative proliferation rate of A20 cells co-cultured with PBS and the other two nanoparticles was consistently higher than the relative proliferation rate of A20 cells co-cultured with siTcl1a NPs. It can be inferred that siTcl1a NPs can inhibit the proliferation rate of B cells compared with PBS and the other two nanoparticles.

[0093] like Fig.11 As shown in Figure 2, on the fifth day of co-culture, AnnexinV and PI proteins were stained and then flow cytometry was performed. It can be seen that AnnexinV of A20 cells co-cultured with siTcl1a NPs + The proportion was about 25%, significantly higher than that of the other three groups of AnnexinV + Therefore, it can be concluded that siTcl1a NPs can accelerate the apoptosis of B cells compared with PBS and the other two nanoparticles.

[0094] In summary, siTcl1a NPs can be taken up by B cells in large quantities, and can effectively interfere with the expression of Tcl1a gene, inhibit B cell proliferation, and accelerate B cell apoptosis.

[0095] Example 5

[0096] Safety of siTcl1a NPs.

[0097] Fifteen BALB / c mice were selected and divided into three groups, with 5 mice in each group. The three groups of mice were injected with 200μL PBS, 200uL empty NPs, and 200μL containing 1nmol siTcl1a NPs every other day. After 7 injections, the sera of the three groups of mice were collected for the detection of blood biochemical indices, and the heart, liver, spleen, lung, and kidney specimens were collected, fixed with 4% PFA, made into paraffin sections, and stained with HE.

[0098] like Fig.12 As shown, the body weight of the three groups of mice before and after injection was about 28g, and there was no significant change among the groups. In addition, the serum of the three groups of mice was collected and the following indicators were tested: alanine aminotransferase (ALT) for evaluating liver cell damage, aspartyl transferase (AST) for evaluating the health of the liver, bile duct and bones, serum alkaline phosphatase (ALP) for evaluating the health of the liver and heart, blood urea nitrogen (BUN) and serum creatinine (CREA) for evaluating renal function, and total protein (TP) in serum for evaluating overall nutritional status, liver function and chronic diseases. Among them, the ALT concentration in the serum of the three groups of mice was about 50U / L, the AST concentration was about 150U / L, and the ALP concentration was about 110U / L, all of which did not change significantly. The BUN concentration in the serum of the three groups of mice was about 15mg / dL, the CREA concentration was about 24μmol / L, and the total protein concentration was about 58g / L, all of which did not change significantly.

[0099] like Fig.13 As shown, no obvious damage was observed in the HE staining of the heart, liver, spleen, lung, and kidney of the three groups of mice collected after injection.

[0100] In summary, siTcl1a NPs have good safety.

[0101] Example 6

[0102] The content of TCL1A protein in the peripheral blood of NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes after injection of siTcl1a NPs.

[0103] NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes were selected, and 200 μL PBS and 200 μL 1 nmol siTcl1a NPs were injected 7 times every other day. Peripheral blood samples were collected from the four groups of mice, and peripheral blood mononuclear cells were extracted for ELISA detection of TCL1A protein. Fig.14 As shown, the TCL1A protein content in the peripheral blood of NOD mice with spontaneous type I diabetes injected with 1 mL of PBS is about 60 pg, while the TCL1A protein content in the peripheral blood of NOD mice with spontaneous type I diabetes injected with siTcl1a NPs is about 8 pg, and the TCL1A protein content in the NOD mice without spontaneous type I diabetes (including those injected with PBS and those injected with siTcl1a NPs) is about 7 pg. Therefore, it can be inferred that the TCL1A protein in the peripheral blood of NOD mice with spontaneous type I diabetes injected with PBS is significantly higher than that of NOD mice without spontaneous type I diabetes, and the TCL1A protein content in the peripheral blood of NOD mice with spontaneous type I diabetes injected with siTcl1a NPs is significantly lower than that of NOD mice with spontaneous type I diabetes injected with PBS, and there is basically no significant difference compared with NOD mice without spontaneous type I diabetes. This result suggests that siTcl1aNPs can effectively interfere with the expression of Tcl1a gene in NOD mice, thereby reducing the expression of TCL1A protein.

[0104] Example 7

[0105] After siTcl1a NPs were injected into NOD mice without spontaneous type 1 diabetes and NOD mice with spontaneous type 1 diabetes, the proportion of B cells in the peripheral blood of NOD mice with spontaneous type 1 diabetes was significantly reduced.

[0106] NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes were selected, and 200 μL PBS and 200 μL 1 nmol siTcl1a NPs were injected 7 times every other day. Peripheral blood samples were collected from the four groups of mice, and peripheral blood mononuclear cells were extracted. After CD45 and CD19 staining, total B cells in the peripheral blood of the four groups of mice were detected by flow cytometry. Fig.15 As shown, the proportion of B cells in the peripheral blood of NOD mice with spontaneous type 1 diabetes injected with PBS was about 13%, which was significantly higher than the proportion of B cells in NOD mice without spontaneous type 1 diabetes (3%), while the proportion of B cells in the peripheral blood of NOD mice with spontaneous type 1 diabetes injected with siTcl1a NPs was about 3%, which was significantly lower than the proportion of B cells in NOD mice with spontaneous type 1 diabetes injected with PBS, and there was basically no significant difference compared with NOD mice without spontaneous type 1 diabetes.

[0107] In summary, it can be concluded that injection of siTcl1a NPs into spontaneous type I diabetic NOD mice can effectively inhibit B cell proliferation in vivo, which is consistent with the results of the in vitro experiment, namely Example 4.

[0108] Example 8

[0109] After NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes were injected with siTcl1a NPs, the blood glucose changes in intravenous glucose tolerance, blood glucose peaks, and the area under the curve of the blood glucose change line graph of the two groups of mice were detected within 2 hours.

[0110] NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes were selected, and injected with 200 μL PBS and 200 μL 1 nmol siTcl1a NPs 7 times at a frequency of every other day. Then, 1 kg / mL 10% glucose solution was injected intraperitoneally into the four groups of mice, and the blood glucose changes of the mice were detected within 2 hours. Fig.16 The figure shows the changes in blood glucose in the four groups of mice within 2 hours before and after injection. Fig.17 The bar graph shows the blood sugar peaks of the mice in each group before and after injection and the area under the curve of the blood sugar change line graph within 2 hours. Fig.16 and Fig.17 It can be observed that after injection of siTcl1a NPs into NOD mice with spontaneous type 1 diabetes, the peak blood glucose of GTT decreased from 13mmol / L before injection to about 7mmol / L, and the AUC of GTT decreased from 1100 to about 500, which was almost indistinguishable from the NOD mice without spontaneous type 1 diabetes (including those injected with PBS and those injected with siTcl1a NPs); while for NOD mice with spontaneous type 1 diabetes injected with PBS, both the peak blood glucose of GTT and AUC continued to increase. Therefore, it can be inferred that after injection of siTcl1a NPs into NOD mice with spontaneous type 1 diabetes, the peak blood glucose in the intravenous glucose tolerance test within 2 hours was significantly reduced compared with that of NOD mice with spontaneous type 1 diabetes injected with an equal volume of PBS, and there was almost no difference in the peak blood glucose of NOD mice without spontaneous type 1 diabetes. Similarly, after spontaneous type 1 diabetic NOD mice were injected with siTcl1a NPs, the AUC of the blood glucose change line graph of this group of mice was significantly lower than the AUC of spontaneous type 1 diabetic NOD mice injected with an equal volume of PBS, and had almost no difference from the AUC of NOD mice without spontaneous type 1 diabetes.

[0111] In summary, it can be seen that after spontaneous type 1 diabetes NOD mice were injected with siTcl1a NPs, the glucose metabolism function was restored, blood sugar decreased, and the hyperglycemia symptoms were alleviated compared with the spontaneous type 1 diabetes NOD mice injected with PBS. siTcl1a NPs has a good therapeutic effect on the treatment of type 1 diabetes in spontaneous type 1 diabetes NOD mice.

[0112] Example 9

[0113] The number of insulin-containing islet structures and infiltrating immune cells in the pancreatic specimens of NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes after injection of siTcl1a NPs.

[0114] NOD mice without spontaneous type 1 diabetes and spontaneous type 1 diabetes were selected, and 200 μL PBS and 200 μL 1 nmol siTcl1a NPs were injected 7 times every other day. The pancreatic islet specimens of the four groups of mice were collected, and the number of insulin-containing islet structures and the number of infiltrating immune cells in the pancreatic islet specimens were detected by immunofluorescence. Fig.18 As shown, pancreatic specimens of NOD mice with spontaneous type 1 diabetes injected with PBS contained a large number of infiltrating immune cells, while pancreatic specimens of NOD mice with spontaneous type 1 diabetes injected with siTcl1aNPs and NOD mice without spontaneous type 1 diabetes (including those injected with PBS and those injected with siTcl1aNPs) contained almost no infiltrating immune cells. According to statistics, the number of insulin-containing islet structures in pancreatic specimens of NOD mice with spontaneous type 1 diabetes injected with PBS was significantly lower than that of NOD mice without spontaneous type 1 diabetes, while the number of insulin-containing islet structures in pancreatic specimens of NOD mice with spontaneous type 1 diabetes injected with siTcl1a NPs increased significantly compared with NOD mice with spontaneous type 1 diabetes injected with PBS, and there was basically no significant difference compared with NOD mice without spontaneous type 1 diabetes.

[0115] In summary, it can be concluded that injection of siTcl1a NPs into NOD mice with spontaneous type 1 diabetes can slow down the infiltration of immune cells and restore the islets of NOD mice with spontaneous type 1 diabetes to synthesize and secrete insulin.

[0116] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A siRNA for interfering with Tcl1a gene expression, wherein the nucleotide sequence of the siRNA is shown in SEQ ID No.

1.

2. Use of the siRNA according to claim 1 in the preparation of a drug for treating type 1 diabetes.

3. A method for preparing core-shell nanoparticles encapsulating siRNA targeting Tcl1a gene, characterized in that: The following steps are involved: 1) mixing the siRNA targeting the Tcl1a gene according to claim 1 with cationic liposome G0-C14 to obtain a complex; 2) mixing the complex obtained in step 1) with polylactic acid-glycolic acid copolymer to obtain a core material; 3) Mixing the core material obtained in step 2) with lipid polymer to obtain core-shell nanoparticles.

4. The preparation method according to claim 3, characterized in that: In the step 1), siRNA is mixed with cationic liposome G0-C14 in the form of a solution, and the concentration of the siRNA solution is 0.1 nmol / μL; The cationic liposome G0-C14 is mixed with siRNA in the form of a cationic liposome G0-C14 solution, and the concentration of the cationic liposome G0-C14 solution is 5 mg / mL.

5. The preparation method according to claim 3 or 4, characterized in that: The molecular weight of the polylactic acid-co-glycolic acid in step 2) is 8000Da; The polylactic acid-co-glycolic acid is mixed with the complex in the form of a polylactic acid-co-glycolic acid solution, and the concentration of the polylactic acid-co-glycolic acid solution is 20 mg / mL.

6. The preparation method according to claim 3 or 4, characterized in that: In step 3), the lipid polymer consists of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine and polyethylene glycol; The molecular weight of the lipid polymer is 3400Da; The lipopolymer is mixed with the core material in the form of a lipopolymer solution, and the concentration of the lipopolymer solution is 20 mg / mL.

7. A core-shell nanoparticle prepared by the preparation method according to any one of claims 3 to 6, wherein the particle size of the core-shell nanoparticle is 80 nm.

8. Use of the core-shell nanoparticles according to claim 7 in the preparation of a drug for treating type I diabetes.

9. Use of the core-shell nanoparticles according to claim 7 in preparing drugs for inhibiting Tcl1a gene expression, inhibiting B cell proliferation and increasing B cell apoptosis.

10. Use of the core-shell nanoparticles according to claim 7 in preparing a drug for restoring the synthesis and secretion of insulin in pancreatic islets of type I diabetes.

Images